MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-221L21
Chromosome	6 (Build37)
Map Location	124,509,938 - 124,510,505
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG546913, LOC100043516, EG435916, EG243628, EG545874, LOC384484, LOC623282, V2r1b, EG384486, Vmn2r-ps34, Vmn2r27, LOC623374, EG622297, Cd163, LOC100043530, 1700013D24Rik, 1700027F06Rik, 1700060L04Rik, Pex5, Clstn3, C1rl, C1r, C1s
Downstream gene	LOC667277, EG317677, Mboat5, Emg1, Phb2, Ptpn6, Grcc10, Atn1, Eno2, Lrrc23, Spsb2, Tpi1, Usp5, Cdca3, Gnb3, Leprel2, Gpr162, Cd4, Lag3, Ptms, Mlf2, EG667343, Cops7a, C530028O21Rik, Zfp384, Ing4, Acrbp, Gpr92, Chd4, Nol1, A930037G23Rik, Gapdh, Ncapd2, Mrpl51, Vamp1, Tapbpl, Cd27, 4930417O13Rik, Tuba3a, Ltbr, Scnn1a, Tnfrsf1a, Plekhg6, Cd9, Vwf
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG546913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546913 MGI:3647952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100043516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG435916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435916 MGI:3646826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG243628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243628 MGI:3647530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG545874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545874 MGI:3644645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 23 Proteins

name	LOC384484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC623282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	V2r1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56552 MGI:2678394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384486 MGI:3645579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	Vmn2r-ps34 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC623374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	EG622297 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622297 MGI:3648854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	Cd163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93671 MGI:2135946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1700013D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76921 MGI:1924171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 1 Protein

name	1700027F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72268 MGI:1919518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1700060L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73378 MGI:1920628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Pex5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19305 MGI:1098808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Clstn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232370 MGI:2178323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1rl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232371 MGI:2660692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50909 MGI:1355313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50908 MGI:1355312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 143 ESTs, 22 Proteins

name	EG317677 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317677 MGI:3644269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mboat5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14792 MGI:1315211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14791 MGI:1315195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12034 MGI:102520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15170 MGI:96055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Grcc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14790 MGI:1315201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13498 MGI:104725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eno2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13807 MGI:95394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16977 MGI:1315192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spsb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14794 MGI:1315199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21991 MGI:98797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22225 MGI:1347343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14793 MGI:1315198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14695 MGI:95785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leprel2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14789 MGI:1315208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr162 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14788 MGI:1315214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12504 MGI:88335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16768 MGI:106588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptms (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69202 MGI:1916452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30853 MGI:1353554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667343 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667343 MGI:3647015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cops7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26894 MGI:1349400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530028O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319352 MGI:2441908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp384 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269800 MGI:2443203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ing4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28019 MGI:107307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acrbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54137 MGI:1859515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381810 MGI:2685918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 12 Proteins

name	Chd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107932 MGI:1344380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110109 MGI:107891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930037G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320678 MGI:2444516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gapdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14433 MGI:95640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncapd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68298 MGI:1915548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66493 MGI:1913743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22317 MGI:1313276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tapbpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213233 MGI:2384853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930417O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73870 MGI:1921120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs

name	Tuba3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22144 MGI:1095406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17000 MGI:104875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scnn1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20276 MGI:101782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21937 MGI:1314884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213522 MGI:2682298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12527 MGI:88348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22371 MGI:98941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255420 GeneID:546913 MGI:3647952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG546913 transcript_id : XM_621729.4

name	LOC100043516 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255314 GeneID:100043516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to gag transcript_id : XM_001480348.1

name	EG435916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63548770 GeneID:435916 MGI:3646826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG435916 transcript_id : XM_487960.2

name	EG243628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83029659 GeneID:243628 MGI:3647530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG243628 transcript_id : XM_144968.5

name	EG545874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255422 GeneID:545874 MGI:3644645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 23 Proteins product : predicted gene, EG545874 transcript_id : XM_620361.4

name	V2r1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392100 GeneID:56552 MGI:2678394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 1b transcript_id : NM_019917.2

name	EG384486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255317 GeneID:384486 MGI:3645579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG384486 transcript_id : XM_001480355.1

name	LOC623374 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255320 GeneID:623374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to putative glialblastoma cell differentiation-related transcript_id : XM_001480361.1

name	Cd163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716384 GeneID:93671 MGI:2135946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD163 antigen transcript_id : NM_053094.1

name	1700013D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255423 GeneID:76921 MGI:1924171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 1 Protein product : RIKEN cDNA 1700013D24 gene transcript_id : XM_989548.2

name	1700027F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378104 GeneID:72268 MGI:1919518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700027F06 gene transcript_id : XM_989580.1

name	1700060L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255325 GeneID:73378 MGI:1920628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700060L04 gene transcript_id : XM_001480369.1

name	Pex5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930736 GeneID:19305 MGI:1098808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 5 transcript_id : NM_008995.2

name	Pex5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930729 GeneID:19305 MGI:1098808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 5 transcript_id : NM_175933.2

name	Clstn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803023 GeneID:232370 MGI:2178323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calsyntenin 3 transcript_id : NM_153508.3

name	C1rl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649724 GeneID:232371 MGI:2660692
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, r subcomponent-like transcript_id : NM_181344.4

name	C1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990159 GeneID:50909 MGI:1355313
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, r subcomponent transcript_id : NM_023143.2

name	C1s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450096 GeneID:50908 MGI:1355312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, s subcomponent transcript_id : NM_144938.1

name	LOC667277 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94378098 GeneID:667277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 143 ESTs, 22 Proteins product : similar to complement component C1rb, transcript variant 2 transcript_id : XM_001002804.1

name	EG317677 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341088 GeneID:317677 MGI:3644269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG317677 transcript_id : NM_173864.2

name	Mboat5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21699057 GeneID:14792 MGI:1315211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane bound O-acyltransferase domain containing 5 transcript_id : NM_145130.1

name	Emg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305108 GeneID:14791 MGI:1315195
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EMG1 nucleolar protein homolog (S. cerevisiae) transcript_id : NM_013536.1

name	Phb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723335 GeneID:12034 MGI:102520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prohibitin 2 transcript_id : NM_007531.2

name	Ptpn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130784 GeneID:15170 MGI:96055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 6 transcript_id : NM_001077705.1

name	Ptpn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130770 GeneID:15170 MGI:96055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 6 transcript_id : NM_013545.2

name	Grcc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305106 GeneID:14790 MGI:1315201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene rich cluster, C10 gene transcript_id : NM_013535.1

name	Atn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059493 GeneID:13498 MGI:104725
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : atrophin 1 transcript_id : NM_007881.4

name	Eno2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982744 GeneID:13807 MGI:95394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enolase 2, gamma neuronal transcript_id : NM_013509.2

name	Lrrc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305240 GeneID:16977 MGI:1315192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 23 transcript_id : NM_013588.1

name	Spsb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305112 GeneID:14794 MGI:1315199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splA/ryanodine receptor domain and SOCS box containing 2 transcript_id : NM_013539.1

name	Tpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678412 GeneID:21991 MGI:98797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triosephosphate isomerase 1 transcript_id : NM_009415.1

name	Usp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305618 GeneID:22225 MGI:1347343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 5 (isopeptidase T) transcript_id : NM_013700.1

name	Cdca3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801801 GeneID:14793 MGI:1315198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 3 transcript_id : NM_013538.4

name	Gnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20502975 GeneID:14695 MGI:95785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, beta 3 transcript_id : NM_013530.1

name	Leprel2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129907 GeneID:14789 MGI:1315208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leprecan-like 2 transcript_id : NM_013534.4

name	Gpr162 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129911 GeneID:14788 MGI:1315214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 162 transcript_id : NM_013533.3

name	Cd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892562 GeneID:12504 MGI:88335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD4 antigen transcript_id : NM_013488.2

name	Lag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678653 GeneID:16768 MGI:106588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte-activation gene 3 transcript_id : NM_008479.1

name	Ptms (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62460365 GeneID:69202 MGI:1916452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parathymosin transcript_id : NM_026988.1

name	Mlf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703769 GeneID:30853 MGI:1353554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid leukemia factor 2 transcript_id : NM_145385.1

name	Cops7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242141 GeneID:26894 MGI:1349400
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 7a (Arabidopsis thaliana) transcript_id : NM_012003.1

name	C530028O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352542 GeneID:319352 MGI:2441908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530028O21 gene transcript_id : NM_175696.3

name	Zfp384 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126352390 GeneID:269800 MGI:2443203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 384 transcript_id : NM_175557.4

name	Ing4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387601 GeneID:28019 MGI:107307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of growth family, member 4 transcript_id : NM_133345.2

name	Acrbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8392844 GeneID:54137 MGI:1859515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proacrosin binding protein transcript_id : NM_016845.1

name	Gpr92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255424 GeneID:381810 MGI:2685918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 12 Proteins product : G protein-coupled receptor 92 transcript_id : XM_355812.4

name	Chd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130239 GeneID:107932 MGI:1344380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 4 transcript_id : NM_145979.2

name	Nol1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27819666 GeneID:110109 MGI:107891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 1 transcript_id : NM_138747.1

name	A930037G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179301 GeneID:320678 MGI:2444516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930037G23 gene transcript_id : NM_178787.5

name	A930037G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345130 GeneID:320678 MGI:2444516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930037G23 gene transcript_id : NM_001039669.2

name	Gapdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012538 GeneID:14433 MGI:95640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyceraldehyde-3-phosphate dehydrogenase transcript_id : NM_008084.2

name	Ncapd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165391 GeneID:68298 MGI:1915548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC condensin I complex, subunit D2 transcript_id : NM_146171.1

name	Mrpl51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801993 GeneID:66493 MGI:1913743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L51 transcript_id : NM_025595.2

name	Vamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702072 GeneID:22317 MGI:1313276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 1 transcript_id : NM_001080557.1

name	Vamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702046 GeneID:22317 MGI:1313276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 1 transcript_id : NM_009496.3

name	Tapbpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703781 GeneID:213233 MGI:2384853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein-like transcript_id : NM_145391.1

name	Cd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350002 GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD antigen 27 transcript_id : NM_001042564.1

name	Cd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350005 GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD antigen 27 transcript_id : NM_001033126.2

name	4930417O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255426 GeneID:73870 MGI:1921120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs product : RIKEN cDNA 4930417O13 gene transcript_id : XM_001481089.1

name	Tuba3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431225 GeneID:22144 MGI:1095406
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 3A transcript_id : NM_009446.2

name	Ltbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227254 GeneID:17000 MGI:104875
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphotoxin B receptor transcript_id : NM_010736.2

name	Scnn1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859617 GeneID:20276 MGI:101782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, nonvoltage-gated, type I, alpha transcript_id : NM_011324.1

name	Tnfrsf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227249 GeneID:21937 MGI:1314884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 1a transcript_id : NM_011609.3

name	Plekhg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348453 GeneID:213522 MGI:2682298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 6 transcript_id : NM_198604.1

name	Cd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271531 GeneID:12527 MGI:88348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD9 antigen transcript_id : NM_007657.3

name	Vwf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511021 GeneID:22371 MGI:98941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Von Willebrand factor homolog transcript_id : NM_011708.3

name	EG546913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255421 GeneID:546913 MGI:3647952
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_621729.4

name	LOC100043516 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255315 GeneID:100043516
definition	codon_start : 1 product : similar to gag protein_id : XP_001480398.1

name	EG435916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63548771 GeneID:435916 MGI:3646826
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_487960.2

name	EG243628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029660 GeneID:243628 MGI:3647530
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_144968.5

name	EG545874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029664 GeneID:545874 MGI:3644645
definition	codon_start : 1 product : similar to Vomeronasal type-2 receptor 1b precursor (Putative pheromone receptor V2R1b) protein_id : XP_620361.2

name	V2r1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392101 CCDS:CCDS20515.1 GeneID:56552 MGI:2678394
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : tissue-type vomeronasal neurons putative pheromone receptor V2R1 product : vomeronasal 2, receptor, 1b protein_id : NP_064301.2

name	EG384486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255318 GeneID:384486 MGI:3645579
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_001480405.1

name	LOC623374 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255321 GeneID:623374
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480411.1

name	Cd163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716385 CCDS:CCDS20516.1 GeneID:93671 MGI:2135946
definition	GO_function : GO:0005044 - scavenger receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD163 antigen protein_id : NP_444324.1

name	1700013D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378103 GeneID:76921 MGI:1924171
definition	codon_start : 1 product : hypothetical protein LOC76921 protein_id : XP_994642.1

name	1700027F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378105 GeneID:72268 MGI:1919518
definition	codon_start : 1 product : hypothetical protein LOC72268 protein_id : XP_994674.1

name	1700060L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255326 GeneID:73378 MGI:1920628
definition	codon_start : 1 product : hypothetical protein LOC73378 protein_id : XP_001480419.1

name	Pex5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28565271 CCDS:CCDS20518.1 GeneID:19305 MGI:1098808
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0000268 - peroxisome targeting sequence binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001764 - neuron migration [Evidence IMP]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] [Evidence IDA]; GO:0006625 - protein targeting to peroxisome [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; peroxisome receptor 1; peroxin 5 product : peroxin 5 isoform 2 protein_id : NP_787947.1

name	Pex5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930737 CCDS:CCDS20517.1 GeneID:19305 MGI:1098808
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0000268 - peroxisome targeting sequence binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001764 - neuron migration [Evidence IMP]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] [Evidence IDA]; GO:0006625 - protein targeting to peroxisome [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; peroxisome receptor 1; peroxin 5 product : peroxin 5 isoform 1 protein_id : NP_033021.2

name	Clstn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943822 CCDS:CCDS20519.1 GeneID:232370 MGI:2178323
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : calsyntenin 3 protein_id : NP_705728.1

name	C1rl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649725 CCDS:CCDS20520.1 GeneID:232371 MGI:2660692
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : C1r-like protein; complement component 1, r subcomponent like protein product : complement component 1, r subcomponent-like protein_id : NP_851989.2

name	C1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62990160 CCDS:CCDS20521.1 GeneID:50909 MGI:1355313
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003815 - complement component C1r activity [Evidence IEA]; GO:0003816 - complement component C1s activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : complement component 1, r subcomponent, b; complement component C1RB product : complement component 1, r subcomponent protein_id : NP_075632.2

name	C1s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450097 GeneID:50908 MGI:1355312
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003816 - complement component C1s activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease; complement component C1SA product : complement component 1, s subcomponent protein_id : NP_659187.1

name	LOC667277 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94378099 GeneID:667277
definition	codon_start : 1 product : similar to complement component C1rb isoform 2 protein_id : XP_001002804.1

name	EG317677 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27805393 CCDS:CCDS20522.1 GeneID:317677 MGI:3644269
definition	codon_start : 1 product : complement component C1SB protein_id : NP_776289.1

name	Mboat5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699058 CCDS:CCDS20523.1 GeneID:14792 MGI:1315211
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : putative transmembrane protein PTG; gene rich cluster, C3f product : O-acyltransferase (membrane bound) domain containing 5 protein_id : NP_660112.1

name	Emg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305109 CCDS:CCDS20524.1 GeneID:14791 MGI:1315195
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 note : gene rich cluster, C2f product : EMG1 nucleolar protein homolog protein_id : NP_038564.1

name	Phb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723336 GeneID:12034 MGI:102520
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0030331 - estrogen receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016566 - specific transcriptional repressor activity [Evidence IDA] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : repressor of estrogen receptor activity product : B-cell receptor-associated protein 37 protein_id : NP_031557.2

name	Ptpn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130785 GeneID:15170 MGI:96055
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0001784 - phosphotyrosine binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence TAS]; GO:0007242 - intracellular signaling cascade [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; hemopoietic cell phosphatase product : protein tyrosine phosphatase, non-receptor type 6 isoform b protein_id : NP_001071173.1

name	Ptpn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130771 GeneID:15170 MGI:96055
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0001784 - phosphotyrosine binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence TAS]; GO:0007242 - intracellular signaling cascade [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; hemopoietic cell phosphatase product : protein tyrosine phosphatase, non-receptor type 6 isoform a protein_id : NP_038573.2

name	Grcc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305107 CCDS:CCDS20525.1 GeneID:14790 MGI:1315201
definition	codon_start : 1 note : B-cell receptor-associated protein 37 product : C10 protein protein_id : NP_038563.1

name	Atn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328110 CCDS:CCDS20526.1 GeneID:13498 MGI:104725
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0050827 - toxin receptor binding [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IGI] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0009404 - toxin metabolism [Evidence IDA] codon_start : 1 product : dentatorubral pallidoluysian atrophy protein_id : NP_031907.2

name	Eno2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305027 CCDS:CCDS20527.1 GeneID:13807 MGI:95394
definition	GO_component : GO:0000015 - phosphopyruvate hydratase complex [Evidence IEA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004634 - phosphopyruvate hydratase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : enolase 2, gamma neuronal protein_id : NP_038537.1

name	Lrrc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305241 CCDS:CCDS20528.1 GeneID:16977 MGI:1315192
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine rich protein, B7 product : leucine-rich B7 protein protein_id : NP_038616.1

name	Spsb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305113 CCDS:CCDS20529.1 GeneID:14794 MGI:1315199
definition	codon_start : 1 note : gene rich cluster, C9 product : splA/ryanodine receptor domain and SOCS box containing 2 protein_id : NP_038567.1

name	Tpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678413 CCDS:CCDS20530.1 GeneID:21991 MGI:98797
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004807 - triose-phosphate isomerase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence IEA]; GO:0019682 - glyceraldehyde-3-phosphate metabolism [Evidence IDA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006098 - pentose-phosphate shunt [Evidence IEA] codon_start : 1 product : triosephosphate isomerase 1 protein_id : NP_033441.1

name	Usp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305619 CCDS:CCDS20531.1 GeneID:22225 MGI:1347343
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin carboxy terminal hydrolase T product : ubiquitin specific protease 5 (isopeptidase T) protein_id : NP_038728.1

name	Cdca3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305111 GeneID:14793 MGI:1315198
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : trigger of mitotic entry 1; gene rich cluster, C8 product : cell division cycle associated 3 protein_id : NP_038566.1

name	Gnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20502976 CCDS:CCDS20532.1 GeneID:14695 MGI:95785
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] GO_function : GO:0003924 - GTPase activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide-binding protein, beta-3 subunit protein_id : NP_038558.1

name	Leprel2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523368 CCDS:CCDS20533.1 GeneID:14789 MGI:1315208
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019797 - procollagen-proline 3-dioxygenase activity [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : prolyl 3-hydroxylase 3; gene rich cluster, B product : leprecan-like 2 protein_id : NP_038562.2

name	Gpr162 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305103 CCDS:CCDS20534.1 GeneID:14788 MGI:1315214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : gene rich cluster, A product : G protein-coupled receptor 162 protein_id : NP_038561.1

name	Cd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304953 CCDS:CCDS20535.1 GeneID:12504 MGI:88335
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0015026 - coreceptor activity [Evidence ISS]; GO:0042289 - MHC class II protein binding [Evidence IDA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0006955 - immune response [Evidence ISS] [Evidence IEA]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IDA]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence ISS] [Evidence IDA]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0050870 - positive regulation of T cell activation [Evidence IDA]; GO:0030217 - T cell differentiation [Evidence ISS]; GO:0045058 - T cell selection [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 product : CD4 antigen protein_id : NP_038516.1

name	Lag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678654 CCDS:CCDS20536.1 GeneID:16768 MGI:106588
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042289 - MHC class II protein binding [Evidence ISS] [Evidence IDA]; GO:0004888 - transmembrane receptor activity [Evidence IDA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0045085 - negative regulation of interleukin-2 biosynthesis [Evidence IDA]; GO:0050868 - negative regulation of T cell activation [Evidence IDA]; GO:0045954 - positive regulation of natural killer cell mediated cytotoxicity [Evidence IMP] [Evidence IDA] codon_start : 1 product : lymphocyte-activation gene 3 protein_id : NP_032505.1

name	Ptms (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62460366 GeneID:69202 MGI:1916452
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : parathymosin protein_id : NP_081264.1

name	Mlf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703770 CCDS:CCDS20538.1 GeneID:30853 MGI:1353554
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006952 - defense response [Evidence ISS] codon_start : 1 note : Myelodysplasia-myeloid leukemia factor 2 product : myeloid leukemia factor 2 homolog protein_id : NP_663360.1

name	Cops7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242142 CCDS:CCDS20539.1 GeneID:26894 MGI:1349400
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : COP9 complex S7a; COP9 (constitutive photomorphogenic), subunit 7a product : COP9 (constitutive photomorphogenic) homolog, subunit 7a protein_id : NP_036133.1

name	C530028O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316804 CCDS:CCDS20540.1 GeneID:319352 MGI:2441908
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319352 protein_id : NP_783627.1

name	Zfp384 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126352391 GeneID:269800 MGI:2443203
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 384 protein_id : NP_780766.3

name	Ing4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111152 GeneID:28019 MGI:107307
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : ING1-like protein product : inhibitor of growth family, member 4 protein_id : NP_579923.1

name	Acrbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8392845 CCDS:CCDS20542.1 GeneID:54137 MGI:1859515
definition	GO_component : GO:0001669 - acrosome [Evidence ISS] GO_function : GO:0016504 - protease activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0048240 - sperm capacitation [Evidence ISS]; GO:0007286 - spermatid development [Evidence ISS] codon_start : 1 exception : mismatches in translation note : proacrosin-binding protein (sp32) product : proacrosin binding protein protein_id : NP_058541.1

name	Gpr92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255425 GeneID:381810 MGI:2685918
definition	codon_start : 1 product : similar to Gpr92 protein protein_id : XP_355812.2

name	Chd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39204553 CCDS:CCDS20543.1 GeneID:107932 MGI:1344380
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Mi-2 beta product : chromodomain helicase DNA binding protein 4 protein_id : NP_666091.1

name	Nol1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819667 GeneID:110109 MGI:107891
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : nucleolar protein 1, 120 kDa product : nucleolar protein 1 protein_id : NP_620086.1

name	A930037G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179308 GeneID:320678 MGI:2444516
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; HOM-TES-103 tumor antigen-like product : hypothetical protein LOC320678 isoform a protein_id : NP_001034758.1

name	A930037G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179302 GeneID:320678 MGI:2444516
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; HOM-TES-103 tumor antigen-like product : hypothetical protein LOC320678 isoform b protein_id : NP_848902.4

name	Gapdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679937 GeneID:14433 MGI:95640
definition	EC_number : 1.2.1.12 codon_start : 1 product : glyceraldehyde-3-phosphate dehydrogenase protein_id : NP_032110.1

name	Ncapd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165392 GeneID:68298 MGI:1915548
definition	GO_component : GO:0000793 - condensed chromosome [Evidence ISS] [Evidence IDA]; GO:0000797 - condensin core heterodimer [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0045120 - pronucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0042393 - histone binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence ISS] [Evidence IEA] codon_start : 1 product : chromosome condensation-related SMC-associated protein 1 protein_id : NP_666283.1

name	Mrpl51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385050 CCDS:CCDS20545.1 GeneID:66493 MGI:1913743
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IDA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : mitochondrial ribosomal protein 64 product : mitochondrial ribosomal protein L51 protein_id : NP_079871.1

name	Vamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678549 CCDS:CCDS20546.1 GeneID:22317 MGI:1313276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : vesicle-associated membrane protein 1 isoform a protein_id : NP_033522.1

name	Vamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123702073 GeneID:22317 MGI:1313276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : vesicle-associated membrane protein 1 isoform b protein_id : NP_001074026.1

name	Tapbpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703782 CCDS:CCDS20547.1 GeneID:213233 MGI:2384853
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TAP binding protein-like protein_id : NP_663366.1

name	Cd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350003 GeneID:21940 MGI:88326
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IPI] [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042100 - B cell proliferation [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence ISS]; GO:0048305 - immunoglobulin secretion [Evidence NAS]; GO:0006917 - induction of apoptosis [Evidence IPI]; GO:0045579 - positive regulation of B cell differentiation [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence NAS]; GO:0046330 - positive regulation of JNK cascade [Evidence IDA]; GO:0045582 - positive regulation of T cell differentiation [Evidence NAS]; GO:0008588 - release of cytoplasmic sequestered NF-kappaB [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; tumor necrosis factor receptor superfamily, member 7 product : tumor necrosis factor receptor superfamily, member 7 isoform b protein_id : NP_001036029.1

name	Cd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677534 GeneID:21940 MGI:88326
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IPI] [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042100 - B cell proliferation [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence ISS]; GO:0048305 - immunoglobulin secretion [Evidence NAS]; GO:0006917 - induction of apoptosis [Evidence IPI]; GO:0045579 - positive regulation of B cell differentiation [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence NAS]; GO:0046330 - positive regulation of JNK cascade [Evidence IDA]; GO:0045582 - positive regulation of T cell differentiation [Evidence NAS]; GO:0008588 - release of cytoplasmic sequestered NF-kappaB [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; tumor necrosis factor receptor superfamily, member 7 product : tumor necrosis factor receptor superfamily, member 7 isoform a protein_id : NP_001028298.1

name	4930417O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255427 GeneID:73870 MGI:1921120
definition	codon_start : 1 product : hypothetical protein LOC73870 protein_id : XP_001481139.1

name	Tuba3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678465 GeneID:22144 MGI:1095406
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 note : tubulin, alpha 3 product : tubulin, alpha 1a protein_id : NP_033472.1

name	Ltbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549775 CCDS:CCDS20549.1 GeneID:17000 MGI:104875
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0048535 - lymph node development [Evidence TAS] codon_start : 1 note : LT beta-R; LT-beta receptor; TNF receptor-related protein; tumor necrosis factor receptor superfamily, member 3 product : lymphotoxin B receptor protein_id : NP_034866.1

name	Scnn1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859618 GeneID:20276 MGI:101782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ENaC alpha; sodium channel, nonvoltage-gated, type I, alpha polypeptide product : sodium channel, nonvoltage-gated, type I, alpha protein_id : NP_035454.1

name	Tnfrsf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560799 CCDS:CCDS20550.1 GeneID:21937 MGI:1314884
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005031 - tumor necrosis factor receptor activity [Evidence TAS] [Evidence IMP] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0050729 - positive regulation of inflammatory response [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006693 - prostaglandin metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : TNF receptor alpha chain product : tumor necrosis factor receptor superfamily, member 1a protein_id : NP_035739.2

name	Plekhg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348454 GeneID:213522 MGI:2682298
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pleckstrin homology domain containing, family G (with RhoGef domain) member 6 protein_id : NP_941006.1

name	Cd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680894 CCDS:CCDS20551.1 GeneID:12527 MGI:88348
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0006928 - cell motility [Evidence ISS]; GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IDA]; GO:0030913 - paranodal junction assembly [Evidence IDA]; GO:0030168 - platelet activation [Evidence ISS] codon_start : 1 product : CD9 antigen protein_id : NP_031683.1

name	Vwf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511022 CCDS:CCDS20552.1 GeneID:22371 MGI:98941
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0002020 - protease binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence TAS] [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007599 - hemostasis [Evidence TAS] [Evidence IMP] codon_start : 1 product : von Willebrand factor protein_id : NP_035838.3

name	LOC623282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623282
definition	number : 5 pseudo : _no_value

name	LOC623282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623282
definition	number : 4 pseudo : _no_value

name	LOC623282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623282
definition	number : 3 pseudo : _no_value

name	LOC623282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623282
definition	number : 2 pseudo : _no_value

name	LOC623282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623282
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps34 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623337
definition	number : 1 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 6 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 5 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 4 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 3 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 2 pseudo : _no_value

name	Vmn2r27 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232367
definition	number : 1 pseudo : _no_value

name	LOC100043530 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043530
definition	number : 1 pseudo : _no_value

name	EG667343 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667343
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:142950
definition	standard_name : EC19AR

name	(CDS detail)
type	STS
link
xref	UniSTS:142949
definition	standard_name : EC192RR

name	(CDS detail)
type	STS
link
xref	UniSTS:130661
definition	standard_name : D6Mit12

name	(CDS detail)
type	STS
link
xref	UniSTS:179461
definition	standard_name : AW212715

name	(CDS detail)
type	STS
link
xref	UniSTS:130885
definition	standard_name : D6Mit331

name	(CDS detail)
type	STS
link
xref	UniSTS:142948
definition	standard_name : EC185RR

name	(CDS detail)
type	STS
link
xref	UniSTS:130736
definition	standard_name : D6Mit193.2

name	(CDS detail)
type	STS
link
xref	UniSTS:130735
definition	standard_name : MT2734

name	(CDS detail)
type	STS
link
xref	UniSTS:123548
definition	standard_name : 21.MMHAP9FRG9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:191632
definition	standard_name : fb81e07.x1

name	(CDS detail)
type	STS
link
xref	UniSTS:159571
definition	standard_name : AI132558

name	(CDS detail)
type	STS
link
xref	UniSTS:149354
definition	standard_name : D3S2327

name	(CDS detail)
type	STS
link
xref	UniSTS:149354
definition	standard_name : D3S2327

name	(CDS detail)
type	STS
link
xref	UniSTS:130890
definition	standard_name : D6Mit336

name	(CDS detail)
type	STS
link
xref	UniSTS:179467
definition	standard_name : AI327365

name	(CDS detail)
type	STS
link
xref	UniSTS:159570
definition	standard_name : AA959438

name	(CDS detail)
type	STS
link
xref	UniSTS:210016
definition	standard_name : RH136020

name	(CDS detail)
type	STS
link
xref	UniSTS:164678
definition	standard_name : C1s

name	(CDS detail)
type	STS
link
xref	UniSTS:179467
definition	standard_name : AI327365

name	(CDS detail)
type	STS
link
xref	UniSTS:159570
definition	standard_name : AA959438

name	(CDS detail)
type	STS
link
xref	UniSTS:210016
definition	standard_name : RH136020

name	(CDS detail)
type	STS
link
xref	UniSTS:164678
definition	standard_name : C1s

name	(CDS detail)
type	STS
link
xref	UniSTS:161828
definition	standard_name : RH125006

name	(CDS detail)
type	STS
link
xref	UniSTS:208036
definition	standard_name : RH126903

name	(CDS detail)
type	STS
link
xref	UniSTS:124975
definition	standard_name : M68902

name	(CDS detail)
type	STS
link
xref	UniSTS:143332
definition	standard_name : Hcph

name	(CDS detail)
type	STS
link
xref	UniSTS:250464
definition	standard_name : AI411273

name	(CDS detail)
type	STS
link
xref	UniSTS:142954
definition	standard_name : EC351RR

name	(CDS detail)
type	STS
link
xref	UniSTS:142952
definition	standard_name : EC218RR

name	(CDS detail)
type	STS
link
xref	UniSTS:208033
definition	standard_name : BB431127

name	(CDS detail)
type	STS
link
xref	UniSTS:142991
definition	standard_name : Eno2

name	(CDS detail)
type	STS
link
xref	UniSTS:179460
definition	standard_name : AI837106

name	(CDS detail)
type	STS
link
xref	UniSTS:269413
definition	standard_name : MARC_4643-4644:966894536:1

name	(CDS detail)
type	STS
link
xref	UniSTS:142992
definition	standard_name : Eno2

name	(CDS detail)
type	STS
link
xref	UniSTS:179459
definition	standard_name : AI461677

name	(CDS detail)
type	STS
link
xref	UniSTS:266275
definition	standard_name : TPI1

name	(CDS detail)
type	STS
link
xref	UniSTS:161426
definition	standard_name : RH124604

name	(CDS detail)
type	STS
link
xref	UniSTS:269724
definition	standard_name : MARC_7181-7182:996687603:1

name	(CDS detail)
type	STS
link
xref	UniSTS:167482
definition	standard_name : RH127101

name	(CDS detail)
type	STS
link
xref	UniSTS:141283
definition	standard_name : Cd4

name	(CDS detail)
type	STS
link
xref	UniSTS:130787
definition	standard_name : D6Mit24

name	(CDS detail)
type	STS
link
xref	UniSTS:141282
definition	standard_name : Cd4

name	(CDS detail)
type	STS
link
xref	UniSTS:144349
definition	standard_name : RH125-126

name	(CDS detail)
type	STS
link
xref	UniSTS:210104
definition	standard_name : RH136109

name	(CDS detail)
type	STS
link
xref	UniSTS:210501
definition	standard_name : RH136519

name	(CDS detail)
type	STS
link
xref	UniSTS:162850
definition	standard_name : RH126138

name	(CDS detail)
type	STS
link
xref	UniSTS:46443
definition	standard_name : WI-8013

name	(CDS detail)
type	STS
link
xref	UniSTS:167480
definition	standard_name : Cops7a

name	(CDS detail)
type	STS
link
xref	UniSTS:210023
definition	standard_name : RH136027

name	(CDS detail)
type	STS
link
xref	UniSTS:179463
definition	standard_name : AU067746

name	(CDS detail)
type	STS
link
xref	UniSTS:130805
definition	standard_name : D6Mit255

name	(CDS detail)
type	STS
link
xref	UniSTS:239189
definition	standard_name : Nmp4

name	(CDS detail)
type	STS
link
xref	UniSTS:185683
definition	standard_name : BB163993

name	(CDS detail)
type	STS
link
xref	UniSTS:142649
definition	standard_name : RH125758

name	(CDS detail)
type	STS
link
xref	UniSTS:218846
definition	standard_name : RH136757

name	(CDS detail)
type	STS
link
xref	UniSTS:208034
definition	standard_name : BB284187

name	(CDS detail)
type	STS
link
xref	UniSTS:268430
definition	standard_name : MARC_17871-17872:1025017089:1

name	(CDS detail)
type	STS
link
xref	UniSTS:167483
definition	standard_name : D6Ertd380e

name	(CDS detail)
type	STS
link
xref	UniSTS:243386
definition	standard_name : AA963793

name	(CDS detail)
type	STS
link
xref	UniSTS:161081
definition	standard_name : RH124259

name	(CDS detail)
type	STS
link
xref	UniSTS:78038
definition	standard_name : RH64827

name	(CDS detail)
type	STS
link
xref	UniSTS:235555
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:144037
definition	standard_name : Nol1

name	(CDS detail)
type	STS
link
xref	UniSTS:235556
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:119881
definition	standard_name : RH94634

name	(CDS detail)
type	STS
link
xref	UniSTS:208035
definition	standard_name : BE292615

name	(CDS detail)
type	STS
link
xref	UniSTS:144742
definition	standard_name : Vamp1

name	(CDS detail)
type	STS
link
xref	UniSTS:161971
definition	standard_name : RH125149

name	(CDS detail)
type	STS
link
xref	UniSTS:144659
definition	standard_name : Tnfrsf7

name	(CDS detail)
type	STS
link
xref	UniSTS:179462
definition	standard_name : AI528779

name	(CDS detail)
type	STS
link
xref	UniSTS:179464
definition	standard_name : AI256028

name	(CDS detail)
type	STS
link
xref	UniSTS:275859
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:125715
definition	standard_name : U29173

name	(CDS detail)
type	STS
link
xref	UniSTS:143800
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:143799
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:130678
definition	standard_name : D6Mit134

name	(CDS detail)
type	STS
link
xref	UniSTS:130762
definition	standard_name : D6Mit217

name	(CDS detail)
type	STS
link
xref	UniSTS:142951
definition	standard_name : EC218RL

name	(CDS detail)
type	STS
link
xref	UniSTS:142953
definition	standard_name : EC351RL

name	(CDS detail)
type	STS
link
xref	UniSTS:144653
definition	standard_name : Tnfrsf1a

name	(CDS detail)
type	STS
link
xref	UniSTS:130804
definition	standard_name : D6Mit254

name	(CDS detail)
type	STS
link
xref	UniSTS:270466
definition	standard_name : PMC124385P1

name	(CDS detail)
type	STS
link
xref	UniSTS:142581
definition	standard_name : D6Jpk2

name	(CDS detail)
type	STS
link
xref	UniSTS:143911
definition	standard_name : Ms6hm3

name	(CDS detail)
type	STS
link
xref	UniSTS:163020
definition	standard_name : RH126312

name	(CDS detail)
type	STS
link
xref	UniSTS:221216
definition	standard_name : RH139130

name	(CDS detail)
type	STS
link
xref	UniSTS:123859
definition	standard_name : 29.MMHAP36FLB5.seq

name	LOC384484 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255316 GeneID:384484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to synaptotagmin binding, cytoplasmic RNA interacting protein pseudo : _no_value transcript_id : XR_034646.1

name	EG622297 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255322 GeneID:622297 MGI:3648854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : predicted gene, EG622297 pseudo : _no_value transcript_id : XR_034651.1

clone name	MSMg01-288A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-380L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197M10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526L13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338J02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-325K13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-387A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-308D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name		B6Ng01-221L21.g
ACC		GA036950
length		574
definition		B6Ng01-221L21.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence		gaattcacatactcaccctttttattataccaaatcatcttttccttcaa acatttccccccttaaatctgggaggctcgtccaaggcaaagtggaccaa atggaagcatattaacaaaccaaacagtcagaaaccataatgaattcaca gccctgaaaacaaataaaaacaaacaaaccaacaaacaaacagatacctt ttctcaagacaaaacaaagctgaatggctggaaaccaaaatgcttttaaa gcaaacaaagtaaaccttatgcatggttggaaagcatactctcaaaaaag ggtaaccaacaagtttgatttaaaactttaagctctgaatagtcaacaga ttgttcaactgagcaagggaagtcttgagttccattaagttctcttttaa gaatctacccaatgagataatggttttatgtttggacataaagaatttat tctggttcctgttccggtcatggttatggctcctgtgtgcagtggatcat tccataactgctgatatataaatacatctctcacctctcagggaataaga ttatactctattctggaaccaaat
quality values		Open. Hide. 15 22 16 24 14 11 13 23 10 16 17 21 11 11 8 17 11 18 13 16 9 12 11 13 18 5 8 16 18 18 24 19 23 23 34 34 19 24 17 19 30 28 27 28 27 29 38 38 18 10 28 27 30 39 36 32 34 23 23 28 28 23 16 16 18 12 13 10 11 11 27 28 23 28 18 23 12 13 23 16 20 18 17 12 18 13 27 17 13 23 28 13 22 25 18 20 19 26 23 18 18 13 26 18 16 26 13 23 11 8 23 21 31 30 34 34 27 34 27 23 21 14 18 23 18 13 13 13 18 23 12 34 23 27 35 24 13 18 18 18 16 34 34 33 29 23 19 9 7 45 17 24 31 27 34 18 18 10 18 18 23 34 34 26 25 27 23 13 16 16 23 13 11 23 17 16 20 13 23 23 18 13 24 10 11 16 18 16 24 25 20 18 13 19 10 25 27 25 36 37 23 27 30 27 23 18 18 18 27 18 10 13 23 23 18 18 34 35 27 34 9 11 18 12 14 21 23 18 27 26 27 34 33 39 27 24 13 24 34 34 28 28 28 34 36 34 39 30 24 9 16 16 18 27 24 20 23 24 18 13 12 12 12 27 18 16 18 18 21 27 18 13 23 28 27 19 12 14 26 31 34 43 34 23 27 21 36 27 27 11 13 13 12 13 6 18 14 16 25 13 28 18 26 21 16 18 13 13 18 12 27 18 18 11 12 5 11 28 18 17 11 7 18 13 19 23 18 10 13 14 11 13 11 11 13 10 8 26 23 17 13 6 8 16 10 13 13 13 13 18 19 10 13 10 11 13 10 18 13 34 31 32 12 23 18 18 18 27 13 21 23 10 12 17 13 23 28 31 16 40 34 10 11 11 16 18 10 10 10 16 11 10 18 13 19 19 10 14 10 13 9 23 16 14 23 24 19 10 8 8 5 9 11 21 18 18 39 33 13 18 16 23 18 12 18 18 10 8 8 23 27 34 23 18 8 5 7 10 11 10 13 12 13 27 25 17 22 28 13 24 17 11 26 18 13 23 19 19 11 26 21 13 18 12 13 12 13 10 10 8 11 17 10 18 10 19 18 10 13 12 13 18 12 13 10 11 13 8 9 13 18 11 10 18 9 8 22 20 18 34 43 23 18 13 35 12 12 18 12 17 13 10 8 23 17 12 11 13 13 12 8 11 11 5 10 8 10 10 24 15 24 18 9 16 24 17 18 15 9 12 9 18 28 28 25 15 11 8 8 11 13 10 16 28 17 19 27 18 18 24 10 16 28 25 28 25 31 16 13 19 18 13 13 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_124509938_124510505
seq2: B6Ng01-221L21.g_35_608 (reverse)

seq1  ATTTGGTTCCAGAATAGAGTAT-CTCTTATTCCCTGTGAGGTGAGAGTTG  49
      ||||||||||||||||||||||  |||||||||||| |||||||||| ||
seq2  ATTTGGTTCCAGAATAGAGTATAATCTTATTCCCTGAGAGGTGAGAGATG  50

seq1  TATTTGTGTGTCTGCAGTTATGGAATGAACCACTGCACACTGGAGCCATC  99
      ||||| | | || ||||||||||||||| ||||||||||| |||||||| 
seq2  TATTTATATATCAGCAGTTATGGAATGATCCACTGCACACAGGAGCCATA  100

seq1  ACCCTGACCGGAGCAGGTACCAGCATAAGTTCTTTGTGTCCAAACCTGAA  149
      ||| |||||||| |||| ||||| |||| |||||| ||||||||| | ||
seq2  ACCATGACCGGAACAGGAACCAGAATAAATTCTTTATGTCCAAACATAAA  150

seq1  ACCATTATCTCCTTGGGTAGATTCTT-CGAGAGAACTTGCTGGAACTC-A  197
      ||||||||||| ||||||||||||||   |||||||||  |||||||| |
seq2  ACCATTATCTCATTGGGTAGATTCTTAAAAGAGAACTTAATGGAACTCAA  200

seq1  GACTTCCCTTGCTCAGTTG-ACAATCTGTTGTCTATTCTGAGCTTCTTGT  246
      ||||||||||||||||||| ||||||||||| |||||| ||||||   ||
seq2  GACTTCCCTTGCTCAGTTGAACAATCTGTTGACTATTCAGAGCTTAAAGT  250

seq1  TTTAAATCCTACTTGTTGGTTACCCTTTTTTGAGAGTATGCTTTCCAACC  296
      ||||||||  ||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAATCAAACTTGTTGGTTACCCTTTTTTGAGAGTATGCTTTCCAACC  300

seq1  ATGCATAAGGTTTGCTTTGTTTGCTTTAAAAGCATTTTGGTTTCCAGCCA  346
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATGCATAAGGTTTACTTTGTTTGCTTTAAAAGCATTTTGGTTTCCAGCCA  350

seq1  TTCAGCTTTGTTTTGTCTTGAGAAAAGGTCTCTGTTTGTTTGTTGGTTTG  396
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TTCAGCTTTGTTTTGTCTTGAGAAAAGGTATCTGTTTGTTTGTTGGTTTG  400

seq1  TTTGTTTTTATTTGTTTTCAGGGCTCTGAATTCATTATGGTTTCTGACTG  446
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TTTGTTTTTATTTGTTTTCAGGGCTGTGAATTCATTATGGTTTCTGACTG  450

seq1  TTTGGTTTGTTAATTTGCTTCCATTTGGTCCACTTTGCCTTGGACGCGCC  496
      |||||||||||||| ||||||||||||||||||||||||||||||| |||
seq2  TTTGGTTTGTTAATATGCTTCCATTTGGTCCACTTTGCCTTGGACGAGCC  500

seq1  TCCCAGATTTAAGGGGGGAAATGTTTGAAGGAAAAGATGATTTGGTTTAA  546
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  TCCCAGATTTAAGGGGGGAAATGTTTGAAGGAAAAGATGATTTGGTATAA  550

seq1  T--GCTCGATGAGTATGTGAATTC  568
      |      | |||||||||||||||
seq2  TAAAAAGGGTGAGTATGTGAATTC  574

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information