MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-224P23
Chromosome	6 (Build37)
Map Location	89,577,774 - 89,578,476
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Mgll, Abtb1, Podxl2, LOC100043146, Mcm2, Gpr175, 4933427D06Rik, Gm1965, LOC100043153, LOC100043159, EG624483, EG624491, LOC665547, EG624537, Gm839, 4930512J16Rik, Plxna1, Chchd6
Downstream gene	Txnrd3, V1r-ps1, V1rb7, V1rb9, V1r-ps2, V1r-ps3, V1ra6, V1ra5, V1rb4, V1r-ps4, V1ra2, V1rb8, V1ra4, V1ra3, V1rb2, V1rb1, V1ra1, LOC625050, V1ra7, V1ra8, V1rb3, LOC100043191, V1r-ps5, V1ra9, BC048671, Chst13, Uroc1, Zxdc, Ccdc37, Klf15, Aldh1l1, Slc41a3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mgll (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23945 MGI:1346042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abtb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80283 MGI:1933148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Podxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319655 MGI:2442488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Mcm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17216 MGI:105380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24100 MGI:1345190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG624483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG624491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC665547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG624537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Gm839 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330379 MGI:2685685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930512J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Plxna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18844 MGI:107685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66098 MGI:1913348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnrd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113869 MGI:2148531
definition	note : vomeronasal 1 receptor, pseudogene 1 pseudo : _no_value

name	V1rb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113870 MGI:2148532
definition	note : vomeronasal 1 receptor, pseudogene 2 pseudo : _no_value

name	V1r-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113871 MGI:2148533
definition	note : vomeronasal 1 receptor, pseudogene 3 pseudo : _no_value

name	V1ra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	V1r-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113872 MGI:2148534
definition	gene_synonym : V1RB3 note : vomeronasal 1 receptor, pseudogene 4 pseudo : _no_value

name	V1ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113846 MGI:2148509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins pseudo : _no_value

name	V1ra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113853 MGI:2148516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1r-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113873 MGI:2148535
definition	note : vomeronasal 1 receptor, pseudogene 5 pseudo : _no_value

name	V1ra9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins

name	Uroc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243537 MGI:2385332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zxdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ccdc37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	Klf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107747 MGI:1340024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71699 MGI:1918949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mgll (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982751 GeneID:23945 MGI:1346042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoglyceride lipase transcript_id : NM_011844.3

name	Abtb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365947 GeneID:80283 MGI:1933148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and BTB (POZ) domain containing 1 transcript_id : NM_030251.2

name	Podxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542456 GeneID:319655 MGI:2442488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocalyxin-like 2 transcript_id : NM_176973.3

name	Mcm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678825 GeneID:17216 MGI:105380
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 2 mitotin (S. cerevisiae) transcript_id : NM_008564.1

name	Gpr175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326470 GeneID:24100 MGI:1345190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 175 transcript_id : NM_011906.2

name	4933427D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378057 GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D06 gene transcript_id : NM_175017.3

name	Gm1965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801784 GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1965, (NCBI) transcript_id : NM_001033491.2

name	LOC100043159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255239 GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043159 transcript_id : XM_001479648.1

name	EG624483 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255241 GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG624483 transcript_id : XM_889034.3

name	EG624491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255243 GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624491 transcript_id : XM_889044.3

name	EG624537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255245 GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624537 transcript_id : XM_889083.3

name	Gm839 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235726 GeneID:330379 MGI:2685685
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 839, (NCBI) transcript_id : NM_201356.1

name	4930512J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255354 GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930512J16 gene transcript_id : XM_001480366.1

name	Plxna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679388 GeneID:18844 MGI:107685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin A1 transcript_id : NM_008881.1

name	Chchd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754145 GeneID:66098 MGI:1913348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 6 transcript_id : NM_025351.2

name	Txnrd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735448 GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 3 transcript_id : NM_153162.3

name	V1rb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716538 GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B7 transcript_id : NM_053228.1

name	V1rb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716542 GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B9 transcript_id : NM_053230.1

name	V1ra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716528 GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A6 transcript_id : NM_053221.1

name	V1ra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716526 GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A5 transcript_id : NM_053220.1

name	V1rb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553591 GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs product : vomeronasal 1 receptor, B4 transcript_id : NM_053227.2

name	V1ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665735 GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A2 transcript_id : NM_011684.2

name	V1rb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716540 GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B8 transcript_id : NM_053229.1

name	V1ra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716524 GeneID:113846 MGI:2148509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A4 transcript_id : NM_053219.1

name	V1ra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716522 GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A3 transcript_id : NM_053218.1

name	V1rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755950 GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1, receptor B2 transcript_id : NM_011911.1

name	V1rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716532 GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B1 transcript_id : NM_053225.1

name	V1ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949776 GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A1 transcript_id : NM_011683.2

name	V1ra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361225 GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A7 transcript_id : NM_053222.1

name	V1ra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361227 GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A8 transcript_id : NM_053223.1

name	V1rb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716534 GeneID:113853 MGI:2148516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B3 transcript_id : NM_053226.1

name	V1ra9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716530 GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A9 transcript_id : NM_053224.1

name	BC048671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802476 GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048671 transcript_id : NM_177738.2

name	Chst13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377995 GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins product : carbohydrate (chondroitin 4) sulfotransferase 13 transcript_id : XM_978459.1

name	Uroc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450100 GeneID:243537 MGI:2385332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocanase domain containing 1 transcript_id : NM_144940.1

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381340 GeneID:80292 MGI:1933108
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_030260.2

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802546 GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_173002.2

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255366 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : coiled-coil domain containing 37, transcript variant 2 transcript_id : XM_001480392.1

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255364 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : coiled-coil domain containing 37, transcript variant 1 transcript_id : XM_001480389.1

name	Klf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130317 GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 15 transcript_id : NM_023184.3

name	Aldh1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532958 GeneID:107747 MGI:1340024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member L1 transcript_id : NM_027406.1

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734230 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_027868.2

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734224 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_001037493.1

name	Mgll (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754690 CCDS:CCDS20338.1 GeneID:23945 MGI:1346042
definition	GO_function : GO:0047372 - acylglycerol lipase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] citation : [PUBMED 9341166] codon_start : 1 note : monoacylglycerol lipase product : monoglyceride lipase protein_id : NP_035974.1

name	Abtb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384866 CCDS:CCDS20339.1 GeneID:80283 MGI:1933148
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mFLJ00331 protein product : ankyrin repeat and BTB (POZ) domain containing 1 protein_id : NP_084527.1

name	Podxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542457 CCDS:CCDS20340.1 GeneID:319655 MGI:2442488
definition	codon_start : 1 exception : mismatches in translation product : podocalyxin-like 2 protein_id : NP_795947.2

name	Mcm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678826 GeneID:17216 MGI:105380
definition	GO_component : GO:0005664 - nuclear origin of replication recognition complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003688 - DNA replication origin binding [Evidence IDA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence TAS]; GO:0006268 - DNA unwinding during replication [Evidence IDA]; GO:0006334 - nucleosome assembly [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mini chromosome maintenance deficient 2 product : minichromosome maintenance deficient 2 mitotin protein_id : NP_032590.1

name	Gpr175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326471 GeneID:24100 MGI:1345190
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane domain protein regulated in adipocytes 40 kDa product : G protein-coupled receptor 175 protein_id : NP_036036.2

name	4933427D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424689 CCDS:CCDS20341.1 GeneID:232217 MGI:3026922
definition	codon_start : 1 product : hypothetical protein LOC232217 protein_id : NP_778182.1

name	Gm1965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702029 GeneID:434065 MGI:3584270
definition	codon_start : 1 product : hypothetical protein LOC434065 protein_id : NP_001028663.1

name	LOC100043159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255240 GeneID:100043159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479698.1

name	EG624483 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255242 GeneID:624483 MGI:3645279
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894127.3

name	EG624491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255244 GeneID:624491 MGI:3645511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894137.2

name	EG624537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255246 GeneID:624537 MGI:3645589
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894176.2

name	Gm839 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235727 GeneID:330379 MGI:2685685
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC330379 protein_id : NP_958744.1

name	4930512J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255355 GeneID:75131 MGI:1922381
definition	codon_start : 1 product : hypothetical protein LOC75131 protein_id : XP_001480416.1

name	Plxna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679389 CCDS:CCDS20344.1 GeneID:18844 MGI:107685
definition	GO_component : GO:0005886 - plasma membrane [Evidence IC] GO_function : GO:0017154 - semaphorin receptor activity [Evidence IPI] codon_start : 1 note : plexin 1 product : plexin A1 protein_id : NP_032907.1

name	Chchd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754146 GeneID:66098 MGI:1913348
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : coiled-coil-helix-coiled-coil-helix domain containing 6 protein_id : NP_079627.2

name	Txnrd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735449 GeneID:232223 MGI:2386711
definition	GO_component : GO:0005792 - microsome [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence IDA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : thioredoxin and glutathione reductase product : thioredoxin reductase 3 protein_id : NP_694802.2 transl_except : (pos:89624783..89624785,aa:Sec)

name	V1rb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716539 CCDS:CCDS20346.1 GeneID:113855 MGI:2148518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B7 protein_id : NP_444458.1

name	V1rb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716543 GeneID:113857 MGI:2148520
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A12 product : vomeronasal 1 receptor, B9 protein_id : NP_444460.1

name	V1ra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716529 GeneID:113848 MGI:2148511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RA10; vomeronasal receptor 1 A1; vomeronasal receptor 1 A3 product : vomeronasal 1 receptor, A6 protein_id : NP_444451.1

name	V1ra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716527 GeneID:113847 MGI:2148510
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A2 product : vomeronasal 1 receptor, A5 protein_id : NP_444450.1

name	V1rb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553592 GeneID:113854 MGI:2148517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A10; vomeronasal receptor V1RB11 product : vomeronasal 1 receptor, B4 protein_id : NP_444457.2

name	V1ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665736 GeneID:22297 MGI:1333762
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 2; vomeronasal 1, receptor 2; vomeronasal receptor V1RA11; vomeronasal receptor 1 A9 product : vomeronasal 1 receptor, A2 protein_id : NP_035814.2

name	V1rb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716541 CCDS:CCDS20348.1 GeneID:113856 MGI:2148519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B8 protein_id : NP_444459.1

name	V1ra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716525 CCDS:CCDS20349.1 GeneID:113846 MGI:2148509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor 1 A7 product : vomeronasal 1 receptor, A4 protein_id : NP_444449.1

name	V1ra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716523 CCDS:CCDS20350.1 GeneID:113845 MGI:2148508
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A3 protein_id : NP_444448.1

name	V1rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755951 CCDS:CCDS20351.1 GeneID:24112 MGI:1344384
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 5; vomeronasal organ family 1, receptor B2 product : vomeronasal 1, receptor B2 protein_id : NP_036041.1

name	V1rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716533 CCDS:CCDS20352.1 GeneID:113852 MGI:2148515
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A5 product : vomeronasal 1 receptor, B1 protein_id : NP_444455.1

name	V1ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949777 GeneID:22296 MGI:1333759
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 1; vomeronasal 1, receptor 1; vomeronasal receptor V1RA1 product : vomeronasal 1 receptor, A1 protein_id : NP_035813.2

name	V1ra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361226 CCDS:CCDS20353.1 GeneID:113849 MGI:2148512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A7 protein_id : NP_444452.1

name	V1ra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361228 CCDS:CCDS20354.1 GeneID:113850 MGI:2148513
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A8 protein_id : NP_444453.1

name	V1rb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716535 CCDS:CCDS20355.1 GeneID:113853 MGI:2148516
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, B3 protein_id : NP_444456.1

name	V1ra9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716531 CCDS:CCDS20356.1 GeneID:113851 MGI:2148514
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A9 protein_id : NP_444454.1

name	BC048671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244226 CCDS:CCDS20357.1 GeneID:243535 MGI:2679261
definition	codon_start : 1 product : hypothetical protein LOC243535 protein_id : NP_808406.1

name	Chst13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377996 GeneID:71797 MGI:1919047
definition	codon_start : 1 product : carbohydrate (chondroitin 4) sulfotransferase 13 protein_id : XP_983553.1

name	Uroc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450101 GeneID:243537 MGI:2385332
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016153 - urocanate hydratase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence IEA]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : urocanase domain containing 1 protein_id : NP_659189.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370506 CCDS:CCDS20358.1 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ZXD family zinc finger C isoform 2 protein_id : NP_766590.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385100 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : ZXD family zinc finger C isoform 1 protein_id : NP_084536.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255365 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 1 protein_id : XP_001480439.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255367 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 2 protein_id : XP_001480442.1

name	Klf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963561 CCDS:CCDS20360.1 GeneID:66277 MGI:1929988
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Kruppel-like factor 15 protein_id : NP_075673.1

name	Aldh1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532959 CCDS:CCDS20361.1 GeneID:107747 MGI:1340024
definition	EC_number : 1.5.1.6 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0016155 - formyltetrahydrofolate dehydrogenase activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009258 - 10-formyltetrahydrofolate catabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : formyltetrahydrofolate dehydrogenase product : aldehyde dehydrogenase 1 family, member L1 protein_id : NP_081682.1

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734231 CCDS:CCDS20362.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : solute carrier family 41, member 3 isoform 1 protein_id : NP_082144.2

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734225 CCDS:CCDS20363.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : solute carrier family 41, member 3 isoform 2 protein_id : NP_001032570.1

name	LOC100043146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043146
definition	number : 1 pseudo : _no_value

name	LOC100043146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043146
definition	number : 2 pseudo : _no_value

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 2 pseudo : _no_value

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 1 pseudo : _no_value

name	LOC665547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665547
definition	number : 1 pseudo : _no_value

name	LOC100043191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043191
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130732
definition	standard_name : D6Mit190

name	(CDS detail)
type	STS
link
xref	UniSTS:233942
definition	standard_name : Mgll

name	(CDS detail)
type	STS
link
xref	UniSTS:211734
definition	standard_name : RH128426

name	(CDS detail)
type	STS
link
xref	UniSTS:161784
definition	standard_name : RH124962

name	(CDS detail)
type	STS
link
xref	UniSTS:164332
definition	standard_name : AI847549

name	(CDS detail)
type	STS
link
xref	UniSTS:130918
definition	standard_name : D6Mit364

name	(CDS detail)
type	STS
link
xref	UniSTS:159540
definition	standard_name : AA959861

name	(CDS detail)
type	STS
link
xref	UniSTS:213930
definition	standard_name : RH130646

name	(CDS detail)
type	STS
link
xref	UniSTS:130812
definition	standard_name : D6Mit263

name	(CDS detail)
type	STS
link
xref	UniSTS:130797
definition	standard_name : D6Mit248

name	(CDS detail)
type	STS
link
xref	UniSTS:235493
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179412
definition	standard_name : AU023851

name	(CDS detail)
type	STS
link
xref	UniSTS:210429
definition	standard_name : RH136443

name	(CDS detail)
type	STS
link
xref	UniSTS:207993
definition	standard_name : RH127255

name	(CDS detail)
type	STS
link
xref	UniSTS:179413
definition	standard_name : AU018164

name	(CDS detail)
type	STS
link
xref	UniSTS:235489
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179414
definition	standard_name : AU024342

name	(CDS detail)
type	STS
link
xref	UniSTS:125271
definition	standard_name : MHAa67d2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207994
definition	standard_name : AU014819

name	(CDS detail)
type	STS
link
xref	UniSTS:272923
definition	standard_name : PMC313053P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130879
definition	standard_name : D6Mit325

name	(CDS detail)
type	STS
link
xref	UniSTS:159541
definition	standard_name : AI196535

name	(CDS detail)
type	STS
link
xref	UniSTS:495550
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495554
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494016
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493164
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490656
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490617
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490615
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493151
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493936
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490596
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490616
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130773
definition	standard_name : D6Mit227

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494014
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:124619
definition	standard_name : 46.MMHAP25FRH10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495549
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130675
definition	standard_name : D6Mit131

name	(CDS detail)
type	STS
link
xref	UniSTS:159545
definition	standard_name : AI265605

name	(CDS detail)
type	STS
link
xref	UniSTS:207998
definition	standard_name : BE136473

name	(CDS detail)
type	STS
link
xref	UniSTS:235501
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179418
definition	standard_name : AW048498

name	(CDS detail)
type	STS
link
xref	UniSTS:222798
definition	standard_name : RH140732

name	(CDS detail)
type	STS
link
xref	UniSTS:468007
definition	standard_name : Klf15

name	(CDS detail)
type	STS
link
xref	UniSTS:179415
definition	standard_name : AW494632

name	(CDS detail)
type	STS
link
xref	UniSTS:164331
definition	standard_name : AV048136

name	(CDS detail)
type	STS
link
xref	UniSTS:130674
definition	standard_name : D6Mit130

name	(CDS detail)
type	STS
link
xref	UniSTS:130917
definition	standard_name : D6Mit363

name	(CDS detail)
type	STS
link
xref	UniSTS:207995
definition	standard_name : AU022697

name	(CDS detail)
type	STS
link
xref	UniSTS:180580
definition	standard_name : AU024588

name	LOC625050 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255359 GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins product : similar to vomeronasal receptor V1RA11 pseudo : _no_value transcript_id : XR_034665.1

clone name	MSMg01-340C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-111P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-224P23.b	B6Ng01-224P23.g
ACC	GA039303	GA039304
length	708	1,186
definition	B6Ng01-224P23.b	B6Ng01-224P23.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcacgattcctgttctttatattaggtctgattcctgagcaacacg tccctgttgactgactctggcggctgttccacaggggcactagaaagact aatgctcagattcttaaaccaactcatagatttgcaaacagatctgagca gctagcagcacctatagctttgcatgctgagcagaggttcccgcatgact gtgtctaagcgctgtaaccctaccacacttcttccaaccctcctctactt ccctgttccagcacttctggacaggttggcttggtaagacttggagggtg agtagatccttaagaatcgaaacaaagtggaggtatcttttctggtggaa ggtacacgaagaggagagagtcaagatgtgtcagaatctgtaggatgtga gactcacagactctgggttaagtcaggaaatgatgtcagttgcgcaatgc ataagtggttgaaagggaaagcaaggctggtaaagaactgatagggacca tggtgagtgtggtgactggcgagagtcttcccttagacgtgttattgtgc taaccttgcggaaccatggggtctatgcatcattaagtgcgactggacca gacacagaaagcctactttttcagacttcccagtcctcttcatttttgct ttttggcaagaaaagccctgatttgtccagctgtcagaaaggaaaggagg gagggggg	gaattctcacctgacaaatactgaatggcaaacaagcacctgaaaaaatg ttcaagatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccattctggaaatcagtctggcggttcctca gaaaactggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa gaaactcacacaatatgtactcactgataagtggatattagccccaaacc taggatacccaagatataagatataatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtgggcactatgcccctccttagatttgggaa caaaacacccatggaaggagttacagagacaaagattggagctgagatga aaggatggaccacgtagagactgccatatccagggatccaccccataatc agcatccaaacactgacaccattgcatacactagcaagattttattgaaa ggacccagatgtagctgtctcttgtgagactatgctggggcctagcaaac acagaagtggatgctcacagtcagctaatggatggatcatagggctccca atggaggagctagagatagtagcccaaggagctaatggtatctgcaacct atagtggaacacattatgaagtagccagtacccggagcttcttgactcta gctgcataatatatccaaaggatgggcttagtcgtcaatcattgaaagga aagccattgaactttgcccaaacctttatgctctagttacatggtaatcg gaggctataaagggtgaatgggtttggccatcgtga
quality values	Open. Hide. 41 45 11 15 27 30 14 9 10 17 11 10 14 10 15 30 12 20 22 12 20 20 21 23 26 37 32 16 11 25 15 16 12 18 34 17 18 18 19 10 18 22 18 15 11 13 18 16 23 12 23 18 18 30 34 34 28 17 23 24 24 23 27 19 23 19 49 30 37 40 24 24 27 16 20 29 18 27 30 30 20 34 13 13 11 23 12 19 12 30 24 18 11 24 18 17 16 34 26 26 19 18 34 34 18 26 30 30 11 34 27 27 24 20 24 18 13 13 18 17 14 12 23 23 23 17 21 22 10 21 23 23 27 24 27 18 19 19 24 34 19 41 34 34 27 23 29 12 23 13 16 24 21 16 13 19 19 17 18 19 18 18 19 12 30 15 30 23 27 23 12 12 18 12 18 23 19 18 13 17 13 21 18 10 33 16 28 28 17 30 34 46 39 21 13 10 27 27 16 18 27 18 18 14 24 27 31 43 18 23 12 18 18 21 16 17 17 34 13 13 13 11 16 12 18 17 16 19 18 23 23 13 23 19 15 13 13 18 18 19 18 18 23 23 27 18 18 24 24 30 24 24 34 23 31 13 27 24 19 10 12 18 15 26 27 34 27 23 30 30 27 23 13 19 34 24 18 23 18 13 23 18 36 27 18 24 27 12 41 24 18 23 27 13 27 17 25 29 12 24 34 13 30 18 13 34 27 27 30 24 24 18 5 23 31 33 17 17 14 12 14 7 22 11 15 21 24 19 30 13 34 13 28 14 13 22 24 13 18 23 18 34 17 27 39 24 41 17 30 18 13 34 5 14 11 34 13 18 34 19 18 43 24 24 39 16 27 13 28 12 10 16 23 14 22 34 16 34 23 21 22 24 17 14 36 23 30 24 24 21 14 13 8 27 38 26 23 21 18 18 17 34 30 30 28 14 7 34 17 43 30 39 39 30 34 34 23 23 20 19 16 11 25 28 24 12 48 28 29 16 18 19 23 13 10 17 20 8 12 18 24 23 23 18 24 17 11 18 46 28 30 10 24 18 13 16 27 25 18 23 16 28 20 20 26 29 18 25 20 16 20 24 14 18 23 34 18 10 18 26 18 19 13 18 13 13 13 10 30 24 16 13 13 17 24 19 21 21 39 38 23 18 12 10 22 13 10 21 32 32 32 24 32 32 15 14 16 24 14 5 19 22 44 31 44 28 26 18 25 25 16 16 17 27 13 10 24 14 18 10 21 26 31 23 42 31 39 42 39 25 27 22 20 31 14 10 10 9 8 9 21 18 12 21 21 17 30 37 22 21 28 27 37 25 23 27 27 19 13 42 29 27 20 26 10 31 35 16 20 10 14 23 18 23 21 12 22 14 16 8 16 35 25 31 18 23 10 22 18 17 14 27 22 26 27 32 30 31 33 11 18 23 10 8 35 28 38 24 42 28 25 28 15 21 15 14 20 21 35 36 27 35 23 35 34 12 14 23 15 10 15 27 27 18 23 19 17 17 22 19 52 41 34 32 18 12 12 18 32 39 31 17 27 12 17 15 30 35 30 23 35 35 26 12 15 35 17 46 32 18 19 25 33 12 20 12 24 30 18 17 12 16 19 21 8 9 14 19	Open. Hide. 62 38 21 33 56 56 39 39 33 26 21 20 19 13 10 17 20 23 24 22 24 32 26 22 24 26 38 28 18 18 10 21 10 43 23 13 30 19 30 36 36 30 30 20 23 30 34 30 28 43 30 34 18 13 13 14 13 24 15 18 18 23 18 24 24 24 17 34 24 17 13 39 30 39 34 43 34 43 39 23 23 29 26 20 19 18 24 19 26 17 24 30 30 24 30 32 30 21 34 30 30 30 30 19 30 34 30 28 18 34 24 34 24 23 13 30 32 24 20 49 32 30 43 34 23 30 30 34 12 49 41 28 44 43 24 24 17 18 24 17 17 13 49 18 30 28 18 30 13 30 19 13 43 30 34 29 43 34 34 34 24 34 49 30 49 24 24 18 23 18 27 18 34 27 23 18 34 18 29 43 34 29 24 30 24 24 23 23 19 24 18 34 34 49 26 30 34 43 30 49 49 43 43 30 30 39 30 24 22 39 24 30 30 36 25 23 24 18 24 24 24 12 34 34 30 39 62 36 39 39 34 34 30 39 13 24 24 24 34 25 18 18 26 13 18 24 18 17 17 13 10 28 19 18 18 18 24 30 30 34 24 24 34 24 13 22 30 36 30 26 34 23 19 24 39 24 41 44 43 43 43 24 24 30 24 18 32 26 32 26 34 30 43 34 39 32 32 25 26 22 20 32 32 30 28 25 20 15 10 11 22 16 14 27 15 24 29 26 27 31 16 22 22 24 24 24 24 25 25 22 42 30 32 51 38 25 31 26 14 23 25 23 32 33 51 39 25 16 19 21 20 14 14 16 12 20 14 15 23 14 11 26 32 32 31 32 33 32 32 32 32 29 31 18 25 10 13 20 13 26 34 23 13 29 24 22 24 23 23 23 15 32 26 23 24 21 30 9 21 22 27 27 29 33 31 30 22 24 23 33 20 26 42 18 35 50 34 18 22 18 18 21 17 31 14 14 24 18 14 18 15 27 28 32 30 25 26 34 27 35 27 18 20 28 14 31 18 27 20 42 23 32 15 30 27 17 23 23 31 42 35 35 10 24 21 30 30 27 19 20 19 19 18 20 39 31 30 27 25 21 34 34 20 23 30 20 37 15 22 20 29 18 25 46 32 24 18 19 15 27 21 24 27 24 30 26 27 28 28 25 32 32 24 19 26 35 29 33 21 24 29 28 18 25 22 17 27 32 37 19 35 40 41 23 35 15 27 25 26 22 28 19 27 23 21 14 21 13 15 12 16 27 23 22 23 41 50 52 53 51 51 46 49 46 58 58 58 58 51 47 58 54 40 58 51 58 39 53 58 58 42 49 58 51 51 40 50 39 39 46 38 48 52 50 41 16 50 49 44 44 35 41 36 58 47 46 48 43 58 50 41 58 49 58 41 52 52 49 54 39 58 42 53 52 47 43 40 58 54 51 52 41 39 58 58 47 40 52 40 51 51 58 39 42 50 53 47 39 50 41 51 35 19 42 17 35 47 41 44 23 36 25 53 54 42 54 35 42 53 40 53 50 34 39 37 53 42 32 40 49 40 39 46 52 53 35 38 31 42 39 23 38 49 54 33 40 54 46 37 44 39 24 49 51 51 41 31 47 54 42 28 38 37 53 42 38 9 49 41 26 52 53 40 53 42 37 54 32 33 37 31 54 53 32 35 34 40 51 19 35 14 52 37 31 46 6 24 32 32 33 49 11 9 47 16 19 26 28 33 23 32 32 36 30 31 32 21 40 30 31 31 34 32 19 25 21 26 28 38 32 31 30 32 32 23 21 31 35 51 29 31 51 41 40 15 32 28 31 33 31 31 31 33 33 35 15 15 5 21 26 30 14 18 19 43 24 15 13 21 42 16 18 23 28 28 23 31 33 31 19 28 17 18 21 33 30 24 23 28 28 48 46 26 14 22 18 31 33 48 18 9 22 14 6 46 37 27 22 41 26 25 30 13 8 30 31 28 10 8 8 16 39 11 25 34 33 32 20 32 18 31 30 34 32 32 34 32 46 31 20 13 17 15 21 17 26 20 44 18 11 18 11 17 25 17 18 6 17 25 21 20 13 24 32 38 32 13 9 23 28 28 38 35 24 32 35 18 23 23 32 26 8 9 20 25 21 27 32 19 12 13 19 39 26 19 10 12 39 32 12 20 21 24 24 8 7 8 23 5 14 22 21 16 20 9 11 6 15 4 11 16 9 19 32 12 14 10 21 31 26 10 27 28 15 24 4 30 27 6 23 15 15 28 24 27 14 8 22 25 5 9 16 9 16 7 7 21 21 15 5 12 9 11 27 15 7 8 7 4 15 16 28 28 17 23 15 7 6 7 10 28 40 12 3 3 22 9 20 8 5 6 8 22 20 18 15 17 16 20 16 11 22 13 19 23 5 8 7 8 12 8 4 4 3 4 5 19 28 17 4 5 22 5 12 24 6 7 4 7 23 5 12 8 3 2 3 5 8 14 10 4 1 4 16 17 28 7 5 8 15 9 10 2 3 3 6 12 15 4 2 5 4 7 18 13 9 6 8 5 18 15 19 5 4 19 17 14 5 4 6 14 4 17 4 6 5 14 7 4 9 4 4 17 11 1 3 6 2 2 1 1 2 2 3 3 1 8 6 16 11 17 5 5 11 4 3 4 3 2 7 20 20 4 8 5 7 12 4 8 11 4 8 15 4 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_89577774_89578476
seq2: B6Ng01-224P23.b_44_751

seq1  GAATTCAAGATTCCTGTTCTTTATATTAGGTCTGATTCCTGAGCAACACG  50
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACGATTCCTGTTCTTTATATTAGGTCTGATTCCTGAGCAACACG  50

seq1  TCCCTGTTGACTGACTCTGGCGGCTGTTCCACAGTGGCACTAGAAAGACT  100
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  TCCCTGTTGACTGACTCTGGCGGCTGTTCCACAGGGGCACTAGAAAGACT  100

seq1  AATGCTCAGATTCTTAAACCAGCTCATAGATTTGCAAACAGATCTGAGCA  150
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  AATGCTCAGATTCTTAAACCAACTCATAGATTTGCAAACAGATCTGAGCA  150

seq1  GCTAGCAGCACCTATAGCTTTGCATGCTGAGCAGAGGTTCCCGCAGGACT  200
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GCTAGCAGCACCTATAGCTTTGCATGCTGAGCAGAGGTTCCCGCATGACT  200

seq1  GTGTCTAAGCGCTGTAACCCTACCACACTTCTTCCAACCCTCCTCTACTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTAAGCGCTGTAACCCTACCACACTTCTTCCAACCCTCCTCTACTT  250

seq1  CCCTGTTCCAGCACTTCTGGACAGGTTGGCTTGGTAAGACTTGGAGGGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGTTCCAGCACTTCTGGACAGGTTGGCTTGGTAAGACTTGGAGGGTG  300

seq1  AGTAGATCCTTAGGAATCGAAGCAAAGTGGAGGTATCTTTTCTGGTGGAA  350
      |||||||||||| |||||||| ||||||||||||||||||||||||||||
seq2  AGTAGATCCTTAAGAATCGAAACAAAGTGGAGGTATCTTTTCTGGTGGAA  350

seq1  GGCAGAGGAAGAGGAGAGAGTCAAGATGTGTCAGAATCTGTAGGATGTGA  400
      || | | |||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACACGAAGAGGAGAGAGTCAAGATGTGTCAGAATCTGTAGGATGTGA  400

seq1  GACTCAGAGACTCTGGGTTAAGTCAGGAAATGAAATCAGTTGCGCAATGC  450
      |||||| ||||||||||||||||||||||||||  |||||||||||||||
seq2  GACTCACAGACTCTGGGTTAAGTCAGGAAATGATGTCAGTTGCGCAATGC  450

seq1  AGAAGTGGTTGAAAGGGAAAGCAAGGCTGGTAAAGAACTGATAGGGACCA  500
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGTGGTTGAAAGGGAAAGCAAGGCTGGTAAAGAACTGATAGGGACCA  500

seq1  TGGTGAGTGTGGTGACTGGCAGAGAGTCATCCC-TAGACAGTGTTATTGT  549
      |||||||||||||||||||| ||||||| |||| ||||| ||||||||||
seq2  TGGTGAGTGTGGTGACTGGC-GAGAGTCTTCCCTTAGAC-GTGTTATTGT  548

seq1  GCTAACCTTGCGGAACCATGGGGTCTATGCATCAGTAAGTGGGACTGGAC  599
      |||||||||||||||||||||||||||||||||| |||||| ||||||||
seq2  GCTAACCTTGCGGAACCATGGGGTCTATGCATCATTAAGTGCGACTGGAC  598

seq1  CAGACACAG-AAGCCTAC-TTTTCAGACTTCCCAGTCCTCTTCA-TTTTG  646
      ||||||||| |||||||| ||||||||||||||||||||||||| |||||
seq2  CAGACACAGAAAGCCTACTTTTTCAGACTTCCCAGTCCTCTTCATTTTTG  648

seq1  C-TTTTGGCAAGAAAAGCCCTGA-TTGTCCAGCTGTCAG-AAGGAAAGGA  693
      | ||||||||||||||||||||| ||||||||||||||| ||||||||||
seq2  CTTTTTGGCAAGAAAAGCCCTGATTTGTCCAGCTGTCAGAAAGGAAAGGA  698

seq1  GGGAGGGGGG  703
      ||||||||||
seq2  GGGAGGGGGG  708

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information