MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-224M13
Chromosome	6 (Build37)
Map Location	72,603,287 - 72,788,350
singlet/doublet	doublet
Overlap gene	Tcf3
Upstream gene	LOC668029, LOC668034, Reep1, Mrpl35, Immt, Ptcd3, Rpo1-4, LOC668057, St3gal5, Atoh8, Sftpb, Usp39, 0610030E20Rik, Tmem150, 2500002L14Rik, Vamp5, Vamp8, Ggcx, Mat2a, Sh2d6, Capg, Rbed1, Retsat, Tgoln1, LOC100038890
Downstream gene	Kcmf1, Tmsb10, Dnahc6, Suclg1, Olfr210-ps1, 4931417E11Rik, LOC100043338
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC668034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins pseudo : _no_value

name	Reep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66223 MGI:1913473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Immt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76614 MGI:1923864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69956 MGI:1917206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20019 MGI:1096397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	St3gal5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Atoh8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sftpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20388 MGI:109516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28035 MGI:107622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610030E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68364 MGI:1915614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs, 2 Proteins

name	Tmem150 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232086 MGI:2385244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2500002L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66510 MGI:1913760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vamp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22320 MGI:1336882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggcx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56316 MGI:1927655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mat2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232087 MGI:2443731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71130 MGI:1918380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins

name	Capg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rbed1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232089 MGI:2445168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Retsat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67442 MGI:1914692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgoln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22134 MGI:105080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kcmf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74287 MGI:1921537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmsb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19240 MGI:109146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnahc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330355 MGI:107744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 7 Proteins

name	Suclg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56451 MGI:1927234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr210-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257960 MGI:3030044
definition	gene_synonym : MOR115-3P note : olfactory receptor 210, pseudogene 1 pseudo : _no_value

name	4931417E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66740 MGI:1913990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins pseudo : _no_value

name	Reep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802230 GeneID:52250 MGI:1098827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 1 transcript_id : NM_178608.3

name	Mrpl35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372564 GeneID:66223 MGI:1913473
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L35 transcript_id : NM_025430.2

name	Immt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608130 GeneID:76614 MGI:1923864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inner membrane protein, mitochondrial transcript_id : NM_029673.2

name	Ptcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982770 GeneID:69956 MGI:1917206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pentatricopeptide repeat domain 3 transcript_id : NM_027275.3

name	Rpo1-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328145 GeneID:20019 MGI:1096397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-4 transcript_id : NM_009088.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126168 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_011375.2

name	St3gal5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126156 GeneID:20454 MGI:1339963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 transcript_id : NM_001035228.1

name	Atoh8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130066 GeneID:71093 MGI:1918343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : atonal homolog 8 (Drosophila) transcript_id : NM_153778.3

name	Sftpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296600 GeneID:20388 MGI:109516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfactant associated protein B transcript_id : NM_147779.1

name	Usp39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378515 GeneID:28035 MGI:107622
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 39 transcript_id : NM_138592.2

name	0610030E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377469 GeneID:68364 MGI:1915614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 73 ESTs, 2 Proteins product : RIKEN cDNA 0610030E20 gene, transcript variant 1 transcript_id : XM_132614.6

name	Tmem150 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802658 GeneID:232086 MGI:2385244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 150 transcript_id : NM_144916.2

name	2500002L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059205 GeneID:66510 MGI:1913760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2500002L14 gene transcript_id : NM_025607.3

name	Vamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001561 GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 5 transcript_id : NM_001080742.1

name	Vamp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001552 GeneID:53620 MGI:1858622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 5 transcript_id : NM_016872.3

name	Vamp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980628 GeneID:22320 MGI:1336882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 8 transcript_id : NM_016794.2

name	Ggcx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374008 GeneID:56316 MGI:1927655
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyl carboxylase transcript_id : NM_019802.2

name	Mat2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802196 GeneID:232087 MGI:2443731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine adenosyltransferase II, alpha transcript_id : NM_145569.3

name	Sh2d6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377474 GeneID:71130 MGI:1918380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins product : SH2 domain containing 6, transcript variant 1 transcript_id : XM_355785.4

name	Capg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354781 GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament), gelsolin-like transcript_id : NM_007599.3

name	Capg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802783 GeneID:12332 MGI:1098259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capping protein (actin filament), gelsolin-like transcript_id : NM_001042534.2

name	Rbed1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386721 GeneID:232089 MGI:2445168
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif and ELMO domain 1 transcript_id : NM_144917.3

name	Retsat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044905 GeneID:67442 MGI:1914692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol saturase (all trans retinol 13,14 reductase) transcript_id : NM_026159.4

name	Tgoln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044904 GeneID:22134 MGI:105080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trans-golgi network protein transcript_id : NM_009443.3

name	LOC100038890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255101 GeneID:100038890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038890 transcript_id : XM_001471628.1

name	Tcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044902 GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 3 transcript_id : NM_009332.2

name	Tcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119703757 GeneID:21415 MGI:1202876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 3 transcript_id : NM_001079822.1

name	Kcmf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517504 GeneID:74287 MGI:1921537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel modulatory factor 1 transcript_id : NM_019715.2

name	Tmsb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476070 GeneID:19240 MGI:109146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymosin, beta 10 transcript_id : NM_025284.3

name	Tmsb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476076 GeneID:19240 MGI:109146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymosin, beta 10 transcript_id : NM_001039392.1

name	Dnahc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255215 GeneID:330355 MGI:107744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 7 Proteins product : dynein, axonemal, heavy chain 6 transcript_id : XM_913416.3

name	Suclg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384185 GeneID:56451 MGI:1927234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : succinate-CoA ligase, GDP-forming, alpha subunit transcript_id : NM_019879.2

name	4931417E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802493 GeneID:66740 MGI:1913990
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931417E11 gene transcript_id : NM_025737.2

name	Reep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519931 GeneID:52250 MGI:1098827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 1 protein_id : NP_848723.1

name	Mrpl35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384830 CCDS:CCDS20234.1 GeneID:66223 MGI:1913473
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L35 protein_id : NP_079706.1

name	Immt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608131 GeneID:76614 MGI:1923864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : inner membrane protein, mitochondrial protein_id : NP_083949.2

name	Ptcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469980 CCDS:CCDS20235.1 GeneID:69956 MGI:1917206
definition	codon_start : 1 product : Pentatricopeptide repeat domain 3 protein_id : NP_081551.2

name	Rpo1-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328146 CCDS:CCDS20236.1 GeneID:20019 MGI:1096397
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase 1-4 (194 kDa subunit) product : RNA polymerase 1-4 protein_id : NP_033114.2

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126157 CCDS:CCDS20237.1 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform a protein_id : NP_001030305.1

name	St3gal5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126169 GeneID:20454 MGI:1339963
definition	EC_number : 2.4.99.9 GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047291 - lactosylceramide alpha-2,3-sialyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; ST3Gal V; mST3Gal V; GM3 synthase; GM3-specific sialytransferase; sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) product : ST3 beta-galactoside alpha-2,3-sialyltransferase 5 isoform b protein_id : NP_035505.2

name	Atoh8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418872 GeneID:71093 MGI:1918343
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : basic helix-loop-helix transcription factor 6 product : okadin protein_id : NP_722473.1

name	Sftpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296601 GeneID:20388 MGI:109516
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0050828 - regulation of liquid surface tension [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : surfactant associated protein B protein_id : NP_680088.1

name	Usp39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070404 CCDS:CCDS20238.1 GeneID:28035 MGI:107622
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : SnRNP assembly defective 1 homolog product : ubiquitin specific protease 39 protein_id : NP_613058.1

name	0610030E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38084531 GeneID:68364 MGI:1915614
definition	codon_start : 1 product : hypothetical protein LOC68364 isoform 1 protein_id : XP_132614.2

name	Tmem150 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450311 CCDS:CCDS20239.1 GeneID:232086 MGI:2385244
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA] codon_start : 1 note : fasting-inducible integral membrane protein TM6P1 product : transmembrane protein 150 protein_id : NP_659165.1

name	2500002L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059206 CCDS:CCDS20240.1 GeneID:66510 MGI:1913760
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66510 protein_id : NP_079883.3

name	Vamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001562 GeneID:53620 MGI:1858622
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IDA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 5 protein_id : NP_001074211.1

name	Vamp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394526 GeneID:53620 MGI:1858622
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IDA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 5 protein_id : NP_058568.1

name	Vamp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980629 GeneID:22320 MGI:1336882
definition	GO_component : GO:0005769 - early endosome [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 product : vesicle-associated membrane protein 8 protein_id : NP_058074.2

name	Ggcx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790009 CCDS:CCDS20242.1 GeneID:56316 MGI:1927655
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008488 - gamma-glutamyl carboxylase activity [Evidence IEA] [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0017187 - peptidyl-glutamic acid carboxylation [Evidence IEA] codon_start : 1 note : gamma-carboxylase; vitamin K-dependent carboxylase product : gamma-glutamyl carboxylase protein_id : NP_062776.1

name	Mat2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704144 GeneID:232087 MGI:2443731
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004478 - methionine adenosyltransferase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006556 - S-adenosylmethionine biosynthesis [Evidence IDA] codon_start : 1 product : methionine adenosyltransferase II, alpha protein_id : NP_663544.1

name	Sh2d6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029226 GeneID:71130 MGI:1918380
definition	codon_start : 1 product : SH2 domain containing 6 isoform 1 protein_id : XP_355785.3

name	Capg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227377 GeneID:12332 MGI:1098259
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030031 - cell projection biogenesis [Evidence IDA] codon_start : 1 product : gelsolin-like capping protein protein_id : NP_001035999.1

name	Capg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227379 GeneID:12332 MGI:1098259
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0030031 - cell projection biogenesis [Evidence IDA] codon_start : 1 product : gelsolin-like capping protein protein_id : NP_031625.2

name	Rbed1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450313 CCDS:CCDS20243.1 GeneID:232089 MGI:2445168
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 product : RNA binding motif and ELMO domain 1 protein_id : NP_659166.1

name	Retsat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52627143 CCDS:CCDS20244.1 GeneID:67442 MGI:1914692
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005640 - nuclear outer membrane [Evidence IDA] GO_function : GO:0051786 - all-trans-retinol 13,14-reductase activity [Evidence IEA] [Evidence IDA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016705 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen [Evidence IEA] GO_process : GO:0016117 - carotenoid biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IDA] [Evidence IEA]; GO:0042572 - retinol metabolism [Evidence IDA] codon_start : 1 product : all-trans-13,14-dihydroretinol saturase protein_id : NP_080435.3

name	LOC100038890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255102 GeneID:100038890
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471678.1

name	Tgoln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678459 GeneID:22134 MGI:105080
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : trans-golgi network protein 1 product : trans-golgi network protein protein_id : NP_033469.1

name	Tcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044903 CCDS:CCDS20245.1 GeneID:21415 MGI:1202876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048319 - axial mesoderm morphogenesis [Evidence IMP]; GO:0008595 - determination of anterior/posterior axis, embryo [Evidence IMP]; GO:0046022 - positive regulation of transcription from RNA polymerase II promoter, mitotic [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transcription factor 7-like 1 product : transcription factor 3 isoform 2 protein_id : NP_033358.2

name	Tcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119703758 GeneID:21415 MGI:1202876
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048319 - axial mesoderm morphogenesis [Evidence IMP]; GO:0008595 - determination of anterior/posterior axis, embryo [Evidence IMP]; GO:0046022 - positive regulation of transcription from RNA polymerase II promoter, mitotic [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; transcription factor 7-like 1 product : transcription factor 3 isoform 1 protein_id : NP_001073290.1

name	Kcmf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517505 GeneID:74287 MGI:1921537
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence ISS] codon_start : 1 note : clone DEBT-91 product : potassium channel modulatory factor DEBT-91 protein_id : NP_062689.2

name	Tmsb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476077 GeneID:19240 MGI:109146
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003785 - actin monomer binding [Evidence TAS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : thymosin beta-10 product : thymosin, beta 10 protein_id : NP_001034481.1

name	Tmsb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384628 GeneID:19240 MGI:109146
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003785 - actin monomer binding [Evidence TAS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : thymosin beta-10 product : thymosin, beta 10 protein_id : NP_079560.1

name	Dnahc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255216 GeneID:330355 MGI:107744
definition	codon_start : 1 product : axonemal dynein heavy chain protein_id : XP_918509.3

name	Suclg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845299 CCDS:CCDS20246.1 GeneID:56451 MGI:1927234
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004776 - succinate-CoA ligase (GDP-forming) activity [Evidence IEA] GO_process : GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : succinyl-CoA synthetase product : succinate-CoA ligase, GDP-forming, alpha subunit protein_id : NP_063932.1

name	4931417E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385198 GeneID:66740 MGI:1913990
definition	codon_start : 1 product : hypothetical protein LOC66740 protein_id : NP_080013.1

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 2 pseudo : _no_value

name	LOC668029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668029
definition	number : 1 pseudo : _no_value

name	LOC668057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668057
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130686
definition	standard_name : D6Mit143

name	(CDS detail)
type	STS
link
xref	UniSTS:159515
definition	standard_name : C87808

name	(CDS detail)
type	STS
link
xref	UniSTS:179390
definition	standard_name : AW558420

name	(CDS detail)
type	STS
link
xref	UniSTS:161843
definition	standard_name : RH125021

name	(CDS detail)
type	STS
link
xref	UniSTS:235469
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159517
definition	standard_name : AF000938

name	(CDS detail)
type	STS
link
xref	UniSTS:130872
definition	standard_name : D6Mit319

name	(CDS detail)
type	STS
link
xref	UniSTS:271220
definition	standard_name : PMC152312P1

name	(CDS detail)
type	STS
link
xref	UniSTS:209590
definition	standard_name : Siat9

name	(CDS detail)
type	STS
link
xref	UniSTS:271797
definition	standard_name : PMC196074P2

name	(CDS detail)
type	STS
link
xref	UniSTS:165469
definition	standard_name : AI562151

name	(CDS detail)
type	STS
link
xref	UniSTS:130792
definition	standard_name : D6Mit243

name	(CDS detail)
type	STS
link
xref	UniSTS:142650
definition	standard_name : D6Wsu157e

name	(CDS detail)
type	STS
link
xref	UniSTS:161619
definition	standard_name : RH124797

name	(CDS detail)
type	STS
link
xref	UniSTS:179395
definition	standard_name : AI894154

name	(CDS detail)
type	STS
link
xref	UniSTS:165471
definition	standard_name : AI461894

name	(CDS detail)
type	STS
link
xref	UniSTS:235470
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162861
definition	standard_name : RH126149

name	(CDS detail)
type	STS
link
xref	UniSTS:494235
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490526
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:116759
definition	standard_name : RH101850

name	(CDS detail)
type	STS
link
xref	UniSTS:144743
definition	standard_name : Vamp8

name	(CDS detail)
type	STS
link
xref	UniSTS:179394
definition	standard_name : AU041171

name	(CDS detail)
type	STS
link
xref	UniSTS:165470
definition	standard_name : AI449819

name	(CDS detail)
type	STS
link
xref	UniSTS:498461
definition	standard_name : Capg

name	(CDS detail)
type	STS
link
xref	UniSTS:185671
definition	standard_name : AI844780

name	(CDS detail)
type	STS
link
xref	UniSTS:207979
definition	standard_name : BE198920

name	(CDS detail)
type	STS
link
xref	UniSTS:207978
definition	standard_name : RH126786

name	(CDS detail)
type	STS
link
xref	UniSTS:167484
definition	standard_name : RH127112

name	(CDS detail)
type	STS
link
xref	UniSTS:159516
definition	standard_name : AU015504

name	(CDS detail)
type	STS
link
xref	UniSTS:207980
definition	standard_name : BE335351

name	(CDS detail)
type	STS
link
xref	UniSTS:163390
definition	standard_name : D50031

name	(CDS detail)
type	STS
link
xref	UniSTS:179392
definition	standard_name : AJ223069

name	(CDS detail)
type	STS
link
xref	UniSTS:161251
definition	standard_name : RH124429

name	(CDS detail)
type	STS
link
xref	UniSTS:185669
definition	standard_name : BB041536

name	(CDS detail)
type	STS
link
xref	UniSTS:123907
definition	standard_name : 30.MMHAP48FLB6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130973
definition	standard_name : D6Mit71

name	(CDS detail)
type	STS
link
xref	UniSTS:130728
definition	standard_name : D6Mit186

name	(CDS detail)
type	STS
link
xref	UniSTS:130794
definition	standard_name : D6Mit245

name	LOC668034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255251 GeneID:668034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to Ribosomal protein L19 pseudo : _no_value transcript_id : XR_034118.1

name	LOC100043338 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255254 GeneID:100043338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : similar to cofactor A pseudo : _no_value transcript_id : XR_034217.1

clone name	MSMg01-264C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-169K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-224M13.b	B6Ng01-224M13.g
ACC	GA039147	GA039148
length	766	1,120
definition	B6Ng01-224M13.b	B6Ng01-224M13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(72,787,585 - 72,788,350)	(72,603,287 - 72,604,413)
sequence	gaattccatgcactgcctaccgcagcctaaggaattcttccagagaccac tctagtgaagcctccagcctggtttaagtcaagattctcgacagcacaga aaacaatgtcgggacaaaacagtgaagcagagttggtatttaatattaga gtttgacagatttaagtgtaaaacttaatacgttctcaaggaaagagcaa ggcgcatgcaggtgtaggtgtgaactgctcaacaactccaagtgttgtca cacttaagtgtctacaaaacagctcttaagtcacatctcaagggttacta ggaaacccacctgcttgttttttatatatggatgtggctctagaggtgcc tttgctctgattataggcagaaaaccacgagtcatagaagtcccaagaga cttaagacatgtcttttgctacagattcatttcttgtgatattcctagga aattacaggctcccggctgggaaggagagggaagagctctaggcttcatg tgtgcttgggctttacattgctgcggtaacatacatgaagacagcattgt tactgtgtgctcaccttcacagtaagtgttagttgttctggaattcttta tccaggtggtgagggactctagccagactctagggtggagcagtgtgaag ccctttccctttccatatctccttcatttcttcctgtccctacttcaatt catacacaatggtttggtttcatgtgtgtgtgtgtgagtgtgtgtgagtg tgagtgtgtgttgtac	gaattctaagtgctttgcgggaccacgaactagggcagtcggaggtatca gtgccaggagcatgcaggcatctgcagttctgaatgcctaggtcacgcca gtggaaagaaactgcttttccaaaaagatttatttatttattttcagtat taattcggtctctgtgtgttgtgtacatgtgtgtgggtatccacacaggt cagtgagttggatctctttgggctacaattgcctacggttgtgtaagcca tgaactatgggtgttgaaactaaactcgagtcctctgcaagaacagtacc cactctttaaacactgcaacatctctccagtgccaagaaagctctttttg gcagtggttcccatgagaggccggccgcacaattatcctggaggtcactg cacatgggtggagcatgtctgtggggattaggctgagctaagactctggg cacaataatggtgtgtggacaaattaaaacaggtttcgccaagccttatc taagctctgttgaacaggctgcgggaggctcaaacttctgaccagcacat cacagccgggcatcagcgcagccgatgtgctcacagcctggtccagctac cccgctctcctgggatgaccactgaagaggcaaagctccctttgtcttca aagtatcaatacaactcttggagcttctatgaccaaaggacccctcagga ttcagagacagaatagtgccatgccaccaatcttcaatatactgcgtcaa aatgctacagtctcttgcgacacatactatgggctgatagacagttccaa ttttcacagaaccttggaaaatggcttacccttctgccattctggtttat agttaagtacagtgaagctaagtttaagatgtatctttttgttggggcca tcaagtttggtcagtaggtaacggaccttgccaccaagcctgacaagtag agtttgattcctgagcctactggtggtgagagaacagacacctgaagcct gcagttgtcctcttgacctccacacatgtgcttgttgtgccattcactac tcctctagattaatggaaataattgcaataaattcgctcggctaatgtgg cactgttgactagggtggtg
quality values	Open. Hide. 58 42 17 32 58 54 32 15 54 58 39 50 54 58 58 58 62 54 62 62 62 62 54 62 62 62 62 47 54 62 56 51 37 37 17 26 32 38 56 50 20 20 56 54 54 47 47 47 47 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 56 34 38 54 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 49 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 56 62 56 62 62 46 62 47 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 52 62 62 62 62 62 62 62 62 54 62 52 62 62 62 62 62 62 62 58 58 58 58 58 54 54 54 54 54 54 52 58 58 58 43 58 16 15 9 16 9 21 58 58 54 58 54 46 45 58 58 58 58 42 54 52 54 52 54 58 52 58 58 58 54 45 42 42 58 58 54 58 54 54 58 54 54 54 36 54 54 54 58 58 52 41 54 52 46 49 58 52 58 58 37 58 46 37 58 47 44 40 54 53 54 47 49 58 49 37 50 49 27 50 53 50 50 50 58 45 49 58 42 49 37 50 51 46 50 58 50 53 52 58 32 39 58 53 42 58 53 53 51 58 54 58 43 33 40 35 50 50 41 51 46 36 39 40 58 49 46 32 58 52 52 50 40 40 58 39 39 34 50 58 58 37 50 52 33 27 17 26 39 41 46 25 17 36 38 53 37 36 40 37 37 58 43 46 51 41 54 12 13 58 16 29 34 53 53 39 51 49 42 53 53 53 53 40 52 39 40 53 26 32 25 33 39 28 32 26 26 50 27 46 49 49 37 46 13 51 42 33 37 26 35 35 34 14 9 17 13	Open. Hide. 62 49 39 39 62 62 54 62 62 62 62 42 34 34 28 27 34 23 27 28 32 59 32 59 43 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 59 59 43 49 54 40 50 50 59 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 56 47 56 46 46 38 39 62 62 62 62 62 62 62 62 56 62 47 62 62 47 62 62 62 62 62 62 62 62 54 62 62 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 50 62 62 62 46 62 62 62 62 62 54 62 62 62 62 58 58 52 58 54 52 54 47 52 58 58 58 52 58 58 49 54 58 49 58 58 54 58 58 54 58 58 58 52 54 51 54 58 54 58 58 58 54 58 58 42 38 58 46 58 53 35 47 52 47 58 58 58 58 58 54 39 45 39 58 54 52 54 49 54 53 52 54 47 52 58 54 43 58 58 54 30 58 58 58 50 58 58 58 51 50 58 58 43 58 29 53 53 58 58 51 51 46 53 52 41 49 51 47 46 48 50 51 46 34 40 58 53 42 53 58 58 58 52 58 50 53 53 52 50 40 58 58 58 30 26 58 51 40 50 50 53 49 50 58 58 32 51 32 33 21 37 58 58 46 51 41 34 54 32 41 58 50 52 50 39 39 53 45 30 58 27 41 50 40 40 37 25 40 54 50 41 40 53 41 53 53 51 37 40 40 39 21 50 52 42 39 39 32 50 40 39 24 24 23 51 44 25 46 25 13 49 50 39 51 41 37 9 44 34 28 30 33 40 32 54 28 35 26 42 24 38 46 37 52 23 34 52 22 39 23 42 52 25 41 37 34 40 24 35 40 34 33 31 22 8 54 35 40 32 37 34 45 51 40 40 41 39 54 54 54 24 29 53 40 45 28 39 32 33 45 40 40 41 22 25 31 32 24 34 28 36 35 28 30 25 42 33 32 34 27 47 17 24 32 27 34 26 31 20 32 20 31 31 18 46 42 52 32 21 38 51 51 22 30 23 32 31 24 42 18 12 18 9 32 45 31 46 51 51 34 30 30 33 18 11 14 28 31 51 31 33 48 38 32 31 23 13 10 25 31 31 29 21 46 30 42 24 21 18 21 24 24 33 22 26 21 18 21 21 32 25 13 22 32 27 9 37 27 27 7 15 17 37 9 17 20 16 38 21 26 10 11 25 36 30 48 46 44 31 31 27 22 32 32 32 12 12 31 8 11 32 18 31 10 10 35 18 21 30 21 32 31 14 9 14 25 21 17 30 21 16 19 25 31 11 14 19 13 10 21 31 18 29 22 7 22 10 25 17 18 19 25 18 20 25 10 7 5 10 6 7 25 36 22 13 7 8 33 16 16 9 11 20 16 8 17 25 6 4 4 6 25 22 8 4 4 4 4 7 34 11 31 34 22 10 7 26 16 7 17 9 28 27 9 9 13 13 16 14 3 3 3 9 27 11 8 24 22 16 24 16 8 7 8 28 25 13 26 13 32 7 6 8 3 3 3 10 21 22 10 6 9 4 3 6 13 6 26 11 7 4 6 10 11 9 11 29 21 20 6 22 13 6 8 12 13 6 16 8 4 18 21 8 8 6 21 29 7 5 14 19 4 7 12 14 8 16 7 21 13 3 3 8 23 8 13 4 6 5 2 1 3 3 3 1 5 5 4 3 4 3 4 10 3 3 4 16 14 8 15 16 21 8 6 4 11 22 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_72787585_72788350
seq2: B6Ng01-224M13.b_47_812 (reverse)

seq1  GTACAACACACACTCACACTCACACACACTCACACACACACACATGAAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAACACACACTCACACTCACACACACTCACACACACACACATGAAAC  50

seq1  CAAACCATTGTGTATGAATTGAAGTAGGGACAGGAAGAAATGAAGGAGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACCATTGTGTATGAATTGAAGTAGGGACAGGAAGAAATGAAGGAGAT  100

seq1  ATGGAAAGGGAAAGGGCTTCACACTGCTCCACCCTAGAGTCTGGCTAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAAAGGGAAAGGGCTTCACACTGCTCCACCCTAGAGTCTGGCTAGAG  150

seq1  TCCCTCACCACCTGGATAAAGAATTCCAGAACAACTAACACTTACTGTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCACCACCTGGATAAAGAATTCCAGAACAACTAACACTTACTGTGA  200

seq1  AGGTGAGCACACAGTAACAATGCTGTCTTCATGTATGTTACCGCAGCAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGCACACAGTAACAATGCTGTCTTCATGTATGTTACCGCAGCAAT  250

seq1  GTAAAGCCCAAGCACACATGAAGCCTAGAGCTCTTCCCTCTCCTTCCCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAGCCCAAGCACACATGAAGCCTAGAGCTCTTCCCTCTCCTTCCCAG  300

seq1  CCGGGAGCCTGTAATTTCCTAGGAATATCACAAGAAATGAATCTGTAGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGAGCCTGTAATTTCCTAGGAATATCACAAGAAATGAATCTGTAGCA  350

seq1  AAAGACATGTCTTAAGTCTCTTGGGACTTCTATGACTCGTGGTTTTCTGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGACATGTCTTAAGTCTCTTGGGACTTCTATGACTCGTGGTTTTCTGC  400

seq1  CTATAATCAGAGCAAAGGCACCTCTAGAGCCACATCCATATATAAAAAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAATCAGAGCAAAGGCACCTCTAGAGCCACATCCATATATAAAAAAC  450

seq1  AAGCAGGTGGGTTTCCTAGTAACCCTTGAGATGTGACTTAAGAGCTGTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGTGGGTTTCCTAGTAACCCTTGAGATGTGACTTAAGAGCTGTTT  500

seq1  TGTAGACACTTAAGTGTGACAACACTTGGAGTTGTTGAGCAGTTCACACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGACACTTAAGTGTGACAACACTTGGAGTTGTTGAGCAGTTCACACC  550

seq1  TACACCTGCATGCGCCTTGCTCTTTCCTTGAGAACGTATTAAGTTTTACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACCTGCATGCGCCTTGCTCTTTCCTTGAGAACGTATTAAGTTTTACA  600

seq1  CTTAAATCTGTCAAACTCTAATATTAAATACCAACTCTGCTTCACTGTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAATCTGTCAAACTCTAATATTAAATACCAACTCTGCTTCACTGTTT  650

seq1  TGTCCCGACATTGTTTTCTGTGCTGTCGAGAATCTTGACTTAAACCAGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCCGACATTGTTTTCTGTGCTGTCGAGAATCTTGACTTAAACCAGGC  700

seq1  TGGAGGCTTCACTAGAGTGGTCTCTGGAAGAATTCCTTAGGCTGCGGTAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGCTTCACTAGAGTGGTCTCTGGAAGAATTCCTTAGGCTGCGGTAG  750

seq1  GCAGTGCATGGAATTC  766
      ||||||||||||||||
seq2  GCAGTGCATGGAATTC  766

seq1: chr6_72603287_72604413
seq2: B6Ng01-224M13.g_68_1187

seq1  GAATTCTAAGTGCTTTGCGGGACCACGAACTAGGGCAGTCGGAGGTATCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAGTGCTTTGCGGGACCACGAACTAGGGCAGTCGGAGGTATCA  50

seq1  GTGCCAGGAGCATGCAGGCATCTGCAGTTCTGAATGCCTAGGTCACGCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCAGGAGCATGCAGGCATCTGCAGTTCTGAATGCCTAGGTCACGCCA  100

seq1  GTGGAAAGAAACTGCTTTTCCAAAAAGATTTATTTATTTATTTTCAGTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAAGAAACTGCTTTTCCAAAAAGATTTATTTATTTATTTTCAGTAT  150

seq1  TAATTCGGTCTCTGTGTGTTGTGTACATGTGTGTGGGTATCCACACAGGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTCGGTCTCTGTGTGTTGTGTACATGTGTGTGGGTATCCACACAGGT  200

seq1  CAGTGAGTTGGATCTCTTTGGGCTACAATTGCCTACGGTTGTGTAAGCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGAGTTGGATCTCTTTGGGCTACAATTGCCTACGGTTGTGTAAGCCA  250

seq1  TGAACTATGGGTGTTGAAACTAAACTCGAGTCCTCTGCAAGAACAGTACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTATGGGTGTTGAAACTAAACTCGAGTCCTCTGCAAGAACAGTACC  300

seq1  CACTCTTTAAACACTGCAACATCTCTCCAGTGCCAAGAAAGCTCTTTTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTTTAAACACTGCAACATCTCTCCAGTGCCAAGAAAGCTCTTTTTG  350

seq1  GCAGTGGTTCCCATGAGAGGCCGGCCGCACAATTATCCTGGAGGTCACTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGGTTCCCATGAGAGGCCGGCCGCACAATTATCCTGGAGGTCACTG  400

seq1  CACATGGGTGGAGCATGTCTGTGGGGATTAGGCTGAGCTAAGACTCTGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGGGTGGAGCATGTCTGTGGGGATTAGGCTGAGCTAAGACTCTGGG  450

seq1  CACAATAATGGTGTGTGGACAAATTAAAACAGGTTTCGCCAAGCCTTATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAATAATGGTGTGTGGACAAATTAAAACAGGTTTCGCCAAGCCTTATC  500

seq1  TAAGCTCTGTTGAACAGGCTGCGGGAGGCTCAAACTTCTGACCAGCACAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCTCTGTTGAACAGGCTGCGGGAGGCTCAAACTTCTGACCAGCACAT  550

seq1  CACAGCCGGGCATCAGCGCAGCCGATGTGCTCACAGCCTGGTCCAGCTAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCCGGGCATCAGCGCAGCCGATGTGCTCACAGCCTGGTCCAGCTAC  600

seq1  CCCGCTCTCCTGGGATGACCACTGAAGAGGCAAAGCTCCCTTTGTCTTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGCTCTCCTGGGATGACCACTGAAGAGGCAAAGCTCCCTTTGTCTTCA  650

seq1  AAGTATCAATACAACTCTTGGAGCTTCTATGACCAAAGGACCCCTCAGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTATCAATACAACTCTTGGAGCTTCTATGACCAAAGGACCCCTCAGGA  700

seq1  TTCAGAGACAGAATAGTGCCATGCCACCAATCTTCAATATACTGCGTCAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGAGACAGAATAGTGCCATGCCACCAATCTTCAATATACTGCGTCAA  750

seq1  AATGCTACAGTCTCTTGCGACACATACTATGGGCTGATAGACAGTTCCAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCTACAGTCTCTTGCGACACATACTATGGGCTGATAGACAGTTCCAA  800

seq1  TTTTCACAGAACCTTGGAAAATGGCTTACCCTTCTGCCATTCTGGTTTAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCACAGAACCTTGGAAAATGGCTTACCCTTCTGCCATTCTGGTTTAT  850

seq1  AGTTAAGTACAGTGAAGCTAAGGTTTAAGATGTATCTTTTTGTTGGGGGC  900
      ||||||||||||||||||||| |||||||||||||||||||||| |||||
seq2  AGTTAAGTACAGTGAAGCTAA-GTTTAAGATGTATCTTTTTGTT-GGGGC  898

seq1  CATCAAG-TTGGTCAGTAGGTAACGGACCTTGCCACCAAGCCTGACAAGT  949
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAAGTTTGGTCAGTAGGTAACGGACCTTGCCACCAAGCCTGACAAGT  948

seq1  AGAGTTTGATTCCTGAGGCCTACATGGTGGAAGGAGAGAACAGACACCTG  999
      |||||||||||||||| |||||| ||||||   |||||||||||||||||
seq2  AGAGTTTGATTCCTGA-GCCTAC-TGGTGG--TGAGAGAACAGACACCTG  994

seq1  GAGCCTGGAAGTTGTCCTC-TGACCTCCACACATGTGC-TGTTGTGCCAA  1047
       ||||| | |||||||||| |||||||||||||||||| |||||||||| 
seq2  AAGCCT-GCAGTTGTCCTCTTGACCTCCACACATGTGCTTGTTGTGCCAT  1043

seq1  TCACTACCCCTCTAGATAAAT-GAAATAAATGCAATAAAAATCGCTCGTT  1096
      ||||||| ||||||||| ||| ||||||| |||||| ||| |||||||  
seq2  TCACTACTCCTCTAGATTAATGGAAATAATTGCAAT-AAATTCGCTCGGC  1092

seq1  TAAATGTGTGCA-TGTGTGACTAGGTGTGGTG  1127
      | |||||| ||| ||| |||||||| ||||||
seq2  T-AATGTG-GCACTGT-TGACTAGG-GTGGTG  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information