MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-237P07
Chromosome	6 (Build37)
Map Location	129,221,505 - 129,315,755
singlet/doublet	doublet
Overlap gene	Cd69, 4922502D21Rik, Clec12a
Upstream gene	Tead4, LOC652986, Tulp3, 5930416I19Rik, Foxm1, Nrip2, Itfg2, Fkbp4, EG667598, Pzp, LOC384494, EG667610, BC048546, Klrb1a, EG545878, LOC677440, Clec2h, LOC100043863, LOC100043861, Klrb1c, LOC100043862, Klrb1d, LOC667706, Clec2i, Clec2g, LOC667715, BC064078, Clec2f, Klrb1f, Clec2e, Klrb1-ps1, Clec2d
Downstream gene	4933425B16Rik, Clec1b, Clec9a, Clec1a, Clec7a, Olr1, D630042F21Rik, Gabarapl1, Klre1, Klrd1, Klrk1, Klrc3, Klrc2, Klrc1, LOC640755, Klri1, Klri2, Gm156, Klra17, Klra5, LOC667764, Klra6, LOC100038893, LOC100038894, LOC100038895, Klra4, LOC667769, LOC100038897, Klra8, EG654449, Klra9, Klra7, LOC100038898, Klra12, Klra10, Klra13, Klra3, Klra1, LOC100038902, LOC100038903
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tead4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC652986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:652986
definition	note : ribosomal protein L18 pseudogene pseudo : _no_value

name	Tulp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22158 MGI:1329045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5930416I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72440 MGI:1915315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14235 MGI:1347487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60345 MGI:1891884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101142 MGI:1915450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14228 MGI:95543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667598 MGI:3647551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 72 ESTs, 41 Proteins

name	Pzp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11287 MGI:87854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG667610 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667610 MGI:3644570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 239 ESTs, 10 Proteins pseudo : _no_value

name	BC048546 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232400 MGI:3039594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrb1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17057 MGI:107540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545878 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 189 ESTs, 10 Proteins

name	LOC677440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	Clec2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94071 MGI:2136934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs

name	LOC100043861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins

name	Klrb1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17059 MGI:107538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043862 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Klrb1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80782 MGI:1931428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Clec2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93675 MGI:2136650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70809 MGI:1918059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	BC064078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408064 MGI:3040692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 39 ESTs

name	Clec2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435921 MGI:3522133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	Klrb1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232408 MGI:2442965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Clec2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232409 MGI:3028921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrb1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:724020 MGI:3624540
definition	gene_synonym : Nkrp1e note : killer cell lectin-like receptor subfamily B member 1, pseudogene 1 pseudo : _no_value

name	Clec2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93694 MGI:2135589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd69 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12515 MGI:88343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4922502D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381816 MGI:2685920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232413 MGI:3040968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933425B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71183 MGI:1918433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	Clec1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56760 MGI:1913287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232414 MGI:2444608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243653 MGI:2444151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56644 MGI:1861431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108078 MGI:1261434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630042F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330428 MGI:2442838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarapl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57436 MGI:1914980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klre1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243655 MGI:2662547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16643 MGI:1196275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Klrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58179 MGI:1929720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16642 MGI:1336162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16641 MGI:1336161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Klri1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503550 MGI:3530275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klri2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320407 MGI:2443965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232415 MGI:2685002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170733 MGI:2180674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16636 MGI:101903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Klra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16637 MGI:101902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16635 MGI:101904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667769 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins pseudo : _no_value

name	LOC100038897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16639 MGI:102968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654449 MGI:3644243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	Klra9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16640 MGI:1321153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16638 MGI:101901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16630 MGI:1321091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16628 MGI:1321093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16631 MGI:1321090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16634 MGI:101905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16627 MGI:101907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tead4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430567 GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 4 transcript_id : NM_001080979.1

name	Tead4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430565 GeneID:21679 MGI:106907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 4 transcript_id : NM_011567.2

name	Tulp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490352 GeneID:22158 MGI:1329045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby-like protein 3 transcript_id : NM_011657.2

name	5930416I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574051 GeneID:72440 MGI:1915315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5930416I19 gene transcript_id : NM_197981.1

name	Foxm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517696 GeneID:14235 MGI:1347487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box M1 transcript_id : NM_008021.4

name	Nrip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468976 GeneID:60345 MGI:1891884
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor interacting protein 2 transcript_id : NM_021717.1

name	Itfg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527141 GeneID:101142 MGI:1915450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 2 transcript_id : NM_133927.1

name	Fkbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129940 GeneID:14228 MGI:95543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 4 transcript_id : NM_010219.3

name	EG667598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378120 GeneID:667598 MGI:3647551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 72 ESTs, 41 Proteins product : predicted gene, EG667598 transcript_id : XM_991392.1

name	Pzp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124256485 GeneID:11287 MGI:87854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy zone protein transcript_id : NM_007376.4

name	BC048546 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375259 GeneID:232400 MGI:3039594
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048546 transcript_id : NM_001001179.2

name	Klrb1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981643 GeneID:17057 MGI:107540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1A transcript_id : NM_010737.2

name	EG545878 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378130 GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 189 ESTs, 9 Proteins product : predicted gene, EG545878, transcript variant 1 transcript_id : XM_620367.3

name	EG545878 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378128 GeneID:545878 MGI:3644646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 170 ESTs, 4 Proteins product : predicted gene, EG545878, transcript variant 6 transcript_id : XM_001003823.1

name	LOC677440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255340 GeneID:677440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to C-type lectin domain family 2, member g transcript_id : XM_001480476.1

name	Clec2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353148 GeneID:94071 MGI:2136934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member h transcript_id : NM_053165.3

name	LOC100043863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255438 GeneID:100043863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs product : hypothetical protein LOC100043863 transcript_id : XM_001481112.1

name	LOC100043861 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255433 GeneID:100043861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins product : similar to natural killer lectin-like receptor protein 1 e transcript_id : XM_001481108.1

name	Klrb1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678745 GeneID:17059 MGI:107538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1C transcript_id : NM_008527.1

name	LOC100043862 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255436 GeneID:100043862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to polyprotein transcript_id : XM_001481111.1

name	Klrb1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328453 GeneID:80782 MGI:1931428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1D transcript_id : NM_030599.3

name	Clec2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9933349 GeneID:93675 MGI:2136650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member i transcript_id : NM_020257.1

name	Clec2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369971 GeneID:70809 MGI:1918059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member g transcript_id : NM_027562.2

name	Clec2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255342 GeneID:435921 MGI:3522133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : C-type lectin domain family 2, member f transcript_id : XM_487967.2

name	Klrb1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379697 GeneID:232408 MGI:2442965
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1F transcript_id : NM_181064.3

name	Klrb1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25092654 GeneID:232408 MGI:2442965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1F transcript_id : NM_153094.1

name	Clec2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130488530 GeneID:232409 MGI:3028921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member e transcript_id : NM_153506.3

name	Clec2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892677 GeneID:93694 MGI:2135589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member d transcript_id : NM_053109.2

name	Cd69 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372001 GeneID:12515 MGI:88343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD69 antigen transcript_id : NM_001033122.2

name	4922502D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802578 GeneID:381816 MGI:2685920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4922502D21 gene transcript_id : NM_199034.3

name	Clec12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130457 GeneID:232413 MGI:3040968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 12, member a transcript_id : NM_177686.3

name	4933425B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255442 GeneID:71183 MGI:1918433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : RIKEN cDNA 4933425B16 gene transcript_id : XM_132881.5

name	Clec1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355991 GeneID:56760 MGI:1913287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 1, member b transcript_id : NM_019985.2

name	Clec9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674802 GeneID:232414 MGI:2444608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 9, member a transcript_id : NM_172732.2

name	Clec1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356146 GeneID:243653 MGI:2444151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 1, member a transcript_id : NM_175526.2

name	Clec7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910159 GeneID:56644 MGI:1861431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 7, member a transcript_id : NM_020008.1

name	Olr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053880 GeneID:108078 MGI:1261434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidized low density lipoprotein (lectin-like) receptor 1 transcript_id : NM_138648.2

name	D630042F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487150 GeneID:330428 MGI:2442838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630042F21 gene transcript_id : NM_001081186.1

name	Gabarapl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801743 GeneID:57436 MGI:1914980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 transcript_id : NM_020590.4

name	Klre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30520370 GeneID:243655 MGI:2662547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family E member 1 transcript_id : NM_153590.2

name	Klrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754469 GeneID:16643 MGI:1196275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily D, member 1 transcript_id : NM_010654.1

name	Klrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023657 GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily K, member 1 transcript_id : NM_001083322.1

name	Klrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023659 GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily K, member 1 transcript_id : NM_033078.3

name	Klrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946713 GeneID:58179 MGI:1929720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 3 transcript_id : NM_021378.1

name	Klrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386297 GeneID:16642 MGI:1336162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 2 transcript_id : NM_010653.3

name	Klrc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754465 GeneID:16641 MGI:1336161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 1 transcript_id : NM_010652.1

name	Klri1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593096 GeneID:503550 MGI:3530275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family I member 1 transcript_id : NM_001012520.1

name	Klri2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358946 GeneID:320407 MGI:2443965
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family I member 2 transcript_id : NM_177155.3

name	Gm156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701511 GeneID:232415 MGI:2685002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 156, (NCBI) transcript_id : NM_001014997.1

name	Klra17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559407 GeneID:170733 MGI:2180674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 17 transcript_id : NM_133203.1

name	Klra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130769 GeneID:16636 MGI:101903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 5 transcript_id : NM_008463.2

name	Klra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130779 GeneID:16637 MGI:101902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 6 transcript_id : NM_008464.2

name	LOC100038893 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255107 GeneID:100038893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038893 transcript_id : XM_001471782.1

name	LOC100038894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255109 GeneID:100038894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038894 transcript_id : XM_001471776.1

name	LOC100038895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255111 GeneID:100038895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038895 transcript_id : XM_001471780.1

name	Klra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130091 GeneID:16635 MGI:101904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 4 transcript_id : NM_010649.2

name	LOC100038897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255113 GeneID:100038897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038897 transcript_id : XM_001471777.1

name	Klra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922594 GeneID:16639 MGI:102968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 8 transcript_id : NM_010650.3

name	Klra9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922570 GeneID:16640 MGI:1321153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 9 transcript_id : NM_010651.3

name	Klra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355994 GeneID:16638 MGI:101901
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 7 transcript_id : NM_014194.2

name	LOC100038898 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255115 GeneID:100038898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038898 transcript_id : XM_001471682.1

name	Klra12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21327664 GeneID:16630 MGI:1321091
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 12 transcript_id : NM_010646.1

name	Klra10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506838 GeneID:16628 MGI:1321093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 10 transcript_id : NM_008459.2

name	Klra13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581537 GeneID:16631 MGI:1321090
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 13 transcript_id : NM_010647.2

name	Klra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922592 GeneID:16634 MGI:101905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 3 transcript_id : NM_010648.2

name	Klra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922591 GeneID:16627 MGI:101907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 1 transcript_id : NM_016659.3

name	LOC100038902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255117 GeneID:100038902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038902 transcript_id : XM_001471779.1

name	LOC100038903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255119 GeneID:100038903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038903 transcript_id : XM_001471680.1

name	Tulp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755905 GeneID:22158 MGI:1329045
definition	codon_start : 1 product : tubby-like protein 3 protein_id : NP_035787.1

name	5930416I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574052 GeneID:72440 MGI:1915315
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72440 protein_id : NP_932098.1

name	Foxm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517697 CCDS:CCDS20570.1 GeneID:14235 MGI:1347487
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence ISS]; GO:0001889 - liver development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : trident; forkhead homolog 16 product : forkhead box M1 protein_id : NP_032047.4

name	Nrip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468977 CCDS:CCDS20571.1 GeneID:60345 MGI:1891884
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : mismatches in translation function : nuclear receptor interacting protein note : neuronal interacting factor 1 product : nuclear receptor interacting protein 2 protein_id : NP_068363.1

name	Itfg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527142 CCDS:CCDS20572.1 GeneID:101142 MGI:1915450
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : integrin alpha FG-GAP repeat containing 2 protein_id : NP_598688.1

name	Fkbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753882 CCDS:CCDS20573.1 GeneID:14228 MGI:95543
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA]; GO:0005488 - binding [Evidence IEA]; GO:0035259 - glucocorticoid receptor binding [Evidence IDA]; GO:0005525 - GTP binding [Evidence IDA]; GO:0031072 - heat shock protein binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0007566 - embryo implantation [Evidence IMP]; GO:0046661 - male sex differentiation [Evidence IMP]; GO:0031503 - protein complex localization [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006463 - steroid hormone receptor complex assembly [Evidence IDA] codon_start : 1 product : FK506 binding protein 4 protein_id : NP_034349.1

name	EG667598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255431 GeneID:667598 MGI:3647551
definition	codon_start : 1 product : similar to U-snRNP-associated cyclophilin protein_id : XP_996486.2

name	Pzp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347469 GeneID:11287 MGI:87854
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IDA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] codon_start : 1 note : alpha 1 macroglobulin product : pregnancy zone protein protein_id : NP_031402.3

name	BC048546 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677551 GeneID:232400 MGI:3039594
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cDNA sequence BC048546 protein_id : NP_001001179.1

name	Klrb1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981644 CCDS:CCDS20574.1 GeneID:17057 MGI:107540
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 55 complex, locus A; natural killer cell receptor protein NKR-P1A; natural killer cell receptor-P1 product : killer cell lectin-like receptor subfamily B member 1A protein_id : NP_034867.2

name	EG545878 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63546142 GeneID:545878 MGI:3644646
definition	codon_start : 1 product : similar to TOM1 isoform 1 protein_id : XP_620367.1

name	EG545878 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378129 GeneID:545878 MGI:3644646
definition	codon_start : 1 product : similar to TOM1 isoform 6 protein_id : XP_001003823.1

name	LOC677440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255341 GeneID:677440
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480526.1

name	Clec2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745110 CCDS:CCDS20576.1 GeneID:94071 MGI:2136934
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0006968 - cellular defense response [Evidence TAS] codon_start : 1 note : C-type lectin related f product : C-type lectin domain family 2, member h protein_id : NP_444395.2

name	LOC100043863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255439 GeneID:100043863
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481162.1

name	LOC100043861 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255434 GeneID:100043861
definition	codon_start : 1 product : similar to natural killer lectin-like receptor protein 1 e protein_id : XP_001481158.1

name	LOC100043862 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255437 GeneID:100043862
definition	codon_start : 1 product : similar to polyprotein protein_id : XP_001481161.1

name	Klrb1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678746 GeneID:17059 MGI:107538
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0045954 - positive regulation of natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 note : lymphocyte antigen 59; natural killer cell-associated antigen 1; lymphocyte antigen 55 complex, locus C; killer cell lectin-like receptor subfamily A member 1C; natural killer cell receptor protein NKR-P1C; natural killer cell receptor-P1 product : killer cell lectin-like receptor subfamily B member 1C protein_id : NP_032553.1

name	Klrb1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328454 GeneID:80782 MGI:1931428
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0045953 - negative regulation of natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : lymphocyte antigen 55 complex, locus D; killer cell lectin-like receptor subfamily A member 1D product : killer cell lectin-like receptor subfamily B member 1D protein_id : NP_085102.3

name	Clec2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9933350 GeneID:93675 MGI:2136650
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0046703 - natural killer cell lectin-like receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0043113 - receptor clustering [Evidence IMP]; GO:0030833 - regulation of actin filament polymerization [Evidence IMP]; GO:0045076 - regulation of interleukin-2 biosynthesis [Evidence IMP]; GO:0042129 - regulation of T cell proliferation [Evidence IMP]; GO:0050852 - T cell receptor signaling pathway [Evidence IMP] codon_start : 1 note : osteoclast inhibitory lectin related protein 2; C-type lectin 1 product : C-type lectin domain family 2, member i protein_id : NP_064653.1

name	Clec2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386236 CCDS:CCDS20578.1 GeneID:70809 MGI:1918059
definition	GO_component : GO:0005615 - extracellular space [Evidence IC] GO_process : GO:0045671 - negative regulation of osteoclast differentiation [Evidence IDA] codon_start : 1 note : osteoclast inhibitory lectin related protein product : C-type lectin domain family 2, member g protein_id : NP_081838.1

name	Clec2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255343 GeneID:435921 MGI:3522133
definition	codon_start : 1 product : C-type lectin domain family 2, member f protein_id : XP_487967.2

name	Klrb1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092655 CCDS:CCDS20579.1 GeneID:232408 MGI:2442965
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : Nkrp1f protein protein_id : NP_694734.1

name	Klrb1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30840996 CCDS:CCDS20579.1 GeneID:232408 MGI:2442965
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : Nkrp1f protein protein_id : NP_851409.1

name	Clec2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130488531 GeneID:232409 MGI:3028921
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : C lectin-related protein A product : C-type lectin domain family 2, member e protein_id : NP_705726.3

name	Clec2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716407 CCDS:CCDS20581.1 GeneID:93694 MGI:2135589
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0046703 - natural killer cell lectin-like receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0006968 - cellular defense response [Evidence TAS]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IDA]; GO:0042270 - protection from natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 note : osteoclast inhibitory lectin product : C-type lectin domain family 2, member d protein_id : NP_444339.1

name	Cd69 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370294 CCDS:CCDS20582.1 GeneID:12515 MGI:88343
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : Very Early Activation Antigen product : CD69 antigen protein_id : NP_001028294.1

name	4922502D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841061 CCDS:CCDS20583.1 GeneID:381816 MGI:2685920
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381816 protein_id : NP_950199.1

name	Clec12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244122 CCDS:CCDS20584.1 GeneID:232413 MGI:3040968
definition	GO_component : GO:0009986 - cell surface [Evidence ISS] GO_function : GO:0019903 - protein phosphatase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0050776 - regulation of immune response [Evidence ISS] codon_start : 1 note : myeloid inhibitory C-type lectin-like receptor product : C-type lectin domain family 12, member a protein_id : NP_808354.1

name	4933425B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20833034 GeneID:71183 MGI:1918433
definition	codon_start : 1 product : macrophage antigen h protein_id : XP_132881.1

name	Clec1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910412 CCDS:CCDS20586.1 GeneID:56760 MGI:1913287
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 note : C-type lectin-like receptor 2 product : C-type lectin domain family 1, member b protein_id : NP_064369.1

name	Clec9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674803 GeneID:232414 MGI:2444608
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : C-type lectin domain family 9, member a protein_id : NP_766320.2

name	Clec1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202063 CCDS:CCDS20587.1 GeneID:243653 MGI:2444151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-type lectin-like receptor-1 protein_id : NP_780735.1

name	Clec7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910160 GeneID:56644 MGI:1861431
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0001846 - opsonin binding [Evidence IDA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA]; GO:0001874 - zymosan receptor activity [Evidence IDA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA]; GO:0001878 - response to yeast [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy function : co-stimulation of T cells note : dectin-1; beta-glucan receptor; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 12 product : dendritic cell-associated C-type lectin 1 protein_id : NP_064392.1

name	Olr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053881 CCDS:CCDS20588.1 GeneID:108078 MGI:1261434
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : oxidised low density lipoprotein (lectin-like) receptor 1 product : oxidized low density lipoprotein (lectin-like) receptor 1 protein_id : NP_619589.2

name	D630042F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487151 GeneID:330428 MGI:2442838
definition	codon_start : 1 product : hypothetical protein LOC330428 protein_id : NP_001074655.1

name	Gabarapl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181206 GeneID:57436 MGI:1914980
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : GABA(A) receptor-associated protein like 1 product : gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 protein_id : NP_065615.1

name	Klre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520371 CCDS:CCDS20589.1 GeneID:243655 MGI:2662547
definition	GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family E member 1 protein_id : NP_705818.2

name	Klrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754470 GeneID:16643 MGI:1196275
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor, subfamily D, member 1 protein_id : NP_034784.1

name	Klrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14861840 GeneID:27007 MGI:1196250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : isoform a is encoded by transcript variant 1; natural killer cell group 2D product : NKG2-D isoform a protein_id : NP_149069.1

name	Klrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134023658 GeneID:27007 MGI:1196250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; natural killer cell group 2D product : NKG2-D isoform b protein_id : NP_001076791.1

name	Klrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946714 CCDS:CCDS20591.1 GeneID:58179 MGI:1929720
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : natural killer cell group 2E cell receptor product : killer cell lectin-like receptor subfamily C, member 3 protein_id : NP_067353.1

name	Klrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842374 GeneID:16642 MGI:1336162
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily C, member 2 protein_id : NP_034783.2

name	Klrc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754466 GeneID:16641 MGI:1336161
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily C, member 1 protein_id : NP_034782.1

name	Klri1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593097 CCDS:CCDS20593.1 GeneID:503550 MGI:3530275
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family I member 1 protein_id : NP_001012538.1

name	Klri2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893135 CCDS:CCDS20594.1 GeneID:320407 MGI:2443965
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family I member 2 protein_id : NP_796129.1

name	Gm156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701512 CCDS:CCDS20595.1 GeneID:232415 MGI:2685002
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily H, member 1 protein_id : NP_001014997.1

name	Klra17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559408 GeneID:170733 MGI:2180674
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : NK receptor Ly-49Q product : killer cell lectin-like receptor, subfamily A, member 17 protein_id : NP_573466.1

name	Klra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680590 CCDS:CCDS20596.1 GeneID:16636 MGI:101903
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : Ly49E receptor; class I MHC receptor KLRA5 product : killer cell lectin-like receptor, subfamily A, member 5 protein_id : NP_032489.1

name	LOC100038893 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255108 GeneID:100038893
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471832.1

name	Klra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680592 CCDS:CCDS20597.1 GeneID:16637 MGI:101902
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor, subfamily A, member 6 protein_id : NP_032490.1

name	Klra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754462 GeneID:16635 MGI:101904
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : killer cell lectin-like receptor subfamily A member 32 product : killer cell lectin-like receptor, subfamily A, member 4 protein_id : NP_034779.1

name	LOC100038895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255112 GeneID:100038895
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471830.1

name	LOC100038894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255110 GeneID:100038894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471826.1

name	Klra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426879 GeneID:16639 MGI:102968
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IDA] codon_start : 1 note : cytomegalovirus resistance 1 product : killer cell lectin-like receptor, subfamily A, member 8 protein_id : NP_034780.1

name	LOC100038897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255114 GeneID:100038897
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471827.1

name	Klra9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922571 GeneID:16640 MGI:1321153
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : Ly49I receptor product : killer cell lectin-like receptor subfamily A, member 9 protein_id : NP_034781.2

name	Klra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355995 GeneID:16638 MGI:101901
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : killer cell lectin-like receptor 7 product : killer cell lectin-like receptor, subfamily A, member 7 protein_id : NP_055009.2

name	Klra12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327665 GeneID:16630 MGI:1321091
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : killer cell lectin-like receptor subfamily A, member 12 protein_id : NP_034776.1

name	Klra10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506839 CCDS:CCDS20600.1 GeneID:16628 MGI:1321093
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily A, member 10 protein_id : NP_032485.2

name	Klra13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31581538 GeneID:16631 MGI:1321090
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : killer cell lectin-like receptor subfamily A, member 13 protein_id : NP_034777.2

name	LOC100038898 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255116 GeneID:100038898
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471732.1

name	Klra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922593 CCDS:CCDS20601.1 GeneID:16634 MGI:101905
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : natural killer cell-associated antigen 2 product : killer cell lectin-like receptor, subfamily A, member 3 protein_id : NP_034778.2

name	LOC100038902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255118 GeneID:100038902
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471829.1

name	LOC100038903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255120 GeneID:100038903
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471730.1

name	Klra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607449 CCDS:CCDS20602.1 GeneID:16627 MGI:101907
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : natural killer cell receptor Ly49A; class I MHC receptor KLRA22 product : killer cell lectin-like receptor, subfamily A, member 1 protein_id : NP_057868.2

name	LOC384494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384494
definition	number : 2 pseudo : _no_value

name	LOC384494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384494
definition	number : 1 pseudo : _no_value

name	LOC640755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640755
definition	number : 1 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 7 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 6 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 5 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 4 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 3 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 2 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 1 pseudo : _no_value

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 8

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 7

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 6

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 5

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 4

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 3

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 2

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 1

name	(CDS detail)
type	STS
link
xref	UniSTS:124241
definition	standard_name : 37.MMHAP65FLE4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:257787
definition	standard_name : px-42h6

name	(CDS detail)
type	STS
link
xref	UniSTS:209708
definition	standard_name : RH126589

name	(CDS detail)
type	STS
link
xref	UniSTS:162960
definition	standard_name : RH126252

name	(CDS detail)
type	STS
link
xref	UniSTS:270887
definition	standard_name : PMC139238P1

name	(CDS detail)
type	STS
link
xref	UniSTS:185685
definition	standard_name : BB238854

name	(CDS detail)
type	STS
link
xref	UniSTS:159577
definition	standard_name : Y11245

name	(CDS detail)
type	STS
link
xref	UniSTS:179479
definition	standard_name : AW554517

name	(CDS detail)
type	STS
link
xref	UniSTS:161520
definition	standard_name : RH124698

name	(CDS detail)
type	STS
link
xref	UniSTS:162540
definition	standard_name : RH125794

name	(CDS detail)
type	STS
link
xref	UniSTS:179471
definition	standard_name : AW491344

name	(CDS detail)
type	STS
link
xref	UniSTS:179472
definition	standard_name : AI646725

name	(CDS detail)
type	STS
link
xref	UniSTS:224369
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179470
definition	standard_name : AW208983

name	(CDS detail)
type	STS
link
xref	UniSTS:235561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162174
definition	standard_name : RH125352

name	(CDS detail)
type	STS
link
xref	UniSTS:179477
definition	standard_name : AI893533

name	(CDS detail)
type	STS
link
xref	UniSTS:130963
definition	standard_name : D6Mit61

name	(CDS detail)
type	STS
link
xref	UniSTS:143803
definition	standard_name : Ly55a

name	(CDS detail)
type	STS
link
xref	UniSTS:235931
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210474
definition	standard_name : RH136490

name	(CDS detail)
type	STS
link
xref	UniSTS:130806
definition	standard_name : D6Mit257

name	(CDS detail)
type	STS
link
xref	UniSTS:179475
definition	standard_name : AI462337

name	(CDS detail)
type	STS
link
xref	UniSTS:130893
definition	standard_name : D6Mit338.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130679
definition	standard_name : D6Mit135

name	(CDS detail)
type	STS
link
xref	UniSTS:130892
definition	standard_name : D6Mit338

name	(CDS detail)
type	STS
link
xref	UniSTS:130836
definition	standard_name : D6Mit289

name	(CDS detail)
type	STS
link
xref	UniSTS:208037
definition	standard_name : BE692208

name	(CDS detail)
type	STS
link
xref	UniSTS:91341
definition	standard_name : RH93287

name	(CDS detail)
type	STS
link
xref	UniSTS:161003
definition	standard_name : RH124109

name	(CDS detail)
type	STS
link
xref	UniSTS:185686
definition	standard_name : BB178967

name	(CDS detail)
type	STS
link
xref	UniSTS:125410
definition	standard_name : MHAa87a3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179473
definition	standard_name : AI646108

name	(CDS detail)
type	STS
link
xref	UniSTS:141293
definition	standard_name : Cd69

name	(CDS detail)
type	STS
link
xref	UniSTS:208039
definition	standard_name : BE691651

name	(CDS detail)
type	STS
link
xref	UniSTS:208038
definition	standard_name : BE447139

name	(CDS detail)
type	STS
link
xref	UniSTS:159576
definition	standard_name : AI196471

name	(CDS detail)
type	STS
link
xref	UniSTS:39952
definition	standard_name : U70176

name	(CDS detail)
type	STS
link
xref	UniSTS:143719
definition	standard_name : Klrd1

name	(CDS detail)
type	STS
link
xref	UniSTS:142578
definition	standard_name : D6H12S2489E

name	(CDS detail)
type	STS
link
xref	UniSTS:125146
definition	standard_name : MHAa34f7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179474
definition	standard_name : AI451035

name	(CDS detail)
type	STS
link
xref	UniSTS:179474
definition	standard_name : AI451035

name	(CDS detail)
type	STS
link
xref	UniSTS:166302
definition	standard_name : G54770

name	(CDS detail)
type	STS
link
xref	UniSTS:166316
definition	standard_name : G54759

name	(CDS detail)
type	STS
link
xref	UniSTS:143713
definition	standard_name : Klra5

name	(CDS detail)
type	STS
link
xref	UniSTS:62323
definition	standard_name : U70177

name	(CDS detail)
type	STS
link
xref	UniSTS:143714
definition	standard_name : Klra6

name	(CDS detail)
type	STS
link
xref	UniSTS:142643
definition	standard_name : D6Uwa4

name	(CDS detail)
type	STS
link
xref	UniSTS:28477
definition	standard_name : U89890

name	(CDS detail)
type	STS
link
xref	UniSTS:143712
definition	standard_name : Klra4

name	(CDS detail)
type	STS
link
xref	UniSTS:166300
definition	standard_name : G54772

name	(CDS detail)
type	STS
link
xref	UniSTS:143711
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143717
definition	standard_name : Klra7

name	(CDS detail)
type	STS
link
xref	UniSTS:143715
definition	standard_name : Klra7

name	(CDS detail)
type	STS
link
xref	UniSTS:166301
definition	standard_name : G54756

name	(CDS detail)
type	STS
link
xref	UniSTS:143711
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143709
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143706
definition	standard_name : Klra1

name	EG667610 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255432 GeneID:667610 MGI:3644570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 239 ESTs, 10 Proteins product : predicted gene, EG667610 pseudo : _no_value transcript_id : XR_035003.1

name	LOC667706 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255435 GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ATP binding protein associated with cell differentiation pseudo : _no_value transcript_id : XR_035006.1

name	LOC667715 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255440 GeneID:667715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to interferon stimulated exonuclease gene 20-like 2 pseudo : _no_value transcript_id : XR_035010.1

name	BC064078 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255441 GeneID:408064 MGI:3040692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 39 ESTs product : cDNA sequence BC064078 transcript_id : XR_035011.1

name	LOC667769 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255344 GeneID:667769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins product : similar to killer cell lectin-like receptor subfamily A member 29 pseudo : _no_value transcript_id : XR_002073.2

clone name	MSMg01-328C16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505C11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-348H15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080J06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082N24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-289B18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-523G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-090N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-148H08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-344K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-199I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232K15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-313G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-172A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-045J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-323O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-507K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-209J23
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-234C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247O11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-237P07.b	B6Ng01-237P07.g
ACC	GA048779	GA048780
length	1,147	281
definition	B6Ng01-237P07.b	B6Ng01-237P07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(129,314,602 - 129,315,755)	(129,221,505 - 129,221,785)
sequence	gaattctttggaaactcagaacattctgcggatcatgatgttgaaggtca ttaagaaaagatgaaagattgagggagcctgtggaagaaagctatgaact taccatgacctgtggatggtacagagtacacaatgttttttccatatgtt tgcggtctggaccaaattgcaggaactggtaagtggatgcacttggaagg aaggacatgaaggcaacaccatggatggtgtgtccaaatcatttctgtgg gaaaggcaaaggcctaggaagaatattcttgtctcttttcacatgaccaa agatgataagacataacaccaagtatattcttttgctgtgattgtaaaac ctactcaacaccaggtacttccaagaagactgacctctaaccttcaggtc cccctcacaaattggagacgaaaagccaccttgtgtcttgattgctttaa taatacaaatgagaagtgctttgatcgctctactcctgaacccaaatgtg tggcatcccctggtgtccccacatggatctctggtattttcttcagtcca cttggcctcactaaccagggtgggttagcaatagatactcccatctattg tcctcccagctttggtctaattctgatctttgcccagcttcattttttaa catccattggtgttctgctcttcgtattaataatgacgaatgaagtgatt taataacgttcattcttatcttattctaaaactaggaatatgttttctct tgctagaactatgatgttaattcaaacttcagagttttgttcatttgctt gctgtttatttcatgtcaaagcttgattgtatttgggaaatctactccta gtttattaagctttattacgacagggtataaagtactcatcaaatgcttc gctatgtcaattgcaaagtttattttccctcacatctttttaagtattta tacatctttaatacaaattgttcttatcgtactatgctttctatattttc cagactttattttctttgagttgaatttgcctggttttatctttgggaaa aaaaaaagagagattagctgcattgtcttgtgttcagcgcattgtatgcc tgaaatacatgtgaaagctatgaacttagtatcctggcagttcagca	aggctgtaagatggagcagttgatattccctgaggaatataaaattaagc atagtaatgtgttgttccactaataaaaaatattaatggtcaattttacc aaattctgagtgcatttggaaaacgtcttgttggctagagataaggcaaa gcaaataaaatgctgacttaataggtatcttcactatgtatgtatgtatg tatgtatgtatgtatgtatgtatgtatatatgcataaatatataatttat atatgtatttaagagggaggatgggtatatt
quality values	Open. Hide. 58 33 22 24 58 54 54 58 58 58 44 38 58 50 47 58 41 30 62 62 62 51 46 49 62 62 54 54 62 62 62 41 39 47 33 43 46 35 44 43 62 62 62 62 62 62 49 56 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 46 49 62 62 49 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 59 59 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 50 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 46 58 58 58 58 58 42 54 58 58 58 58 58 49 52 47 41 58 58 51 58 58 58 58 49 53 54 58 51 52 54 58 54 58 58 58 58 58 58 51 58 53 49 49 51 46 41 58 58 58 54 58 58 49 51 49 58 51 51 51 50 58 58 53 47 53 50 58 58 58 58 51 50 58 58 53 51 54 44 58 52 58 58 53 54 58 54 46 53 51 58 58 52 54 58 50 58 49 42 52 47 51 54 58 51 44 40 54 51 58 49 51 49 58 52 39 42 58 58 51 53 39 52 58 58 58 58 40 40 43 51 34 53 58 49 42 54 52 54 46 42 54 50 40 54 53 53 37 53 54 53 52 53 42 52 47 40 50 39 53 52 52 40 49 54 41 47 42 49 42 39 53 32 29 37 49 52 28 29 54 53 33 41 41 51 42 52 45 53 46 39 33 46 39 53 31 42 52 45 52 43 40 40 37 51 53 40 49 54 54 44 47 40 42 24 47 53 37 29 31 34 40 33 53 49 52 53 34 53 31 32 52 32 32 32 31 49 13 30 32 37 45 40 41 32 53 28 47 33 32 40 53 52 37 51 38 47 33 42 42 32 24 38 24 51 51 51 32 37 25 31 31 32 37 51 45 31 32 28 33 42 31 43 42 29 51 43 32 31 51 39 31 29 37 51 31 32 24 46 31 22 30 22 27 43 31 38 32 42 26 38 43 48 46 42 46 32 32 47 32 24 42 35 32 36 43 42 31 32 34 21 37 48 28 28 31 43 38 31 27 31 41 48 41 28 27 33 30 37 21 35 30 19 26 48 31 14 21 26 27 46 28 26 26 29 31 31 31 27 38 36 30 39 31 27 34 28 17 31 37 31 37 20 23 32 37 33 34 19 17 18 15 29 31 30 48 22 25 34 44 32 24 23 44 44 36 30 47 25 15 31 22 15 21 33 34 29 47 48 48 16 29 28 7 5 13 14 39 29 23 20 17 32 19 33 30 25 43 21 19 10 19 21 32 11 39 30 17 16 32 12 14 33 22 18 28 25 32 27 19 31 31 32 31 17 22 17 24 28 10 21 9 28 18 19 24 34 34 26 9 14 15 17 28 18 24 40 15 23 26 34 34 10 26 11 34 15 7 7 5 3 11 24 23 25 18 40 15 16 14 14 18 11 17 6 34 34 14 26 13 14 9 47 11 13 47 21 15 22 12 30 32 29 26 17 12 17 5 4 4 9 5 5 2 5 5 3 5 18 18 10 8 13 5 24 14 22 10 21 13 5 7 5 15 19 9 7 7 4 16 6 15 5 8 9 9 19 20 5 11 7 7 13 14 6 13 13 15 8 8 9 3 2 9 29 17 3 8 12 17 21 16 13 5 6 16 7 16 10 8 7 21 5 3 1 4 15 3 8 13 5 5 22 10 10 11 10	Open. Hide. 37 62 62 62 56 56 51 50 32 27 25 28 49 49 62 59 62 62 62 62 62 62 59 46 59 59 62 62 62 54 62 62 59 54 54 54 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 51 51 50 46 50 54 48 56 35 32 48 50 45 32 32 50 34 46 27 34 30 18 18 18 18 34 18 18 23 34 10 11 13 12 24 30 30 21 13 13 23 14 11 23 18 12 5 18 13 14 13 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_129314602_129315755
seq2: B6Ng01-237P07.b_52_1198 (reverse)

seq1  TGCTG-ACTGCCACGATACTAAG-TCATAGCTTTTCACCATGTATTTTCA  48
      ||||| ||||||| ||||||||| ||||||| ||||| |||||||||   
seq2  TGCTGAACTGCCAGGATACTAAGTTCATAGC-TTTCA-CATGTATTTCAG  48

seq1  GCATACAATGCGCTGAACACAAGACCATGCAGCCTATTTCTTCTCTTTTT  98
      ||||||||||||||||||||||||| |||||||  ||    |||||||||
seq2  GCATACAATGCGCTGAACACAAGACAATGCAGCTAAT---CTCTCTTTTT  95

seq1  TTTTTCCCCAAAGAT-AAACCAGGCAAATTTCAACCTCAAAGAAAATAAA  147
      ||||| ||||||||| |||||||||||| ||||| |||||||||||||||
seq2  TTTTT-CCCAAAGATAAAACCAGGCAAA-TTCAA-CTCAAAGAAAATAAA  142

seq1  GTCTGGAAAAATATAGAAAGCATAGTACGATAAGAACAATTTGTATTAAA  197
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGG-AAAATATAGAAAGCATAGTACGATAAGAACAATTTGTATTAAA  191

seq1  GATGTATAAATACTTTAAAAAGATGTGAGGGAAAATAAACTTTGCAATTG  247
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  GATGTATAAATAC-TTAAAAAGATGTGAGGGAAAATAAACTTTGCAATTG  240

seq1  ACATAGCGAAGCATTTGATGAGTACTTTATACCCTGTCGTAATAAAGCTT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAGCGAAGCATTTGATGAGTACTTTATACCCTGTCGTAATAAAGCTT  290

seq1  AATAAACTAGGAGTAGATTTCCCAAATACAATCAAGCTTTGACATGAAAT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAACTAGGAGTAGATTTCCCAAATACAATCAAGCTTTGACATGAAAT  340

seq1  AAACAGCAAGCAAATGAACAAAACTCTGAAGTTTGAATTAACATCATAGT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAGCAAGCAAATGAACAAAACTCTGAAGTTTGAATTAACATCATAGT  390

seq1  TCTAGCAAGAGAAAACATATTCCTAGTTTTAGAATAAGATAAGAATGAAC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGCAAGAGAAAACATATTCCTAGTTTTAGAATAAGATAAGAATGAAC  440

seq1  GTTATTAAATCACTTCATTCGTCATTATTAATACGAAGAGCAGAACACCA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATTAAATCACTTCATTCGTCATTATTAATACGAAGAGCAGAACACCA  490

seq1  ATGGATGTTAAAAAATGAAGCTGGGCAAAGATCAGAATTAGACCAAAGCT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGATGTTAAAAAATGAAGCTGGGCAAAGATCAGAATTAGACCAAAGCT  540

seq1  GGGAGGACAATAGATGGGAGTATCTATTGCTAACCCACCCTGGTTAGTGA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGACAATAGATGGGAGTATCTATTGCTAACCCACCCTGGTTAGTGA  590

seq1  GGCCAAGTGGACTGAAGAAAATACCAGAGATCCATGTGGGGACACCAGGG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAAGTGGACTGAAGAAAATACCAGAGATCCATGTGGGGACACCAGGG  640

seq1  GATGCCACACATTTGGGTTCAGGAGTAGAGCGATCAAAGCACTTCTCATT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCCACACATTTGGGTTCAGGAGTAGAGCGATCAAAGCACTTCTCATT  690

seq1  TGTATTATTAAAGCAATCAAGACACAAGGTGGCTTTTCGTCTCCAATTTG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTATTAAAGCAATCAAGACACAAGGTGGCTTTTCGTCTCCAATTTG  740

seq1  TGAGGGGGACCTGAAGGTTAGAGGTCAGTCTTCTTGGAAGTACCTGGTGT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGGGACCTGAAGGTTAGAGGTCAGTCTTCTTGGAAGTACCTGGTGT  790

seq1  TGAGTAGGTTTTACAATCACAGCAAAAGAATATACTTGGTGTTATGTCTT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTAGGTTTTACAATCACAGCAAAAGAATATACTTGGTGTTATGTCTT  840

seq1  ATCATCTTTGGTCATGTGAAAAGAGACAAGAATATTCTTCCTAGGCCTTT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTTTGGTCATGTGAAAAGAGACAAGAATATTCTTCCTAGGCCTTT  890

seq1  GCCTTTCCCACAGAAATGATTTGGACACACCATCCATGGTGTTGCCTTCA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTTCCCACAGAAATGATTTGGACACACCATCCATGGTGTTGCCTTCA  940

seq1  TGTCCTTCCTTCCAAGTGCATCCACTTACCAGTTCCTGCAATTTGGTCCA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTTCCTTCCAAGTGCATCCACTTACCAGTTCCTGCAATTTGGTCCA  990

seq1  GACCGCAAACATATGGAAAAAACATTGTGTACTCTGTACCATCCACAGGT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCGCAAACATATGGAAAAAACATTGTGTACTCTGTACCATCCACAGGT  1040

seq1  CATGGTAAGTTCATAGCTTTCTTCCACAGGCTCCCTCAATCTTTCATCTT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTAAGTTCATAGCTTTCTTCCACAGGCTCCCTCAATCTTTCATCTT  1090

seq1  TTCTTAATGACCTTCAACATCATGATCCGCAGAATGTTCTGAGTTTCCAA  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTAATGACCTTCAACATCATGATCCGCAGAATGTTCTGAGTTTCCAA  1140

seq1  AGAATTC  1154
      |||||||
seq2  AGAATTC  1147

seq1: chr6_129221505_129221785
seq2: B6Ng01-237P07.g_68_348

seq1  AGGCTGTAAGATGGAGCAGTTGATATTCCCTGAGGAATATAAAATTAAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGTAAGATGGAGCAGTTGATATTCCCTGAGGAATATAAAATTAAGC  50

seq1  ATAGTAATGTGTTGTTCCACTAATAAAAAATATTAATGGTCAATTTTACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTAATGTGTTGTTCCACTAATAAAAAATATTAATGGTCAATTTTACC  100

seq1  AAATTCTGAGTGCATTTGGAAAACGTCTTGTTGGCTAGAGATAAGGCAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCTGAGTGCATTTGGAAAACGTCTTGTTGGCTAGAGATAAGGCAAA  150

seq1  GCAAATAAAATGCTGACTTAATAGGTATCTTCACTATGTATGTATGTATG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAATAAAATGCTGACTTAATAGGTATCTTCACTATGTATGTATGTATG  200

seq1  TATGTATGTATGTATGTATGTATGTATATATGCATAAATATATAATTTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTATGTATGTATGTATGTATGTATATATGCATAAATATATAATTTAT  250

seq1  ATATGTATTTAGTAGGCATAATGGGTATATT  281
      |||||||||||  ||| |  |||||||||||
seq2  ATATGTATTTAAGAGGGAGGATGGGTATATT  281

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information