MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-255D08
Chromosome	6 (Build37)
Map Location	132,067,075 - 132,068,259
singlet/doublet	singlet
Overlap gene	EG114600
Upstream gene	LOC667830, EG434094, Klra2, LOC434095, 2010012C16Rik, Styk1, Csda, LOC625758, 5430401F13Rik, LOC625781, Tas2r130, Tas2r107, Tas2r106, Tas2r104, Tas2r105, Tas2r114, LOC639802
Downstream gene	Prb1, LOC631126, LOC100043878, Prpmp5, EG667929, EG381818, Prh1, Prp2, A630073D07Rik, Tas2r120, Tas2r121, Tas2r122, Tas2r115, Tas2r124, Tas2r102, Tas2r136, Tas2r145-ps3, Tas2r117, Tas2r111-ps2, Tas2r123, Tas2r116, Tas2r110, Tas2r113, Tas2r142-ps5, Tas2r125, Tas2r146-ps1, Tas2r129, Tas2r131, Tas2r109, EG667992, LOC100043634, Tas2r140, LOC668002, Tas2r141-ps4, 2700089E24Rik, LOC630618
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG434094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434094 MGI:3643462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Klra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16633 MGI:101906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434095
definition	note : protein tyrosine phosphatase 4a1-like pseudo : _no_value

name	2010012C16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66441 MGI:1913691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Styk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243659 MGI:2141396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC625758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	5430401F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71392 MGI:1918642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC625781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins

name	Tas2r130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387355 MGI:2681278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387342 MGI:2681207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387341 MGI:2681203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387340 MGI:2681185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57252 MGI:2681195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387346 MGI:2681218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG114600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114600 MGI:3647826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381833 MGI:2681872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043878 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Prpmp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381832 MGI:1927478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667929 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667929 MGI:3645847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins

name	EG381818 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381818 MGI:3646668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins

name	Prh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19131 MGI:97773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83380 MGI:1932491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630073D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381819 MGI:2686534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Tas2r120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387348 MGI:2681256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387349 MGI:2681259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r122 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630845 MGI:2681262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353325 MGI:2681223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387351 MGI:2681267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387339 MGI:2681171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353165 MGI:2681304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r145-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387518 MGI:2681320
definition	gene_synonym : mps3; ps3; Tas2r45 note : taste receptor, type 2, member 145, pseudogene 3 pseudo : _no_value

name	Tas2r117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353166 MGI:2681242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r111-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387517 MGI:2681317
definition	gene_synonym : mps2; T2R11 note : taste receptor, type 2, member 111, pseudogene 2 pseudo : _no_value

name	Tas2r123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353167 MGI:2681264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112408 MGI:1890258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387344 MGI:2681216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387345 MGI:2681217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r142-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387520 MGI:2681324
definition	gene_synonym : Tas2r42 note : taste receptor, type 2, member 142, pseudogene 5 pseudo : _no_value

name	Tas2r125 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387352 MGI:2681269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r146-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387516 MGI:2681315
definition	gene_synonym : mps1; Tas2r46 note : taste receptor, type 2, member 146, pseudogene 1 pseudo : _no_value

name	Tas2r129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387354 MGI:2681276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387356 MGI:2681280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387343 MGI:2681214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667992 MGI:3643556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	LOC100043634 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043634
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Tas2r140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387616 MGI:2681298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tas2r141-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387519 MGI:2681322
definition	gene_synonym : Tas2r41 note : taste receptor, type 2, member 141, pseudogene 4 pseudo : _no_value

name	2700089E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381820 MGI:1914379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC630618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins pseudo : _no_value

name	EG434094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255352 GeneID:434094 MGI:3643462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG434094 transcript_id : XM_485832.5

name	Klra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803076 GeneID:16633 MGI:101906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 2 transcript_id : NM_008462.4

name	2010012C16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384147 GeneID:66441 MGI:1913691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010012C16 gene transcript_id : NM_025564.2

name	Styk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129934 GeneID:243659 MGI:2141396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine/tyrosine kinase 1 transcript_id : NM_172891.2

name	Csda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059498 GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold shock domain protein A transcript_id : NM_011733.2

name	Csda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059494 GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold shock domain protein A transcript_id : NM_139117.2

name	LOC625758 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94378154 GeneID:625758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : similar to M199.5 transcript_id : XM_132900.5

name	5430401F13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378155 GeneID:71392 MGI:1918642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 5430401F13 gene transcript_id : XM_355820.3

name	LOC625781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255356 GeneID:625781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : similar to HMG-L6 transcript_id : XM_890347.2

name	Tas2r130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255296 GeneID:387355 MGI:2681278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 130 transcript_id : NM_199156.1

name	Tas2r107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255292 GeneID:387342 MGI:2681207
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 107 transcript_id : NM_199154.1

name	Tas2r106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309586 GeneID:387341 MGI:2681203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 106 transcript_id : NM_207016.1

name	Tas2r104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46275827 GeneID:387340 MGI:2681185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 104 transcript_id : NM_207011.1

name	Tas2r105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048425 GeneID:57252 MGI:2681195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 105 transcript_id : NM_020501.1

name	Tas2r114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309590 GeneID:387346 MGI:2681218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 114 transcript_id : NM_207019.1

name	EG114600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716578 GeneID:114600 MGI:3647826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG114600 transcript_id : NM_053251.1

name	Prb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348571 GeneID:381833 MGI:2681872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich protein BstNI subfamily 1 transcript_id : NM_198669.1

name	LOC631126 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255121 GeneID:631126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC631126 transcript_id : XM_001471698.1

name	LOC100043878 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255443 GeneID:100043878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043878 transcript_id : XM_001481153.1

name	Prpmp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089301 GeneID:381832 MGI:1927478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich protein MP5 transcript_id : NM_001024705.2

name	EG667929 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255445 GeneID:667929 MGI:3645847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins product : predicted gene, EG667929 transcript_id : XM_993286.2

name	Prh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13928681 GeneID:19131 MGI:97773
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich protein HaeIII subfamily 1 transcript_id : NM_011174.2

name	Prp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964709 GeneID:83380 MGI:1932491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich protein 2 transcript_id : NM_031499.2

name	A630073D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255358 GeneID:381819 MGI:2686534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA A630073D07 gene transcript_id : XM_993420.2

name	Tas2r120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309594 GeneID:387348 MGI:2681256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 120 transcript_id : NM_207023.1

name	Tas2r121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309596 GeneID:387349 MGI:2681259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 121 transcript_id : NM_207024.1

name	Tas2r122 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157528 GeneID:630845 MGI:2681262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 122 transcript_id : NM_001039128.1

name	Tas2r115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309576 GeneID:353325 MGI:2681223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 115 transcript_id : NM_207020.1

name	Tas2r124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309598 GeneID:387351 MGI:2681267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 124 transcript_id : NM_207026.1

name	Tas2r102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255298 GeneID:387339 MGI:2681171
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 102 transcript_id : NM_199153.1

name	Tas2r136 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044476 GeneID:353165 MGI:2681304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 136 transcript_id : NM_181276.1

name	Tas2r117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309574 GeneID:353166 MGI:2681242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 117 transcript_id : NM_207021.1

name	Tas2r123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309580 GeneID:353167 MGI:2681264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 123 transcript_id : NM_207025.1

name	Tas2r116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778748 GeneID:112408 MGI:1890258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 116 transcript_id : NM_053212.1

name	Tas2r110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587008 GeneID:387344 MGI:2681216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 110 transcript_id : NM_199155.2

name	Tas2r113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309588 GeneID:387345 MGI:2681217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 113 transcript_id : NM_207018.1

name	Tas2r125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309604 GeneID:387352 MGI:2681269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 125 transcript_id : NM_207027.1

name	Tas2r129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309606 GeneID:387354 MGI:2681276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 129 transcript_id : NM_207029.1

name	Tas2r131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309602 GeneID:387356 MGI:2681280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 131 transcript_id : NM_207030.1

name	Tas2r109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309582 GeneID:387343 MGI:2681214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 109 transcript_id : NM_207017.1

name	EG667992 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255360 GeneID:667992 MGI:3643556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG667992 transcript_id : XM_993708.2

name	Tas2r140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51783972 GeneID:387616 MGI:2681298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 140 transcript_id : NM_021562.1

name	2700089E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255362 GeneID:381820 MGI:1914379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 2700089E24 gene transcript_id : XM_001480602.1

name	EG434094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255353 GeneID:434094 MGI:3643462
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_485832.5

name	Klra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538840 CCDS:CCDS20603.1 GeneID:16633 MGI:101906
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : killer cell lectin-like receptor subfamily A member 30 product : killer cell lectin-like receptor, subfamily A, member 2 protein_id : NP_032488.3

name	2010012C16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385002 GeneID:66441 MGI:1913691
definition	codon_start : 1 product : mago-nashi homolog protein_id : NP_079840.1

name	Styk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370362 CCDS:CCDS20604.1 GeneID:243659 MGI:2141396
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : NOK kinase protein_id : NP_766479.1

name	Csda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806532 CCDS:CCDS20605.1 GeneID:56449 MGI:2137670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y box protein 3; DNA-binding protein A product : cold shock domain protein A short isoform protein_id : NP_035863.1

name	Csda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059495 CCDS:CCDS20606.1 GeneID:56449 MGI:2137670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y box protein 3; DNA-binding protein A product : cold shock domain protein A long isoform protein_id : NP_620817.2

name	LOC625758 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38085318 GeneID:625758
definition	codon_start : 1 product : hypothetical protein protein_id : XP_132900.2

name	5430401F13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085320 GeneID:71392 MGI:1918642
definition	codon_start : 1 product : hypothetical protein LOC71392 protein_id : XP_355820.1

name	LOC625781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255357 GeneID:625781
definition	codon_start : 1 product : similar to HMG-L6 protein_id : XP_895440.2

name	Tas2r130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255297 CCDS:CCDS20608.1 GeneID:387355 MGI:2681278
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS] codon_start : 1 product : taste receptor, type 2, member 130 protein_id : NP_954607.1

name	Tas2r107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255293 CCDS:CCDS20609.1 GeneID:387342 MGI:2681207
definition	GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS] codon_start : 1 product : taste receptor, type 2, member 107 protein_id : NP_954605.1

name	Tas2r106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309587 CCDS:CCDS20610.1 GeneID:387341 MGI:2681203
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 106 protein_id : NP_996899.1

name	Tas2r104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46275828 CCDS:CCDS20611.1 GeneID:387340 MGI:2681185
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 104 protein_id : NP_996894.1

name	Tas2r105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048426 CCDS:CCDS20612.1 GeneID:57252 MGI:2681195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050913 - sensory perception of bitter taste [Evidence IMP]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : taste receptor T2R5; candidate taste receptor T2R5 product : taste receptor, type 2, member 105 protein_id : NP_065247.1

name	Tas2r114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309591 CCDS:CCDS20613.1 GeneID:387346 MGI:2681218
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 114 protein_id : NP_996902.1

name	EG114600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716579 GeneID:114600 MGI:3647826
definition	codon_start : 1 exception : unclassified translation discrepancy note : proline-rich protein product : proline rich protein MP4 protein_id : NP_444481.1

name	Prb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348572 CCDS:CCDS20614.1 GeneID:381833 MGI:2681872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : proline-rich proteoglycan 2 protein_id : NP_941071.1

name	LOC631126 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255122 GeneID:631126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471748.1

name	LOC100043878 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255444 GeneID:100043878
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481203.1

name	Prpmp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089302 GeneID:381832 MGI:1927478
definition	codon_start : 1 note : proline-rich protein PRP MP5 product : proline-rich protein MP5 protein_id : NP_001019876.2

name	EG667929 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255446 GeneID:667929 MGI:3645847
definition	codon_start : 1 product : similar to proline-rich salivary protein protein_id : XP_998380.2

name	Prh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928682 GeneID:19131 MGI:97773
definition	codon_start : 1 exception : unclassified translation discrepancy note : proline-rich salivary protein product : proline rich protein HaeIII subfamily 1 protein_id : NP_035304.2

name	Prp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964710 GeneID:83380 MGI:1932491
definition	codon_start : 1 product : proline rich protein 2 protein_id : NP_113687.2

name	A630073D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378161 GeneID:381819 MGI:2686534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_998514.1

name	Tas2r120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309595 CCDS:CCDS20617.1 GeneID:387348 MGI:2681256
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 120 protein_id : NP_996906.1

name	Tas2r121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309597 CCDS:CCDS20618.1 GeneID:387349 MGI:2681259
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 121 protein_id : NP_996907.1

name	Tas2r122 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157529 GeneID:630845 MGI:2681262
definition	codon_start : 1 product : taste receptor, type 2, member 122 protein_id : NP_001034217.1

name	Tas2r115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309577 CCDS:CCDS20619.1 GeneID:353325 MGI:2681223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 115 protein_id : NP_996903.1

name	Tas2r124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309599 CCDS:CCDS20620.1 GeneID:387351 MGI:2681267
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 124 protein_id : NP_996909.1

name	Tas2r102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255299 CCDS:CCDS20621.1 GeneID:387339 MGI:2681171
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : taste receptor, type 2, member 102 protein_id : NP_954604.1

name	Tas2r136 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044477 CCDS:CCDS20622.1 GeneID:353165 MGI:2681304
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 136 protein_id : NP_851793.1

name	Tas2r117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309575 CCDS:CCDS20623.1 GeneID:353166 MGI:2681242
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 117 protein_id : NP_996904.1

name	Tas2r123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309581 CCDS:CCDS20624.1 GeneID:353167 MGI:2681264
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 123 protein_id : NP_996908.1

name	Tas2r116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778749 CCDS:CCDS20625.1 GeneID:112408 MGI:1890258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r56; taste receptor, type 2, member 7; taste receptor, type 2, member 14 product : taste receptor, type 2, member 116 protein_id : NP_444442.1

name	Tas2r110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587009 CCDS:CCDS20626.1 GeneID:387344 MGI:2681216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 110 protein_id : NP_954606.2

name	Tas2r113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309589 CCDS:CCDS20627.1 GeneID:387345 MGI:2681217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 113 protein_id : NP_996901.1

name	Tas2r125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309605 CCDS:CCDS20628.1 GeneID:387352 MGI:2681269
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 125 protein_id : NP_996910.1

name	Tas2r129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309607 CCDS:CCDS20629.1 GeneID:387354 MGI:2681276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 129 protein_id : NP_996912.1

name	Tas2r131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309603 CCDS:CCDS20630.1 GeneID:387356 MGI:2681280
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 131 protein_id : NP_996913.1

name	Tas2r109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309583 CCDS:CCDS20631.1 GeneID:387343 MGI:2681214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 109 protein_id : NP_996900.1

name	EG667992 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255361 GeneID:667992 MGI:3643556
definition	codon_start : 1 product : similar to candidate taste receptor mt2r63 protein_id : XP_998802.2

name	Tas2r140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51783973 CCDS:CCDS20633.1 GeneID:387616 MGI:2681298
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 140 protein_id : NP_067537.1

name	2700089E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255363 GeneID:381820 MGI:1914379
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480652.1

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 1 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 2 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 3 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 4 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 5 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 6 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 3 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 2 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 1 pseudo : _no_value

name	LOC100043634 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043634
definition	number : 1 pseudo : _no_value

name	LOC100043634 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043634
definition	number : 2 pseudo : _no_value

name	LOC668002 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668002
definition	number : 1 pseudo : _no_value

name	LOC668002 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668002
definition	number : 2 pseudo : _no_value

name	LOC668002 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668002
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:186752
definition	standard_name : Klra2

name	(CDS detail)
type	STS
link
xref	UniSTS:179476
definition	standard_name : U10304

name	(CDS detail)
type	STS
link
xref	UniSTS:179506
definition	standard_name : AI326477

name	(CDS detail)
type	STS
link
xref	UniSTS:224837
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:208058
definition	standard_name : BB273866

name	(CDS detail)
type	STS
link
xref	UniSTS:219028
definition	standard_name : RH136939

name	(CDS detail)
type	STS
link
xref	UniSTS:139208
definition	standard_name : G61989

name	(CDS detail)
type	STS
link
xref	UniSTS:166299
definition	standard_name : G54762

name	(CDS detail)
type	STS
link
xref	UniSTS:186734
definition	standard_name : 282h8Sp6

name	(CDS detail)
type	STS
link
xref	UniSTS:166303
definition	standard_name : G54764

name	(CDS detail)
type	STS
link
xref	UniSTS:166313
definition	standard_name : G54769

name	(CDS detail)
type	STS
link
xref	UniSTS:166303
definition	standard_name : G54764

name	(CDS detail)
type	STS
link
xref	UniSTS:492766
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:166314
definition	standard_name : G54768

name	(CDS detail)
type	STS
link
xref	UniSTS:495726
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493160
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490632
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492769
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494184
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487868
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493147
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491963
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:166309
definition	standard_name : G54766

name	(CDS detail)
type	STS
link
xref	UniSTS:142657
definition	standard_name : D6Wum18

name	(CDS detail)
type	STS
link
xref	UniSTS:166308
definition	standard_name : G54765

name	(CDS detail)
type	STS
link
xref	UniSTS:142656
definition	standard_name : D6Wum16

name	(CDS detail)
type	STS
link
xref	UniSTS:186733
definition	standard_name : 242D11L2

name	(CDS detail)
type	STS
link
xref	UniSTS:130764
definition	standard_name : D6Mit219

name	(CDS detail)
type	STS
link
xref	UniSTS:130764
definition	standard_name : D6Mit219

name	(CDS detail)
type	STS
link
xref	UniSTS:144267
definition	standard_name : Prp

name	(CDS detail)
type	STS
link
xref	UniSTS:142584
definition	standard_name : D6Mit13

name	(CDS detail)
type	STS
link
xref	UniSTS:124938
definition	standard_name : M23236

name	(CDS detail)
type	STS
link
xref	UniSTS:142584
definition	standard_name : D6Mit13

name	(CDS detail)
type	STS
link
xref	UniSTS:130672
definition	standard_name : D6Mit13

name	(CDS detail)
type	STS
link
xref	UniSTS:130673
definition	standard_name : D6Mit13.2

name	(CDS detail)
type	STS
link
xref	UniSTS:123038
definition	standard_name : 10.MMHAP64FLD1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:494945
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487847
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488667
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492770
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492771
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490678
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493184
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494399
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487830
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491964
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491951
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494402
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487846
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490634
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490679
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495732
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487848
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493165
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487845
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165504
definition	standard_name : AI662692

name	EG381818 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255447 GeneID:381818 MGI:3646668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : predicted gene, EG381818 transcript_id : XR_035022.1

name	LOC630618 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255448 GeneID:630618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins product : similar to calmodulin pseudo : _no_value transcript_id : XR_035024.1

clone name	MSMg01-313H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-531G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-345L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066K12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-103P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358N20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365O03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170E11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-255D08.b	B6Ng01-255D08.g
ACC	GA061473	GA061474
length	1,230	1,166
definition	B6Ng01-255D08.b	B6Ng01-255D08.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaagaagctggtatacagaaaatcaagtaatactattttaaaaag ggggaacaaaaaattctcaactgaggagtaccaaatggctgagaagatct ttaccaacatatacaaggaattcaaaacgctggaatccagaaaatcaaat aaccctattaaaacagggagggggaggtacaaaaaattcttaactgagaa atatcaaatggtttaaaagcacctgaaaaaatgttcaaccttattagtca tcagagaaattgaagtcaaaacaaccctgagattccatctcataccagta agaatgcctaagatcaaaaattcaggtgacagcagatgctggcaaggatg tgaagaaagaggaccactcctccattgctggtgggattgcaagcttgtac aatcactctgcaaatcagtctggcttttcctcagaaaattggacatatta ctaccagaggatccagaaatacctctcctgtgcatatactcagaagatgt tccaactggtaataataacacatgctctaccatgttcttagctgccttat ttataatagccagaagcaggaaagaacccagatgtctctcaacagaggaa tgaatacagaaaatgtggtaaatttacacaatgtagtactactcagctat taaaaacaatggatttatgaaatttttaggcaaattgatggaattggatg atatcatcctgagtgaggtaatgcaatcacaaaactcaagtaatatacat tcactgataagtgagtattagcccagaaatttagaatatccaagatacaa tttgcaaaacacatgaaactcaagaaaaaggaaggtctaagtgtggatac ttagtccctccttagaatggggaacaaaatacccatgggaaggagttgca gagacaagtttggagctgagacagaaggaaggactatccagagactgctc cacctggatatccatactataatcagccgccaaatgcagacactatttca tatgcagcagattttgctgacatgacccttattttgctgtttctggcaaa tacagaagtgaatgctcacagtcatctatgatgacacagggcccagggaa gagctagagaagtacccaggatctggagggttgtaacctaaggagtatag caactgaacttacagtctcctggatcagttctctagctacaatgtatgtt agaggaatgtggacacttagtgtccgggcc	attctttctttttcattttttattagaacttttcttcattaacatttcac atgttatcctgaaaaacgactataatctccccaatgtcctacttcccaac ccacacacactcccatttcttgatcctggtgttcccctctactggggcat acaaagtttcaatgccaaaaggcttgtcttctgaatgatggccaagtagg caatctgagaagatatgaagcccctggcaaatactaaagtgcatgcacac agtcacctattggtgggaacacagggacccagtggaggagctagagaaag taccaaggagctgaaggggtctgcaacccaataggtggaacaagaatatg aactaactagcaatcccagagaccctgtctctagaactgaattcttgata gcctcagccctactgcatcctgctaggctaaagtcccaaagaagagtcag ggatgcatggcatgctcctgtcacaagtgtgttctacagtaaggaagtga aagatgcctttgttctaccctccttataaagactgtggccttccttcctc cagcacaaccttgggagcaatcttccaagatgctggttgtcctgctcaca gcagctttgctggtcctgagctcagctcagagacaagatgaaggtatgaa gtaggggagagagtggtacagtgatatttgactggtgtaacacacttcag gactgggagaaatgaaaggagatggaaaaggaacagaggcaaagaattat gagaacaaatagaagaacatttgttataattttacttctagagcttaaac tatacttatggtatgaattacaaatattcttgcaacaaaataacctgagt aaattcaaaaaaagacttttttgtagtagaagatgcaagaagtatgttgt agtttacagagggaacttattttttatggtgttatgaaaaaccaatagtc gattgtgcttgccttgtgtgtagaggacagagaaagaggaagtattaaaa catattaaggaatggtttagagaaacaatgtaacaattttaaactgtaca acatgactataaatatcagggttatttcttctaaatacctttatatcatt tttgattgtcataaaaatggaagtctctgagtgtctagccaatgtgtctc tccatattttccaatg
quality values	Open. Hide. 62 41 33 38 62 37 13 35 62 62 62 62 62 62 62 54 62 62 54 62 62 59 62 62 62 62 62 59 59 59 59 62 51 43 43 48 45 40 33 48 56 62 62 59 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 54 54 62 62 59 59 62 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 59 62 54 54 54 62 54 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 49 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 54 58 54 44 41 58 54 54 54 54 58 58 58 58 58 58 49 52 58 58 52 54 58 45 58 58 49 42 58 58 37 49 51 58 46 49 58 58 58 58 51 58 48 58 45 52 58 58 51 53 58 51 51 58 49 58 49 58 58 58 51 58 51 58 51 51 51 51 58 58 53 53 51 58 58 53 54 41 49 58 58 58 50 49 49 54 54 58 58 47 41 58 58 52 46 51 58 58 48 38 58 58 58 51 50 37 58 50 41 58 51 50 49 58 41 41 58 58 58 32 35 53 58 53 53 36 51 53 31 50 52 53 39 54 50 58 50 58 54 29 54 51 46 30 54 39 49 51 49 51 39 47 49 51 45 35 44 39 54 54 51 49 51 52 32 46 51 41 26 49 44 49 52 39 50 31 54 47 39 37 46 45 53 33 35 40 44 35 52 42 38 32 45 37 33 45 41 34 45 54 49 30 40 54 54 32 40 54 53 36 33 33 30 32 32 45 30 45 31 53 52 35 24 31 32 17 40 32 53 52 45 32 32 52 52 32 32 31 42 31 45 40 53 49 36 27 45 30 21 42 31 51 51 51 51 31 33 31 37 41 26 51 22 33 32 28 31 31 39 45 30 38 23 30 31 30 33 31 25 33 26 33 35 45 27 32 26 42 29 43 31 24 28 27 31 42 46 46 41 23 31 23 28 46 46 41 30 30 27 32 36 23 29 11 47 12 32 31 8 46 27 22 38 38 31 32 27 19 39 19 31 19 20 21 17 38 47 32 31 31 32 19 31 31 23 36 11 32 23 30 28 29 19 10 13 31 15 24 16 30 23 34 33 38 20 26 21 18 38 17 26 25 33 38 21 32 26 19 17 22 31 19 17 29 10 9 10 26 19 26 21 32 32 31 32 31 20 22 13 27 33 27 34 23 24 22 24 17 21 39 21 27 34 18 18 18 22 8 5 15 22 31 25 43 25 16 17 19 20 20 15 43 8 15 21 30 8 32 24 43 43 32 33 27 23 24 33 21 13 27 27 23 11 34 11 15 19 14 8 40 34 20 11 21 22 14 10 34 11 5 4 11 13 19 17 28 12 16 15 15 11 14 11 29 8 10 9 10 15 24 28 12 27 10 20 16 23 16 15 20 20 20 20 13 3 6 5 7 17 7 3 3 4 6 11 16 26 2 3 13 15 7 16 28 17 4 5 15 4 5 16 23 16 9 8 4 16 22 10 8 13 13 26 17 15 11 9 11 20 5 8 6 7 24 7 28 5 3 3 12 9 10 7 17 13 6 4 2 2 7 16 5 9 14 11 16 6 10 5 5 3 3 5 11 9 11 8 9 7 24 9 3 2 1 3 5 11 1 6 3 2 3 7 6 3 5 5 8 5 4 18 13 7 15 9 8 13 4 4 5 4 4 2 1 5 17 12 9 9 8 5 5 4 7 5 9 8 9 12 11 6 6 4 5 5 7 4 7 4 11 5 7 7 26 3 3 4	Open. Hide. 51 59 62 62 62 62 62 62 56 59 43 43 43 23 18 54 54 54 62 62 59 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 59 59 62 62 62 33 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 54 46 58 58 58 58 49 54 58 54 54 54 58 52 58 58 58 58 52 54 42 54 58 52 58 54 58 58 58 58 58 49 49 58 58 52 58 54 58 58 58 58 58 54 45 39 58 58 49 42 58 58 58 58 58 47 47 58 58 54 58 58 58 58 58 52 52 53 52 51 54 53 52 58 58 58 58 51 54 58 58 58 50 48 58 54 58 49 32 58 58 53 37 52 58 58 51 52 41 58 39 53 50 40 58 53 39 34 58 58 49 26 46 37 50 46 58 58 51 52 51 51 28 58 58 58 44 35 49 40 58 40 50 58 49 46 39 49 53 53 52 58 39 41 52 46 58 51 51 47 40 50 58 51 41 58 40 42 40 52 50 53 52 51 58 54 53 39 18 58 32 30 45 54 54 54 39 30 38 17 34 35 49 53 51 33 40 54 49 39 49 31 40 51 49 54 54 51 40 51 33 40 38 26 40 54 26 45 34 45 54 52 32 49 32 39 53 37 41 47 46 28 47 24 46 23 51 35 40 37 40 45 53 40 53 31 41 28 46 52 34 52 31 32 37 35 32 32 32 51 49 25 26 32 32 41 32 33 32 31 52 33 52 53 53 37 51 36 47 52 31 52 32 31 51 45 29 29 33 51 32 35 31 32 44 32 18 33 32 31 41 51 34 31 30 31 42 32 42 31 42 32 15 37 30 33 45 46 24 21 25 31 25 22 31 43 42 27 38 35 46 31 31 33 37 37 48 46 48 48 46 31 19 20 8 28 46 48 48 48 42 37 29 31 31 31 31 24 36 32 25 32 16 28 29 21 32 29 18 7 14 31 25 25 27 25 36 32 24 31 15 31 48 31 35 31 13 27 29 18 48 22 30 24 18 15 25 15 30 48 48 44 44 25 18 15 19 38 24 28 26 18 24 30 31 27 44 43 14 18 10 25 27 22 22 27 25 21 28 24 37 19 22 32 26 31 34 17 30 17 13 22 13 32 32 26 32 18 23 24 32 31 34 25 11 17 18 6 14 26 10 20 43 14 17 31 15 10 34 18 19 19 18 20 27 17 47 17 16 5 8 28 11 6 30 7 8 24 9 20 13 27 19 21 16 32 10 19 8 15 6 20 40 18 12 14 25 7 8 14 3 7 21 14 21 10 34 38 27 14 29 10 8 10 27 7 5 20 22 8 15 16 20 8 17 12 11 8 10 17 24 5 5 3 3 10 7 17 30 17 6 8 17 6 28 10 9 16 7 14 5 18 4 2 3 4 6 11 10 30 17 21 6 4 18 11 6 16 30 28 4 2 3 2 6 5 14 1 5 7 16 19 28 29 4 7 8 6 13 3 5 7 6 8 9 6 12 15 9 4 4 11 6 9 18 16 8 16 25 5 4 4 2 3 6 7 4 5 4 5 16 14 5 6 4 5 29 27 5 5 4 3 3 7 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_132067075_132068259
seq2: B6Ng01-255D08.g_68_1233 (reverse)

seq1  CATTTGAAAATATGGAGACACA---TGGCTAGACACACTCAGAGACTTCC  47
      |||| ||||||||||||| |||   |||||||  ||||||||||||||||
seq2  CATTGGAAAATATGGAGAGACACATTGGCTAG--ACACTCAGAGACTTCC  48

seq1  ATATTTTTATGACCATCCATAAAATGAATATTAAAGTAATATTTAGAAGA  97
        ||||||||||| |||   |||||| |||| || |   |||||||||||
seq2  --ATTTTTATGACAATC--AAAAATG-ATATAAAGG---TATTTAGAAGA  90

seq1  AATTAACCCCTGATATTTATAGTTCATGTTGTACAGTTTAAAATTTGTTA  147
      |||  | ||||||||||||||| |||||||||||||||||||| ||||| 
seq2  AAT--AACCCTGATATTTATAG-TCATGTTGTACAGTTTAAAA-TTGTT-  135

seq1  ACATTTGTTTTCTCTTAAAACCATTCC-TAATATGTTTTTAATACTTTCC  196
      |||||   |||||||  |||||||||| ||||||| ||||||||| ||||
seq2  ACATT--GTTTCTCT--AAACCATTCCTTAATATG-TTTTAATAC-TTCC  179

seq1  TCTTTCTCTGTCCTCTACACACAAGGCAAGCACAATCGACTATTGGTTTT  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTCTGTCCTCTACACACAAGGCAAGCACAATCGACTATTGGTTTT  229

seq1  TCATAACACCATAAAAAATAAGTTTCCCTCTGTAAACTACAACATACTTT  296
      |||||||||||||||||||||| |||||||||||||||||||||||| ||
seq2  TCATAACACCATAAAAAATAAG-TTCCCTCTGTAAACTACAACATAC-TT  277

seq1  CTTGCATCTTCTACTACAAAAAAGTCTTTTTTTGAATTTACTCAGGTTAT  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCATCTTCTACTACAAAAAAGTCTTTTTTTGAATTTACTCAGGTTAT  327

seq1  TTTGTTGCAAGAATATTTGTAATTCATACCATAAGTATAGTTTAAGCTCT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTGCAAGAATATTTGTAATTCATACCATAAGTATAGTTTAAGCTCT  377

seq1  AGAAGTAAAATTATAACAAATGTTCTTCTATTTGTTCTCATAATTCTTTG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGTAAAATTATAACAAATGTTCTTCTATTTGTTCTCATAATTCTTTG  427

seq1  CCTCTGTTCCTTTTCCATCTCCTTTCATTTCTCCCAGTCCTGAAGTGTGT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGTTCCTTTTCCATCTCCTTTCATTTCTCCCAGTCCTGAAGTGTGT  477

seq1  TACACCAGTCAAATATCACTGTACCACTCTCTCCCCTACTTCATACCTTC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACCAGTCAAATATCACTGTACCACTCTCTCCCCTACTTCATACCTTC  527

seq1  ATCTTGTCTCTGAGCTGAGCTCAGGACCAGCAAAGCTGCTGTGAGCAGGA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTGTCTCTGAGCTGAGCTCAGGACCAGCAAAGCTGCTGTGAGCAGGA  577

seq1  CAACCAGCATCTTGGAAGATTGCTCCCAAGGTTGTGCTGGAGGAAGGAAG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCAGCATCTTGGAAGATTGCTCCCAAGGTTGTGCTGGAGGAAGGAAG  627

seq1  GCCACAGTCTTTATAAGGAGGGTAGAACAAAGGCATCTTTCACTTCCTTA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACAGTCTTTATAAGGAGGGTAGAACAAAGGCATCTTTCACTTCCTTA  677

seq1  CTGTAGAACACACTTGTGACAGGAGCATGCCATGCATCCCTGACTCTTCT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAGAACACACTTGTGACAGGAGCATGCCATGCATCCCTGACTCTTCT  727

seq1  TTGGGACTTTAGCCTAGCAGGATGCAGTAGGGCTGAGGCTATCAAGAATT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGACTTTAGCCTAGCAGGATGCAGTAGGGCTGAGGCTATCAAGAATT  777

seq1  CAGTTCTAGAGACAGGGTCTCTGGGATTGCTAGTTAGTTCATATTCTTGT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTCTAGAGACAGGGTCTCTGGGATTGCTAGTTAGTTCATATTCTTGT  827

seq1  TCCACCTATTGGGTTGCAGACCCCTTCAGCTCCTTGGTACTTTCTCTAGC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACCTATTGGGTTGCAGACCCCTTCAGCTCCTTGGTACTTTCTCTAGC  877

seq1  TCCTCCACTGGGTCCCTGTGTTCCCACCAATAGGTGACTGTGTGCATGCA  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCACTGGGTCCCTGTGTTCCCACCAATAGGTGACTGTGTGCATGCA  927

seq1  CTTTAGTATTTGCCAGGGGCTTCATATCTTCTCAGATTGCCTACTTGGCC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGTATTTGCCAGGGGCTTCATATCTTCTCAGATTGCCTACTTGGCC  977

seq1  ATCATTCAGAAGACAAGCCTTTTGGCATTGAAACTTTGTATGCCCCAGTA  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATTCAGAAGACAAGCCTTTTGGCATTGAAACTTTGTATGCCCCAGTA  1027

seq1  GAGGGGAACACCAGGATCAAGAAATGGGAGTGTGTGTGGGTTGGGAAGTA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGGAACACCAGGATCAAGAAATGGGAGTGTGTGTGGGTTGGGAAGTA  1077

seq1  GGACATTGGGGAGATTATAGTCGTTTTTCAGGATAACATGTGAAATGTTA  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACATTGGGGAGATTATAGTCGTTTTTCAGGATAACATGTGAAATGTTA  1127

seq1  ATGAAGAAAAGTTCTAATAAAAAATGAAAAAGAAAGAAT  1185
      |||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGAAAAGTTCTAATAAAAAATGAAAAAGAAAGAAT  1166

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information