MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-239A12
Chromosome	6 (Build37)
Map Location	66,934,457 - 67,086,319
singlet/doublet	doublet
Overlap gene	Gng12, LOC100042837, Gadd45a, E230016M11Rik
Upstream gene	Ppia-ps6_651.1, LOC100041916, Tpm3-rs3, LOC627751, Mad2l1, V1rc15, LOC100041941, Aurkb-ps, V1rc14, LOC546901, V1rc12, LOC627833, V1rc11, V1rc10, LOC100042816, LOC546902, V1rc13, EG546903, LOC100042008, 4930597O21Rik
Downstream gene	EG667310, LOC667318, Serbp1, Il12rb2, LOC667324, EG667326, LOC672137, EG209589, LOC100042890, Il23r, Tacstd2, Igk, Igkv2-137, 4930515G16Rik, Igkv1-136, Igkv1-135, LOC723992, EG628006, Igkv14-134-1, Igkv17-134, EG628027, LOC384401, EG628042, EG243423, EG628056, EG628072, Igkv9-129, Igkv9-128, EG243433, Igkv14-126-1, LOC723993, EG628127, ENSMUSG00000050218, EG243431, EG628144, Igkv1-122, EG667435, EG434025, Igkv9-119, Igkv14-118-2, Igkv14-118-1, EG384405, Igkv11-118, Igkv1-117
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ppia-ps6_651.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545843
definition	note : peptidyl-prolyl cis-trans isomerase A pseudogene 6_651.1 pseudo : _no_value

name	LOC100041916 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tpm3-rs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110376 MGI:99709
definition	note : tropomyosin 3, related sequence 3 pseudo : _no_value

name	LOC627751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Mad2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56150 MGI:1860374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171188 MGI:2159451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Aurkb-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384398
definition	note : aurora kinase B pseudogene pseudo : _no_value

name	V1rc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171187 MGI:2159450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	V1rc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171185 MGI:2159444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627833 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627833
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins pseudo : _no_value

name	V1rc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171184 MGI:2159443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171183 MGI:2159442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042816 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 6 Proteins pseudo : _no_value

name	LOC546902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins pseudo : _no_value

name	V1rc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171186 MGI:2159445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546903 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546903 MGI:3644802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 Proteins

name	LOC100042008 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 854 ESTs, 1 Protein

name	4930597O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75373 MGI:1922623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	Gng12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14701 MGI:1336171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 3 Proteins pseudo : _no_value

name	Gadd45a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13197 MGI:107799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E230016M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320172 MGI:2443524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	EG667310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667310 MGI:3647296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 14 Proteins

name	LOC667318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66870 MGI:1914120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il12rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16162 MGI:1270861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG667326 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667326 MGI:3643886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC672137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG209589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209589 MGI:3648855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100042890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	Il23r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209590 MGI:2181693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tacstd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56753 MGI:1861606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243469 MGI:96494
definition	gene_synonym : kappa note : immunoglobulin kappa chain complex

name	Igkv2-137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692187 IMGT/GENE-DB:IGKV2-137
definition	note : immunoglobulin kappa chain variable 2-137

name	4930515G16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75070 MGI:1922320
definition	note : RIKEN cDNA 4930515G16 gene; myc induced nuclear antigen pseudogene pseudo : _no_value

name	Igkv1-136 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692186 IMGT/GENE-DB:IGKV1-136
definition	gene_synonym : bc1 note : immunoglobulin kappa chain variable 1-136 pseudo : _no_value

name	Igkv1-135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:243420 IMGT/GENE-DB:IGKV1-135
definition	gene_synonym : bd2 note : immunoglobulin kappa chain variable 1-135

name	LOC723992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:723992
definition	note : tubulin, alpha 1 pseudogene pseudo : _no_value

name	EG628006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628006 MGI:3648164
definition	note : predicted gene, EG628006; ribosomal protein L18a pseudogene pseudo : _no_value

name	Igkv14-134-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692185
definition	gene_synonym : cx9 note : immunoglobulin kappa chain variable 14-134-1 pseudo : _no_value

name	Igkv17-134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692184 IMGT/GENE-DB:IGKV17-134
definition	gene_synonym : Igk-Vk20(294A9) note : immunoglobulin kappa chain variable 17-134 pseudo : _no_value

name	EG628027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628027 IMGT/GENE-DB:IGKV1-133 MGI:3648380
definition	gene_synonym : Igk-Vk2(70/1); Igkv1-133 note : predicted gene, EG628027

name	LOC384401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384401
definition	note : tubulin, alpha 1 pseudogene pseudo : _no_value

name	EG628042 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628042 MGI:3648591
definition	note : predicted gene, EG628042; ribosomal protein L18a pseudogene pseudo : _no_value

name	EG243423 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243423 IMGT/GENE-DB:IGKV1-132 MGI:3648800
definition	gene_synonym : bi2; Igkv1-132 note : predicted gene, EG243423

name	EG628056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628056 IMGT/GENE-DB:IGKV1-131 MGI:3645551
definition	gene_synonym : bh2; Igkv1-131 note : predicted gene, EG628056

name	EG628072 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628072 IMGT/GENE-DB:IGKV14-130 MGI:3645770
definition	gene_synonym : cb9; Igkv14-130 note : predicted gene, EG628072

name	Igkv9-129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692182 IMGT/GENE-DB:IGKV9-129
definition	note : immunoglobulin kappa chain variable 9-129

name	Igkv9-128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692181 IMGT/GENE-DB:IGKV9-128
definition	note : immunoglobulin kappa chain variable 9-128 pseudo : _no_value

name	EG243433 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243433 IMGT/GENE-DB:IGKV17-127 MGI:3646891
definition	gene_synonym : bw20; Igkv17-127 note : predicted gene, EG243433

name	Igkv14-126-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692180 IMGT/GENE-DB:IGKV14-126-1
definition	gene_synonym : co9 note : immunoglobulin kappa chain variable 14-126-1 pseudo : _no_value

name	LOC723993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:723993
definition	note : ARP2 actin-related protein 2 homolog (yeast) pseudogene pseudo : _no_value

name	EG628127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628127 IMGT/GENE-DB:IGKV14-126 MGI:3643131
definition	gene_synonym : br9; Igkv14-126 note : predicted gene, EG628127 pseudo : _no_value

name	ENSMUSG00000050218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243428 IMGT/GENE-DB:IGKV11-125 MGI:3642338
definition	gene_synonym : if11; Igkv11-125 note : predicted gene, ENSMUSG00000050218

name	EG243431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243431 IMGT/GENE-DB:IGKV9-124 MGI:3646892
definition	gene_synonym : Igkv9-124 note : predicted gene, EG243431

name	EG628144 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628144 IMGT/GENE-DB:IGKV9-123 MGI:3643848
definition	gene_synonym : Igkv9-123 note : predicted gene, EG628144

name	Igkv1-122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434024 IMGT/GENE-DB:IGKV1-122
definition	gene_synonym : bl1 note : immunoglobulin kappa chain variable 1-122

name	EG667435 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667435 IMGT/GENE-DB:IGKV17-121 MGI:3647671
definition	gene_synonym : bt20; Igkv17-121 note : predicted gene, EG667435

name	EG434025 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434025 IMGT/GENE-DB:IGKV9-120 MGI:3647784
definition	gene_synonym : Igkv9-120 note : predicted gene, EG434025

name	Igkv9-119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692177 IMGT/GENE-DB:IGKV9-119
definition	gene_synonym : bp9 note : immunoglobulin kappa chain variable 9-119 pseudo : _no_value

name	Igkv14-118-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692176 IMGT/GENE-DB:IGKV14-118-2
definition	gene_synonym : bq9 note : immunoglobulin kappa chain variable 14-118-2 pseudo : _no_value

name	Igkv14-118-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692175 IMGT/GENE-DB:IGKV14-118-1
definition	note : immunoglobulin kappa chain variable 14-118-1 pseudo : _no_value

name	EG384405 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384405 MGI:3646419
definition	note : predicted gene, EG384405; nucleosome assembly protein 1-like 1 pseudogene pseudo : _no_value

name	Igkv11-118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:692174 IMGT/GENE-DB:IGKV11-118
definition	gene_synonym : ie11 note : immunoglobulin kappa chain variable 11-118 pseudo : _no_value

name	Igkv1-117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:16098 IMGT/GENE-DB:IGKV1-117
definition	gene_synonym : Igk-V21; V(k)45.1 note : immunoglobulin kappa chain variable 1-117

name	LOC100041916 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255172 GeneID:100041916
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041916 transcript_id : XM_001477206.1

name	Mad2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369937 GeneID:56150 MGI:1860374
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAD2 (mitotic arrest deficient, homolog)-like 1 (yeast) transcript_id : NM_019499.3

name	V1rc15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381477 GeneID:171188 MGI:2159451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C15 transcript_id : NM_134170.3

name	LOC100041941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255174 GeneID:100041941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041941 transcript_id : XM_001477238.1

name	V1rc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717666 GeneID:171187 MGI:2159450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C14 transcript_id : NM_134169.1

name	LOC546901 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255177 GeneID:546901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to vomeronasal receptor V1RC10 transcript_id : XM_001477290.1

name	V1rc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21699047 GeneID:171185 MGI:2159444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C12 transcript_id : NM_134167.1

name	V1rc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21699039 GeneID:171184 MGI:2159443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C11 transcript_id : NM_134166.1

name	V1rc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21699043 GeneID:171183 MGI:2159442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C10 transcript_id : NM_134165.1

name	V1rc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717656 GeneID:171186 MGI:2159445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C13 transcript_id : NM_134168.1

name	EG546903 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82901211 GeneID:546903 MGI:3644802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 Proteins product : predicted gene, EG546903 transcript_id : XM_621716.2

name	LOC100042008 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255180 GeneID:100042008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 854 ESTs, 1 Protein product : similar to ribosomal protein L23 transcript_id : XM_001477371.1

name	4930597O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255182 GeneID:75373 MGI:1922623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 4930597O21 gene transcript_id : XM_989547.2

name	Gng12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363813 GeneID:14701 MGI:1336171
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 12 transcript_id : NM_025278.4

name	Gadd45a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681148 GeneID:13197 MGI:107799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible 45 alpha transcript_id : NM_007836.1

name	E230016M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255184 GeneID:320172 MGI:2443524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : RIKEN cDNA E230016M11 gene transcript_id : XM_989634.2

name	EG667310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255211 GeneID:667310 MGI:3647296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 177 ESTs, 14 Proteins product : predicted gene, EG667310 transcript_id : XM_989693.2

name	Serbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385279 GeneID:66870 MGI:1914120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Serpine1 mRNA binding protein 1 transcript_id : NM_025814.1

name	Il12rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803153 GeneID:16162 MGI:1270861
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 12 receptor, beta 2 transcript_id : NM_008354.2

name	EG209589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255190 GeneID:209589 MGI:3648855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG209589 transcript_id : XM_144761.6

name	Il23r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362352 GeneID:209590 MGI:2181693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 23 receptor transcript_id : NM_144548.1

name	Tacstd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866004 GeneID:56753 MGI:1861606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor-associated calcium signal transducer 2 transcript_id : NM_020047.3

name	4930515G16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347557 GeneID:75070 MGI:1922320
definition	product : RIKEN cDNA 4930515G16 gene pseudo : _no_value transcript_id : NR_003100.1

name	LOC100041916 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255173 GeneID:100041916
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477256.1

name	Mad2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543218 CCDS:CCDS20210.1 GeneID:56150 MGI:1860374
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005816 - spindle pole body [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0000070 - mitotic sister chromatid segregation [Evidence IMP]; GO:0007094 - mitotic spindle checkpoint [Evidence ISS] [Evidence IMP]; GO:0045841 - negative regulation of mitotic metaphase/anaphase transition [Evidence TAS] codon_start : 1 product : MAD2 (mitotic arrest deficient, homolog)-like 1 protein_id : NP_062372.2

name	V1rc15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717661 CCDS:CCDS20211.1 GeneID:171188 MGI:2159451
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C15 protein_id : NP_598931.1

name	LOC100041941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255175 GeneID:100041941
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477288.1

name	V1rc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717667 CCDS:CCDS20212.1 GeneID:171187 MGI:2159450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C14 protein_id : NP_598930.1

name	LOC546901 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255178 GeneID:546901
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC10 protein_id : XP_001477340.1

name	V1rc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699048 CCDS:CCDS20213.1 GeneID:171185 MGI:2159444
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C12 protein_id : NP_598928.1

name	V1rc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699040 CCDS:CCDS20214.1 GeneID:171184 MGI:2159443
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C11 protein_id : NP_598927.1

name	V1rc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699044 CCDS:CCDS20215.1 GeneID:171183 MGI:2159442
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C10 protein_id : NP_598926.1

name	V1rc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717657 CCDS:CCDS20216.1 GeneID:171186 MGI:2159445
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C13 protein_id : NP_598929.1

name	EG546903 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901212 GeneID:546903 MGI:3644802
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC13 protein_id : XP_621716.2

name	LOC100042008 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255181 GeneID:100042008
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477421.1

name	4930597O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255183 GeneID:75373 MGI:1922623
definition	codon_start : 1 product : hypothetical protein LOC75373 protein_id : XP_994641.2

name	Gng12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384618 GeneID:14701 MGI:1336171
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 12 protein_id : NP_079554.1

name	Gadd45a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681149 CCDS:CCDS20217.1 GeneID:13197 MGI:107799
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0007098 - centrosome cycle [Evidence IGI]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNA-damage inducible transcript 1; Gadd45alpha; growth arrest and DNA-damage-inducible, alpha product : growth arrest and DNA-damage-inducible 45 alpha protein_id : NP_031862.1

name	E230016M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377407 GeneID:320172 MGI:2443524
definition	codon_start : 1 product : hypothetical protein LOC320172 protein_id : XP_994728.1

name	EG667310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377409 GeneID:667310 MGI:3647296
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994787.1

name	Serbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385280 CCDS:CCDS20219.1 GeneID:66870 MGI:1914120
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003730 - mRNA 3'-UTR binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PAI-1 mRNA-binding protein product : SERPINE1 mRNA binding protein 1 protein_id : NP_080090.1

name	Il12rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680401 CCDS:CCDS20220.1 GeneID:16162 MGI:1270861
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : interferon response to microorganisms product : interleukin 12 receptor, beta 2 protein_id : NP_032380.1

name	EG209589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255191 GeneID:209589 MGI:3648855
definition	codon_start : 1 product : similar to ribosomal protein S7 protein_id : XP_144761.6

name	Il23r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362353 GeneID:209590 MGI:2181693
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0042019 - interleukin-23 binding [Evidence ISS]; GO:0042020 - interleukin-23 receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0007259 - JAK-STAT cascade [Evidence ISS]; GO:0002443 - leukocyte mediated immunity [Evidence ISS] codon_start : 1 product : interleukin 23 receptor protein_id : NP_653131.1

name	Tacstd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560359 CCDS:CCDS20221.1 GeneID:56753 MGI:1861606
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 97; tunor-associated calcium signal transducer 2 product : tumor-associated calcium signal transducer 2 protein_id : NP_064431.2

name	Igkv2-137 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692187 IMGT/GENE-DB:IGKV2-137
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv1-136 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692186 IMGT/GENE-DB:IGKV1-136
definition	codon_start : 1 gene_synonym : bc1 pseudo : _no_value

name	Igkv1-135 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:243420 IMGT/GENE-DB:IGKV1-135
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bd2

name	Igkv14-134-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692185
definition	codon_start : 1 gene_synonym : cx9 pseudo : _no_value

name	Igkv17-134 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692184 IMGT/GENE-DB:IGKV17-134
definition	codon_start : 1 gene_synonym : Igk-Vk20(294A9) pseudo : _no_value

name	EG628027 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628027 IMGT/GENE-DB:IGKV1-133 MGI:3648380
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk-Vk2(70/1); Igkv1-133

name	EG243423 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243423 IMGT/GENE-DB:IGKV1-132 MGI:3648800
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bi2; Igkv1-132

name	EG628056 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628056 IMGT/GENE-DB:IGKV1-131 MGI:3645551
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bh2; Igkv1-131

name	EG628072 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628072 IMGT/GENE-DB:IGKV14-130 MGI:3645770
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : cb9; Igkv14-130

name	Igkv9-129 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692182 IMGT/GENE-DB:IGKV9-129
definition	codon_start : 1 exception : rearrangement required for product

name	Igkv9-128 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692181 IMGT/GENE-DB:IGKV9-128
definition	codon_start : 1 pseudo : _no_value

name	EG243433 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243433 IMGT/GENE-DB:IGKV17-127 MGI:3646891
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bw20; Igkv17-127

name	Igkv14-126-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692180 IMGT/GENE-DB:IGKV14-126-1
definition	codon_start : 1 gene_synonym : co9 pseudo : _no_value

name	EG628127 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628127 IMGT/GENE-DB:IGKV14-126 MGI:3643131
definition	codon_start : 1 gene_synonym : br9; Igkv14-126 pseudo : _no_value

name	ENSMUSG00000050218 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243428 IMGT/GENE-DB:IGKV11-125 MGI:3642338
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : if11; Igkv11-125

name	EG243431 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:243431 IMGT/GENE-DB:IGKV9-124 MGI:3646892
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-124

name	EG628144 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628144 IMGT/GENE-DB:IGKV9-123 MGI:3643848
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-123

name	Igkv1-122 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:434024 IMGT/GENE-DB:IGKV1-122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bl1

name	EG667435 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667435 IMGT/GENE-DB:IGKV17-121 MGI:3647671
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : bt20; Igkv17-121

name	EG434025 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434025 IMGT/GENE-DB:IGKV9-120 MGI:3647784
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igkv9-120

name	Igkv9-119 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692177 IMGT/GENE-DB:IGKV9-119
definition	codon_start : 1 gene_synonym : bp9 pseudo : _no_value

name	Igkv14-118-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692176 IMGT/GENE-DB:IGKV14-118-2
definition	codon_start : 1 gene_synonym : bq9 pseudo : _no_value

name	Igkv14-118-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692175 IMGT/GENE-DB:IGKV14-118-1
definition	codon_start : 1 pseudo : _no_value

name	Igkv11-118 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:692174 IMGT/GENE-DB:IGKV11-118
definition	codon_start : 1 gene_synonym : ie11 pseudo : _no_value

name	Igkv1-117 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:16098 IMGT/GENE-DB:IGKV1-117
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Igk-V21; V(k)45.1

name	LOC627751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627751
definition	number : 1 pseudo : _no_value

name	LOC546902 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546902
definition	number : 1 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 4 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 3 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 2 pseudo : _no_value

name	LOC667318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667318
definition	number : 1 pseudo : _no_value

name	LOC667324 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667324
definition	number : 1 pseudo : _no_value

name	EG667326 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667326
definition	number : 1 pseudo : _no_value

name	LOC672137 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672137
definition	number : 1 pseudo : _no_value

name	Igkv2-137 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692187
definition	standard_name : IGKV2-137

name	Igkv1-136 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692186
definition	gene_synonym : bc1 pseudo : _no_value standard_name : IGKV1-136

name	Igkv1-135 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243420
definition	gene_synonym : bd2 standard_name : IGKV1-135

name	Igkv14-134-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692185
definition	gene_synonym : cx9 pseudo : _no_value standard_name : IGKV14-134-1

name	Igkv17-134 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692184
definition	gene_synonym : Igk-Vk20(294A9) pseudo : _no_value standard_name : IGKV17-134

name	EG628027 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628027
definition	gene_synonym : Igk-Vk2(70/1); Igkv1-133 standard_name : IGKV1-133

name	EG243423 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243423
definition	gene_synonym : bi2; Igkv1-132 standard_name : IGKV1-132

name	EG628072 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628072
definition	gene_synonym : cb9; Igkv14-130 standard_name : IGKV14-130

name	Igkv9-129 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692182
definition	standard_name : IGKV9-129

name	Igkv9-128 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692181
definition	pseudo : _no_value standard_name : IGKV9-128

name	EG243433 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243433
definition	gene_synonym : bw20; Igkv17-127 standard_name : IGKV17-127

name	Igkv14-126-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692180
definition	gene_synonym : co9 pseudo : _no_value standard_name : IGKV14-126-1

name	EG628127 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628127
definition	gene_synonym : br9; Igkv14-126 pseudo : _no_value standard_name : IGKV14-126

name	ENSMUSG00000050218 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243428
definition	gene_synonym : if11; Igkv11-125 standard_name : IGKV11-125

name	EG243431 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:243431
definition	gene_synonym : Igkv9-124 standard_name : IGKV9-124

name	EG628144 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628144
definition	gene_synonym : Igkv9-123 standard_name : IGKV9-123

name	Igkv1-122 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434024
definition	gene_synonym : bl1 standard_name : IGKV1-122

name	EG667435 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667435
definition	gene_synonym : bt20; Igkv17-121 standard_name : IGKV17-121

name	EG434025 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434025
definition	gene_synonym : Igkv9-120 standard_name : IGKV9-120

name	Igkv9-119 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692177
definition	gene_synonym : bp9 pseudo : _no_value standard_name : IGKV9-119

name	Igkv14-118-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692176
definition	gene_synonym : bq9 pseudo : _no_value standard_name : IGKV14-118-2

name	Igkv14-118-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692175
definition	pseudo : _no_value standard_name : IGKV14-118-1

name	Igkv11-118 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:692174
definition	gene_synonym : ie11 pseudo : _no_value standard_name : IGKV11-118

name	Igkv1-117 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:16098
definition	gene_synonym : Igk-V21; V(k)45.1 standard_name : IGKV1-117

name	(CDS detail)
type	STS
link
xref	UniSTS:123582
definition	standard_name : 22.MMHAP97FRH7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130998
definition	standard_name : D6Mit95

name	(CDS detail)
type	STS
link
xref	UniSTS:123398
definition	standard_name : 18.MMHAP79FRF9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:225980
definition	standard_name : Mad2l1

name	(CDS detail)
type	STS
link
xref	UniSTS:144520
definition	standard_name : Stk5

name	(CDS detail)
type	STS
link
xref	UniSTS:78798
definition	standard_name : Z72355

name	(CDS detail)
type	STS
link
xref	UniSTS:495560
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484924
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:123657
definition	standard_name : 24.MMHAP6FLH3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:491560
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494237
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489275
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491560
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484923
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495559
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484923
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492636
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:51726
definition	standard_name : Z72357

name	(CDS detail)
type	STS
link
xref	UniSTS:12197
definition	standard_name : Z72358

name	(CDS detail)
type	STS
link
xref	UniSTS:164326
definition	standard_name : AI842738

name	(CDS detail)
type	STS
link
xref	UniSTS:209881
definition	standard_name : RH135883

name	(CDS detail)
type	STS
link
xref	UniSTS:161322
definition	standard_name : RH124500

name	(CDS detail)
type	STS
link
xref	UniSTS:179385
definition	standard_name : AI314170

name	(CDS detail)
type	STS
link
xref	UniSTS:142839
definition	standard_name : Gadd45a

name	(CDS detail)
type	STS
link
xref	UniSTS:125638
definition	standard_name : U00937

name	(CDS detail)
type	STS
link
xref	UniSTS:210543
definition	standard_name : RH136562

name	(CDS detail)
type	STS
link
xref	UniSTS:38389
definition	standard_name : Z72359

name	(CDS detail)
type	STS
link
xref	UniSTS:207972
definition	standard_name : BB208751

name	(CDS detail)
type	STS
link
xref	UniSTS:259146
definition	standard_name : Sod1

name	(CDS detail)
type	STS
link
xref	UniSTS:123299
definition	standard_name : 16.MMHAP26FLF1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:94913
definition	standard_name : G43269

name	(CDS detail)
type	STS
link
xref	UniSTS:162252
definition	standard_name : RH125430

name	(CDS detail)
type	STS
link
xref	UniSTS:235462
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:163388
definition	standard_name : U64199

name	(CDS detail)
type	STS
link
xref	UniSTS:64232
definition	standard_name : Z72360

name	(CDS detail)
type	STS
link
xref	UniSTS:179387
definition	standard_name : AW493563

name	(CDS detail)
type	STS
link
xref	UniSTS:77145
definition	standard_name : Z72361

name	(CDS detail)
type	STS
link
xref	UniSTS:235463
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179388
definition	standard_name : C80403

name	(CDS detail)
type	STS
link
xref	UniSTS:487866
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167489
definition	standard_name : D6Ertd456e

name	(CDS detail)
type	STS
link
xref	UniSTS:56967
definition	standard_name : Z72362

name	(CDS detail)
type	STS
link
xref	UniSTS:13646
definition	standard_name : Z72364

name	(CDS detail)
type	STS
link
xref	UniSTS:41798
definition	standard_name : Z72365

name	(CDS detail)
type	STS
link
xref	UniSTS:44132
definition	standard_name : A004F15

name	(CDS detail)
type	STS
link
xref	UniSTS:12690
definition	standard_name : Z72366

name	(CDS detail)
type	STS
link
xref	UniSTS:19220
definition	standard_name : Z72367

name	(CDS detail)
type	STS
link
xref	UniSTS:124602
definition	standard_name : 46.MHAa56h10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:46191
definition	standard_name : Z72368

name	(CDS detail)
type	STS
link
xref	UniSTS:143515
definition	standard_name : Igk-V20

name	(CDS detail)
type	STS
link
xref	UniSTS:143527
definition	standard_name : Igk-V9

name	(CDS detail)
type	STS
link
xref	UniSTS:235464
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489614
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143508
definition	standard_name : Igk-V1

name	LOC627833 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255207 GeneID:627833
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_033943.1

name	LOC100042816 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255208 GeneID:100042816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 6 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G pseudo : _no_value transcript_id : XR_033952.1

name	LOC100042837 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255210 GeneID:100042837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 3 Proteins product : similar to protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) pseudo : _no_value transcript_id : XR_033973.1

name	LOC100042890 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255214 GeneID:100042890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to ribosomal protein L30 pseudo : _no_value transcript_id : XR_033999.1

clone name	MSMg01-370G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-073M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137N15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379M13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-050H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534E24
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-261J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286A04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-239A12.b	B6Ng01-239A12.g
ACC	GA049566	GA049567
length	483	843
definition	B6Ng01-239A12.b	B6Ng01-239A12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(67,085,831 - 67,086,319)	(66,934,457 - 66,935,298)
sequence	ttgcagcagccccaagaggcaactatctttgtgattacattttatagaaa gaaggaaaacaaaacacaaaggttaaaagactttttcagagccacaaagc cagaaagtccccgtgattcaaaacgtagcagcctggttctgaagtccatt ctctaactaatacattgcatgtctgctcttcctctattgccccccccccc cgctccccagttctctctctctgaccgtccctcccttttttcttcttgcc tcctcccacctttatttctacttgcctctccccacctttatttctagata ggctctcactatgtagcactggccagcttagaacttgatatgtagaccag gctgacatctaactcccagaatctacccacatctcctgaatgctgagatt taagacatgtgtcaccacactcaattttgtagatttcttttcttctcctt tccttctttcctttccttccctccctccctccc	gaattcttcaggcatcgcttctggatgctggtctctggttcctggcctgc ctggcccgccagtggaagtcattctccagacagattagcctgtggttggg ttctgctcatcttcccccttgtgttttgtgaaaccggtcctgtgttcctc aggatgagctgagaagaaaaataatcagctacaggaattttctaatttcc aaaatgaccctcagtattttgttgcattgcccgtcccctccccattttcc cctcttcttgtaaagactttaaatatctcaaaattaaaatcaggaaaata ggctagccacctgtgtagcaaggctgattgcacatggtgtgtgtattgct atgtgaaacagcaatttgtagcactgtatacaaatagaccgcatttgttt aaaaactcctatctatgcatatggtatgtttgtaaaaggcagctgagggt gtggtggaggaaagattctagacagtggctgccctttggagtgagcttag aaggaaggaattgtagctttttgtttggttcacatgagtatagtgggggt ttgcagcatatttcttgtttcattttttaaaatgccttcatttttaaaaa cgaagaaaaggcaaatacctgagctggcttcaaacaaccggggctaacta gtgtaatgtctagaagctgggtctagcctggctgctgtaaggttttccct gaaggagctcagacagaacatgaattcattttgggtactttggtcctgcc tagcacacactgctggagccgcagactgcctctggagcattcaagtgggc agtgtgccttgcctgctcctcttccttggtggggggtgggggg
quality values	Open. Hide. 62 62 49 42 33 62 54 62 62 62 62 62 47 44 62 62 59 59 62 59 62 62 62 62 62 43 39 27 28 28 38 28 28 54 49 54 54 54 46 62 62 54 42 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 54 43 42 48 59 59 62 62 62 62 54 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 48 56 46 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 59 62 62 62 62 59 59 51 62 62 62 62 62 62 62 62 62 59 59 51 59 59 59 59 62 62 62 62 62 59 59 51 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 44 32 43 56 56 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 46 62 62 62 62 46 62 47 62 62 62 62 62 62 46 38 52 52 52 62 52 46 33 38 40 41 13	Open. Hide. 62 47 51 44 62 62 62 62 44 42 43 39 20 13 22 22 13 23 25 27 38 34 38 49 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 34 49 50 34 34 40 34 28 23 42 43 42 54 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 25 34 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 47 46 54 62 62 54 62 62 50 62 62 62 52 62 62 62 54 52 58 58 45 58 58 58 43 58 58 54 41 58 58 54 54 44 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 52 54 54 54 58 49 54 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 52 52 58 40 58 54 54 58 58 54 54 58 58 58 58 58 50 40 58 58 58 58 58 48 50 58 58 47 45 58 49 58 58 58 51 40 51 58 58 58 52 51 49 58 58 58 51 52 58 58 32 58 58 54 58 42 58 32 54 58 50 51 50 44 44 51 51 36 27 58 58 58 35 38 58 58 51 26 50 48 48 42 44 43 54 51 54 58 58 49 46 40 58 52 51 58 37 39 58 53 52 58 51 58 49 58 50 58 50 51 54 32 51 49 36 58 58 50 51 51 51 39 51 54 41 54 47 47 51 47 36 38 51 40 38 33 38 26 14 54 51 39 42 49 49 50 46 35 50 27 49 54 35 44 49 37 52 30 34 26 22 35 49 40 25 30 41 33 52 32 44 41 37 37 38 54 54 45 42 54 46 32 37 37 34 54 33 33 51 37 39 32 26 32 31 40 32 32 28 45 35 32 32 32 32 33 26 32 40 37 31 46 32 16 38 40 31 34 32 23 35 26 28 30 18 19 33 31 31 34 33 33 23 41 28 31 11 23 26 33 33 30 42 51 41 30 31 28 28 32 32 35 42 31 41 31 31 26 18 20 43 31 20 18 30 31 37 31 42 22 33 31 31 16 46 14 31 46 46 46 46 16 20 24 41 40 41 41 40

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_67085831_67086319
seq2: B6Ng01-239A12.b_48_536 (reverse)

seq1  GGGAGGGAGGGAGGGAAGGAAAGGAAAGAAGGAAAGGAGAAGAAAAGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGGAGGGAGGGAAGGAAAGGAAAGAAGGAAAGGAGAAGAAAAGAAA  50

seq1  TCTACAAAATTGAGTGTGGTGACACATGTCTTAAATCTCAGCATTCAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACAAAATTGAGTGTGGTGACACATGTCTTAAATCTCAGCATTCAGGA  100

seq1  GATGTGGGTAGATTCTGGGAGTTAGATGTCAGCCTGGTCTACATATCAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTGGGTAGATTCTGGGAGTTAGATGTCAGCCTGGTCTACATATCAAG  150

seq1  TTCTAAGCTGGCCAGTGCTACATAGTGAGAGCCTATCTAGAAATAAAGGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAAGCTGGCCAGTGCTACATAGTGAGAGCCTATCTAGAAATAAAGGT  200

seq1  GGGGAGAGGCAAGTAGAAATAAAGGTGGGAGGAGGCAAGAAGAAAAAAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAGAGGCAAGTAGAAATAAAGGTGGGAGGAGGCAAGAAGAAAAAAGG  250

seq1  GAGGGACGGTCAGAGAGAGAGAACTGGGGAGCGGGGGGGGGGGGCAATAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGACGGTCAGAGAGAGAGAACTGGGGAGCGGGGGGGGGGGGCAATAG  300

seq1  AGGAAGAGCAGACATGCAATGTATTAGTTAGAGAATGGACTTCAGAACCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGAGCAGACATGCAATGTATTAGTTAGAGAATGGACTTCAGAACCA  350

seq1  GGCTGCTACGTTTTGAATCACGGGGACTTTCTGGCTTTGTGGCTCTGAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTACGTTTTGAATCACGGGGACTTTCTGGCTTTGTGGCTCTGAAA  400

seq1  AAGTCTTTTAACCTTTGTGTTTTGTTTTCCTTCTTTCTATAAAATGTAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTTTTAACCTTTGTGTTTTGTTTTCCTTCTTTCTATAAAATGTAAT  450

seq1  CACAAAGATAGTTGCCTCTTGGGGCTGCTGCAAGAATTC  489
      |||||||||||||||||||||||||||||||||||||||
seq2  CACAAAGATAGTTGCCTCTTGGGGCTGCTGCAAGAATTC  489

seq1: chr6_66934457_66935298
seq2: B6Ng01-239A12.g_68_910

seq1  GAATTCTTCAGGCATCGCTTCTGGATGCTGGTCTCTGGTTCCTGGCCTGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCAGGCATCGCTTCTGGATGCTGGTCTCTGGTTCCTGGCCTGC  50

seq1  CTGGCCCGCCAGTGGAAGTCATTCTCCAGACAGATTAGCCTGTGGTTGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCCGCCAGTGGAAGTCATTCTCCAGACAGATTAGCCTGTGGTTGGG  100

seq1  TTCTGCTCATCTTCCCCCTTGTGTTTTGTGAAACCGGTCCTGTGTTCCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCTCATCTTCCCCCTTGTGTTTTGTGAAACCGGTCCTGTGTTCCTC  150

seq1  AGGATGAGCTGAGAAGAAAAATAATCAGCTACAGGAATTTTCTAATTTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGAGCTGAGAAGAAAAATAATCAGCTACAGGAATTTTCTAATTTCC  200

seq1  AAAATGACCCTCAGTATTTTGTTGCATTGCCCGTCCCCTCCCCATTTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGACCCTCAGTATTTTGTTGCATTGCCCGTCCCCTCCCCATTTTCC  250

seq1  CCTCTTCTTGTAAAGACTTTAAATATCTCAAAATTAAAATCAGGAAAATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTCTTGTAAAGACTTTAAATATCTCAAAATTAAAATCAGGAAAATA  300

seq1  GGCTAGCCACCTGTGTAGCAAGGCTGATTGCACATGGTGTGTGTATTGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTAGCCACCTGTGTAGCAAGGCTGATTGCACATGGTGTGTGTATTGCT  350

seq1  ATGTGAAACAGCAATTTGTAGCACTGTATACAAATAGACCGCATTTGTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGAAACAGCAATTTGTAGCACTGTATACAAATAGACCGCATTTGTTT  400

seq1  AAAAACTCCTATCTATGCATATGGTATGTTTGTAAAAGGCAGCTGAGGGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACTCCTATCTATGCATATGGTATGTTTGTAAAAGGCAGCTGAGGGT  450

seq1  GTGGTGGAGGAAAGATTCTAGACAGTGGCTGCCCTTTGGAGTGAGCTTAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGGAGGAAAGATTCTAGACAGTGGCTGCCCTTTGGAGTGAGCTTAG  500

seq1  AAGGAAGGAATTGTAGCTTTTTGTTTGGTTCACATGAGTATAGTGGGGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAGGAATTGTAGCTTTTTGTTTGGTTCACATGAGTATAGTGGGGGT  550

seq1  TTGCAGCATATTTCTTGTTTCATTTTTTAAAATGCCTTCATTTTTAAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAGCATATTTCTTGTTTCATTTTTTAAAATGCCTTCATTTTTAAAAA  600

seq1  CGAAGAAAAGGCAAATACCTGAGCTGGCTTCAAACAACCGGGGCTAACTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAGAAAAGGCAAATACCTGAGCTGGCTTCAAACAACCGGGGCTAACTA  650

seq1  GTGTAATGTCTAGAAGCTGGGTCTAGCCTGGCTGCTGTAAGGTTTTCCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAATGTCTAGAAGCTGGGTCTAGCCTGGCTGCTGTAAGGTTTTCCCT  700

seq1  GAAGGAGCTCAGACAGAACATGAATTCATTTTGGGTACTTTGGTCCTGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGAGCTCAGACAGAACATGAATTCATTTTGGGTACTTTGGTCCTGCC  750

seq1  TAGCACACACTGCTGGAGCCGCAGACTGCCTCTGGAGCATTCAAGTGGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCACACACTGCTGGAGCCGCAGACTGCCTCTGGAGCATTCAAGTGGGC  800

seq1  AGTGTGCCTTGCCTGCTCCTCTTCCTTGGT-GGGGGTGGGGGG  842
      |||||||||||||||||||||||||||||| ||||||||||||
seq2  AGTGTGCCTTGCCTGCTCCTCTTCCTTGGTGGGGGGTGGGGGG  843

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information