MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-286E15
Chromosome	6 (Build37)
Map Location	40,483,081 - 40,607,271
singlet/doublet	doublet
Overlap gene	Olfr461, Olfr460, Clec5a, Tas2r138, Mgam
Upstream gene	Dennd2a, Adck2, Ndufb2, Braf, Fth-ps2, Mrps33, LOC665247, LOC665254, EG434008, Agk, E330009J07Rik, BC052883, Ssbp1, Tas2r137, Tas2r108, 1700016G05Rik, LOC669661
Downstream gene	EG638904, Moxd2, LOC621968, BC048599, 1700074P13Rik, LOC194360, 1810009J06Rik, LOC100040208, 2210010C04Rik, LOC100039790, Tcrb-V8.2, LOC100040359, LOC100040333, Try4, 1810049H19Rik, Try10, Prss3, EG436523, EG386551, LOC100040233, Prss1, Prss2, Tcrb-V13, Ephb6, Trpv6, Trpv5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dennd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209773 MGI:2444961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68198 MGI:1915448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Braf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109880 MGI:88190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fth-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14321 MGI:104594
definition	gene_synonym : Fth-rs2 note : ferritin heavy chain, pseudogene 2 pseudo : _no_value

name	Mrps33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14548 MGI:1338046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC665254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	EG434008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434008 MGI:3647581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69923 MGI:1917173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330009J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243780 MGI:2444256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052883 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381759 MGI:3027899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tas2r137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67690 MGI:1914940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Olfr461 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr460 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tas2r138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387513 MGI:2681306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232714 MGI:1203495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 6 Proteins

name	EG638904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638904 MGI:3645497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Moxd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194357 MGI:2388042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	BC048599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232717 MGI:3608323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700074P13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73481 MGI:1920731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194360 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	1810009J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73626 MGI:1920876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 55 Proteins

name	2210010C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67373 MGI:1914623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Tcrb-V8.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 8 Proteins

name	LOC100040359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC100040333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Try4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22074 MGI:102757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810049H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435889 MGI:3045752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Try10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG386551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins

name	Prss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcrb-V13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ephb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13848 MGI:1096338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64177 MGI:1927259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194352 MGI:2429764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dennd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366403 GeneID:209773 MGI:2444961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 2A transcript_id : NM_172477.2

name	Adck2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803492 GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 2 transcript_id : NM_178873.3

name	Ndufb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386282 GeneID:68198 MGI:1915448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 transcript_id : NM_026612.2

name	Braf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801723 GeneID:109880 MGI:88190
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Braf transforming gene transcript_id : NM_139294.4

name	Mrps33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331152 GeneID:14548 MGI:1338046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S33 transcript_id : NM_001010930.1

name	Mrps33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331151 GeneID:14548 MGI:1338046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S33 transcript_id : NM_010270.2

name	EG434008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801946 GeneID:434008 MGI:3647581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434008 transcript_id : NM_001004182.2

name	Agk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537517 GeneID:69923 MGI:1917173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylglycerol kinase transcript_id : NM_023538.1

name	E330009J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802116 GeneID:243780 MGI:2444256
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330009J07 gene transcript_id : NM_175528.3

name	BC052883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235772 GeneID:381759 MGI:3027899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052883 transcript_id : NM_201370.1

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374436 GeneID:381760 MGI:1920040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_212468.3

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374437 GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_028358.2

name	Tas2r137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480159 GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 137 transcript_id : NM_001025385.1

name	Tas2r108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048427 GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 108 transcript_id : NM_020502.1

name	1700016G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385811 GeneID:67690 MGI:1914940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700016G05 gene transcript_id : NM_026317.1

name	Olfr461 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129540 GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 461 transcript_id : NM_146382.1

name	Olfr460 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129534 GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 460 transcript_id : NM_146383.1

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370378 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_021364.2

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370375 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_001038604.1

name	Tas2r138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47824875 GeneID:387513 MGI:2681306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 138 transcript_id : NM_001001451.1

name	Mgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255058 GeneID:232714 MGI:1203495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 6 Proteins product : maltase-glucoamylase transcript_id : XM_001481277.1

name	EG638904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377282 GeneID:638904 MGI:3645497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG638904 transcript_id : XM_976192.1

name	Moxd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948566 GeneID:194357 MGI:2388042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monooxygenase, DBH-like 2 transcript_id : NM_139296.2

name	LOC621968 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82900877 GeneID:621968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to T-cell receptor beta chain V region E1 precursor transcript_id : XM_886370.1

name	BC048599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801831 GeneID:232717 MGI:3608323
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048599 transcript_id : NM_175020.2

name	1700074P13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893180 GeneID:73481 MGI:1920731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700074P13 gene transcript_id : NM_028550.3

name	1810009J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130492 GeneID:73626 MGI:1920876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009J06 gene transcript_id : NM_023707.3

name	LOC100040208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255071 GeneID:100040208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 55 Proteins product : similar to trypsinogen 4 transcript_id : XM_001474567.1

name	2210010C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043960 GeneID:67373 MGI:1914623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010C04 gene transcript_id : NM_023333.4

name	LOC100039790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255060 GeneID:100039790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to TCRBV16S1 transcript_id : XM_001473509.1

name	LOC100040359 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255077 GeneID:100040359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : similar to LOC639390 protein transcript_id : XM_001474835.1

name	LOC100040333 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255075 GeneID:100040333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to Expressed sequence AW456874 transcript_id : XM_001474813.1

name	Try4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129293 GeneID:22074 MGI:102757
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trypsin 4 transcript_id : NM_011646.3

name	1810049H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802041 GeneID:435889 MGI:3045752
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810049H19 gene transcript_id : NM_001003405.2

name	Try10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781770 GeneID:436522 MGI:3687012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trypsin 10 transcript_id : NM_001038996.1

name	Prss3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755890 GeneID:22073 MGI:102758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 3 transcript_id : NM_011645.1

name	EG436523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781767 GeneID:436523 MGI:3646222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436523 transcript_id : NM_001038997.1

name	EG386551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092302 GeneID:386551 MGI:3643903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG386551 transcript_id : NM_001003664.1

name	LOC100040233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255073 GeneID:100040233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 116 ESTs, 98 Proteins product : similar to trypsinogen 15 transcript_id : XM_001474605.1

name	Prss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716568 GeneID:114228 MGI:98839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 1 (trypsin 1) transcript_id : NM_053243.1

name	Prss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678438 GeneID:22072 MGI:102759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 2 transcript_id : NM_009430.1

name	Ephb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354026 GeneID:13848 MGI:1096338
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B6 transcript_id : NM_007680.3

name	Trpv6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374373 GeneID:64177 MGI:1927259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 6 transcript_id : NM_022413.3

name	Trpv5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186473 GeneID:194352 MGI:2429764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 5 transcript_id : NM_001007572.2

name	Adck2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725855 CCDS:CCDS20024.1 GeneID:57869 MGI:1889336
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 2 protein_id : NP_849204.1

name	Ndufb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386096 CCDS:CCDS20025.1 GeneID:68198 MGI:1915448
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 protein_id : NP_080888.1

name	Braf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199767 GeneID:109880 MGI:88190
definition	EC_number : 2.7.11.1 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : B-Raf proto-oncogene serine/threonine-protein kinase (p94) product : Braf transforming protein_id : NP_647455.2

name	Mrps33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859564 CCDS:CCDS20026.1 GeneID:14548 MGI:1338046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ganglioside-induced differentiation-associated-protein 3 product : mitochondrial ribosomal protein S33 isoform 1 protein_id : NP_034400.1

name	Mrps33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331153 GeneID:14548 MGI:1338046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ganglioside-induced differentiation-associated-protein 3 product : mitochondrial ribosomal protein S33 isoform 2 protein_id : NP_001010930.1

name	EG434008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921359 GeneID:434008 MGI:3647581
definition	codon_start : 1 product : hypothetical protein LOC434008 protein_id : NP_001004182.1

name	Agk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537518 CCDS:CCDS20027.1 GeneID:69923 MGI:1917173
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0001729 - ceramide kinase activity [Evidence IDA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0001727 - lipid kinase activity [Evidence IDA] GO_process : GO:0046834 - lipid phosphorylation [Evidence IDA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : multiple substrate lipid kinase product : multi-substrate lipid kinase protein_id : NP_076027.1

name	E330009J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425298 CCDS:CCDS20028.1 GeneID:243780 MGI:2444256
definition	codon_start : 1 product : hypothetical protein LOC243780 protein_id : NP_780737.1

name	BC052883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235773 CCDS:CCDS20029.1 GeneID:381759 MGI:3027899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381759 protein_id : NP_958758.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059026 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : single-stranded DNA binding protein 1 isoform 1 protein_id : NP_997633.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058964 CCDS:CCDS20030.1 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : single-stranded DNA binding protein 1 isoform 2 protein_id : NP_082634.1

name	Tas2r137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480160 CCDS:CCDS20031.1 GeneID:574417 MGI:3606604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r41; taste receptor T2R37 product : taste receptor, type 2, member 137 protein_id : NP_001020556.1

name	Tas2r108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048428 CCDS:CCDS20032.1 GeneID:57253 MGI:2681210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : taste receptor T2R8; candidate taste receptor T2R8 product : taste receptor, type 2, member 108 protein_id : NP_065248.1

name	1700016G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385812 CCDS:CCDS20033.1 GeneID:67690 MGI:1914940
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67690 protein_id : NP_080593.1

name	Olfr461 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129541 CCDS:CCDS20034.1 GeneID:258380 MGI:3030295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6973252-6974193; olfactory receptor MOR120-3 product : olfactory receptor 461 protein_id : NP_666494.1

name	Olfr460 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129535 CCDS:CCDS20035.1 GeneID:258381 MGI:3030294
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6947292-6946348; olfactory receptor MOR120-2 product : olfactory receptor 460 protein_id : NP_666495.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946692 CCDS:CCDS20037.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 2 protein_id : NP_067339.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370376 CCDS:CCDS20036.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 1 protein_id : NP_001033693.1

name	Tas2r138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824876 CCDS:CCDS20038.1 GeneID:387513 MGI:2681306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence ISS] [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 138 protein_id : NP_001001451.1

name	Mgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255059 GeneID:232714 MGI:1203495
definition	codon_start : 1 note : overriding stop codons product : similar to maltase-glucoamylase protein_id : XP_001481327.1 transl_except : (pos:40630375..40630377,aa:OTHER) transl_except : (pos:40714274..40714276,aa:OTHER)

name	EG638904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377283 GeneID:638904 MGI:3645497
definition	codon_start : 1 product : similar to hCG2001479 protein_id : XP_981286.1

name	Moxd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948567 CCDS:CCDS20039.1 GeneID:194357 MGI:2388042
definition	GO_process : GO:0006548 - histidine catabolism [Evidence IEA] codon_start : 1 note : dopamine beta-hydroxylase-like 1 product : monooxygenase, DBH-like 2 protein_id : NP_647457.2

name	LOC621968 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82900878 GeneID:621968
definition	codon_start : 1 product : similar to T-cell receptor beta V(E1)-D(1)-J(2.5) protein_id : XP_891463.1

name	BC048599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239437 CCDS:CCDS20040.1 GeneID:232717 MGI:3608323
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232717 protein_id : NP_778185.1

name	1700074P13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312106 CCDS:CCDS20041.1 GeneID:73481 MGI:1920731
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73481 protein_id : NP_082826.1

name	1810009J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963793 CCDS:CCDS20042.1 GeneID:73626 MGI:1920876
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : trypsinogen; trypsinogen 5 product : RIKEN cDNA 1810009J06 protein_id : NP_076196.1

name	LOC100040208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255072 GeneID:100040208
definition	codon_start : 1 product : similar to trypsinogen 4 protein_id : XP_001474617.1

name	2210010C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043961 CCDS:CCDS20043.1 GeneID:67373 MGI:1914623
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : trypsinogen 7 protein_id : NP_075822.3

name	LOC100039790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255061 GeneID:100039790
definition	codon_start : 1 product : similar to TCRBV16S1 protein_id : XP_001473559.1

name	Tcrb-V8.2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	codon_start : 1 exception : rearrangement required for product

name	Tcrb-V8.2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:21607 MGI:98608
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100040359 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255078 GeneID:100040359
definition	codon_start : 1 product : similar to LOC639390 protein protein_id : XP_001474885.1

name	LOC100040333 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255076 GeneID:100040333
definition	codon_start : 1 product : similar to Expressed sequence AW456874 protein_id : XP_001474863.1

name	Try4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755893 CCDS:CCDS20044.1 GeneID:22074 MGI:102757
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : trypsin 4 protein_id : NP_035776.1

name	1810049H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51010909 CCDS:CCDS20045.1 GeneID:435889 MGI:3045752
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : Tesp4 protein protein_id : NP_001003405.1

name	Try10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781771 CCDS:CCDS20046.1 GeneID:436522 MGI:3687012
definition	codon_start : 1 product : trypsinogen 10 protein_id : NP_001034085.1

name	Prss3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755891 CCDS:CCDS20047.1 GeneID:22073 MGI:102758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mesotrypsin; trypsin 3; trypsinogen; trypsinogen 15 product : protease, serine, 3 protein_id : NP_035775.1

name	EG436523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781768 CCDS:CCDS20048.1 GeneID:436523 MGI:3646222
definition	codon_start : 1 product : trypsinogen 12 protein_id : NP_001034086.1

name	EG386551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092303 GeneID:386551 MGI:3643903
definition	codon_start : 1 function : serine protease product : Try10-like trypsinogen protein_id : NP_001003664.1

name	LOC100040233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255074 GeneID:100040233
definition	codon_start : 1 product : similar to trypsinogen 15 protein_id : XP_001474655.1

name	Prss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716569 CCDS:CCDS20049.1 GeneID:114228 MGI:98839
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : trypsinogen 16; trypsin 1 product : protease, serine, 1 protein_id : NP_444473.1

name	Prss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678439 CCDS:CCDS20050.1 GeneID:22072 MGI:102759
definition	GO_component : GO:0031012 - extracellular matrix [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004295 - trypsin activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence ISS]; GO:0007586 - digestion [Evidence IEA]; GO:0045785 - positive regulation of cell adhesion [Evidence ISS]; GO:0030307 - positive regulation of cell growth [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : trypsin 2; trypsinogen 20 product : protease, serine, 2 protein_id : NP_033456.1

name	Tcrb-V13 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:269846 MGI:98587
definition	codon_start : 1 exception : rearrangement required for product

name	Ephb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982461 CCDS:CCDS20051.1 GeneID:13848 MGI:1096338
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chicken eph/elk receptor-like protein product : Eph receptor B6 protein_id : NP_031706.2

name	Trpv6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28376639 CCDS:CCDS20052.1 GeneID:64177 MGI:1927259
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : osmosensitive transient receptor potential channel 3; epithelial calcium channel 2 product : transient receptor potential cation channel, subfamily V, member 6 protein_id : NP_071858.2

name	Trpv5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090239 CCDS:CCDS20053.1 GeneID:194352 MGI:2429764
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA] [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence NAS]; GO:0006816 - calcium ion transport [Evidence IDA] [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0051262 - protein tetramerization [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : epithelial calcium channel 1 product : transient receptor potential cation channel, subfamily V, member 5 protein_id : NP_001007573.1

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 3 pseudo : _no_value

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 2 pseudo : _no_value

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 1 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 5 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 4 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 3 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 2 pseudo : _no_value

name	LOC194360 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194360
definition	number : 1 pseudo : _no_value

name	Tcrb-V8.2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:21607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 4 Proteins standard_name : Tcrb-V8.2

name	Tcrb-V8.2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:21607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 6 Proteins standard_name : Tcrb-V8.2

name	Tcrb-V13 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:269846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins standard_name : Tcrb-V13

name	(CDS detail)
type	STS
link
xref	UniSTS:130717
definition	standard_name : D6Mit173

name	(CDS detail)
type	STS
link
xref	UniSTS:161491
definition	standard_name : RH124669

name	(CDS detail)
type	STS
link
xref	UniSTS:185663
definition	standard_name : BB006057

name	(CDS detail)
type	STS
link
xref	UniSTS:167497
definition	standard_name : AU015031

name	(CDS detail)
type	STS
link
xref	UniSTS:219348
definition	standard_name : RH137260

name	(CDS detail)
type	STS
link
xref	UniSTS:159496
definition	standard_name : AI447469

name	(CDS detail)
type	STS
link
xref	UniSTS:235421
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235419
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235425
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235420
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:141185
definition	standard_name : Braf

name	(CDS detail)
type	STS
link
xref	UniSTS:130698
definition	standard_name : D6Mit153

name	(CDS detail)
type	STS
link
xref	UniSTS:185664
definition	standard_name : C87398

name	(CDS detail)
type	STS
link
xref	UniSTS:235427
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165462
definition	standard_name : AI841153

name	(CDS detail)
type	STS
link
xref	UniSTS:141948
definition	standard_name : D13Sfk14

name	(CDS detail)
type	STS
link
xref	UniSTS:130705
definition	standard_name : D6Mit161.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130704
definition	standard_name : D6Mit161

name	(CDS detail)
type	STS
link
xref	UniSTS:130786
definition	standard_name : D6Mit239

name	(CDS detail)
type	STS
link
xref	UniSTS:130706
definition	standard_name : D6Mit161.2

name	(CDS detail)
type	STS
link
xref	UniSTS:224210
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207943
definition	standard_name : BB283466

name	(CDS detail)
type	STS
link
xref	UniSTS:151126
definition	standard_name : D7S2119E

name	(CDS detail)
type	STS
link
xref	UniSTS:235423
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159493
definition	standard_name : AI465370

name	(CDS detail)
type	STS
link
xref	UniSTS:220154
definition	standard_name : RH138067

name	(CDS detail)
type	STS
link
xref	UniSTS:164322
definition	standard_name : AI841796

name	(CDS detail)
type	STS
link
xref	UniSTS:235428
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207942
definition	standard_name : AU023319

name	(CDS detail)
type	STS
link
xref	UniSTS:494930
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485084
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492662
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492557
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142594
definition	standard_name : D6Mit382

name	(CDS detail)
type	STS
link
xref	UniSTS:207939
definition	standard_name : RH126673

name	(CDS detail)
type	STS
link
xref	UniSTS:141212
definition	standard_name : Cacnb3

name	(CDS detail)
type	STS
link
xref	UniSTS:224349
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165461
definition	standard_name : AV047902

name	(CDS detail)
type	STS
link
xref	UniSTS:165460
definition	standard_name : AV072249

name	(CDS detail)
type	STS
link
xref	UniSTS:144579
definition	standard_name : Tcrb

name	(CDS detail)
type	STS
link
xref	UniSTS:124905
definition	standard_name : L37871

name	(CDS detail)
type	STS
link
xref	UniSTS:130724
definition	standard_name : ND

name	(CDS detail)
type	STS
link
xref	UniSTS:130725
definition	standard_name : D6Mit182.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130863
definition	standard_name : D6Mit311

name	(CDS detail)
type	STS
link
xref	UniSTS:124936
definition	standard_name : M22605

name	(CDS detail)
type	STS
link
xref	UniSTS:144580
definition	standard_name : Tcrb-C

name	(CDS detail)
type	STS
link
xref	UniSTS:144578
definition	standard_name : Tcrb

name	(CDS detail)
type	STS
link
xref	UniSTS:116606
definition	standard_name : D6Mit117

name	(CDS detail)
type	STS
link
xref	UniSTS:495891
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:502658
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:266995
definition	standard_name : Ephb6

name	(CDS detail)
type	STS
link
xref	UniSTS:159494
definition	standard_name : L77867

name	(CDS detail)
type	STS
link
xref	UniSTS:207941
definition	standard_name : BB111090

name	(CDS detail)
type	STS
link
xref	UniSTS:125978
definition	standard_name : mHAa31g5.seq

name	LOC665254 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255068 GeneID:665254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to Aldolase 1, A pseudo : _no_value transcript_id : XR_031611.1

name	LOC669661 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255057 GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_031169.1

clone name	MSMg01-509D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342N22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-236P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273L05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-280M07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543I08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-433H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-157L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-286E15.b	B6Ng01-286E15.g
ACC	GA084524	GA084525
length	1,163	1,132
definition	B6Ng01-286E15.b	B6Ng01-286E15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(40,606,098 - 40,607,271)	(40,483,081 - 40,484,224)
sequence	gaattctgaaaacatagttcatagaatctctcttctcaaagaagccttcc tgaccccagcttaaccttatctgcaggtggtctattgagttttaatataa ataaccaccatacagagccctacagggtctgaaagtccacactgctcctt ggtgttgtttatgctttaccccttggccagcaaaggtctaaagctccaga ttaggtcatcaccaccagctgctccacataaactgctctcgaaacacatt ttccacttttctgacaggtatttgggcagcaagcatgtgtttaagtgaga cagggtgagaataagatgctgtctctgctgcctgaaaaacagtttaccat gggctcctaatttgatttcaatgggaaagttattgggcatgttctttgtg atatttagtcttctagatacttgacatcttttagtcatttaacccttatc accagcttcaaggagagtatatgaaccccacttttaagttccacaactcc tgaatgagctagctaagcatatgtaattaccccaattgtagaaccccaat gtggaattgaacacccaaagaggtaacaacttgcccagaatcatgtagtt gataagtagaagatctccaaagcaaagcagcctcggtttagattttcact ctaaacaactatactatgtgaccctcaagattagaggaaagaagcctgaa agcttacctcattcggggttgtgtctctggaaaacatgggccaggtcttc caattcatattgtgtcggtactgctggtgcacatgttcacccagaccata tacattagcacttggcaggtgggtagagaactgcaggaactggtcagaga agaggaggggcccaatacttgagtcaaacctaaacatgggaggtaaacac agacatgagtgagaagtagggagagaagactcagtactctccacagacaa gtgatctccacagctcacaacacaatacccctctccaagcttctctgaca ggtcccatagataccaaagagaaacaatctcccggccaggtatctcactg tgttacacccttgcttgttcttctacaccttacaatataaccgagcactt gttatcaaggtgtcatagacctaatagaacctgaatgatgcttggtgatt acgtgaaacagac	gaattcaaggctattctttgagcattttgttagttgctaattgatgtagg atggaccagttccaagccagagatgggagatgcagaatggtgggatgcta tctctaagcaagtgaacctaggatgcatttaaaaagtagcaaagcaagcc aaaaggcagcactcctccatggtctcttcttcagttccagtccccatgtt cctgccttgagccctcctctcctggcttcccttagtgatggactagaagc tggaaatgaagacaaaccttttcctcactaagatgcttatggtcatggtg tttatcacagctatagaaaccagactaaaacaagttgggaaaaaactata gaaaaatgtctcaagagaaaaatccaagtgatttgtgtcatgatatattt attaataagagttaaggtatatgtgttctttaggaagatgataattgttt tgattccttaaaaagttttgagagtggggaaataattggtcccttgggaa tcaggtagaaaacttttcagtgttgaaaatattttccttatttaatggtt ccttccattttgttgaaaatgatgtcattaatttacacaatgaataacat tcttgtgtttttatgatcattccatcaacagtagctgtctagtttgatct atatcttagctataaacatgaacatgaaggcatctctgtggtgtgatgac ttcatttcctttgtttttatagcacagggagaggagagagggctgtgatt gggaggtaatatgaataagacaataaattatggcaagtaaaaaaggagga aaggaggggaagcttttatcaagatgtgggtaaattaattaattagttag ttaattattaaaattggcaatagtaaaacgtttctggatgcccaatgacc aaacactactttgaattgaaatgtgtgacaagcctgagtgatgctggcca tgctcagacatactgcctcatgtgctttagccgcagctcatgaatgcaga tgttagtgagacctagactttcacgaacctttcatgcatacccatgattc cccacccaagttacactgccatgctctagagctcggaactttagtgcatg tttattaagtttatggtgcatgatgactttca
quality values	Open. Hide. 58 36 19 26 58 54 34 36 38 54 62 62 42 33 54 62 62 62 62 37 43 62 62 62 62 39 39 62 62 62 62 56 50 34 38 32 24 21 21 32 28 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 43 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 54 58 58 58 58 58 58 42 58 54 58 58 58 58 58 58 58 58 54 54 58 58 54 58 58 58 58 58 58 53 58 58 58 58 54 54 58 58 58 54 54 54 58 58 58 58 58 58 52 58 58 58 58 58 58 54 58 58 49 58 58 58 54 58 58 58 54 58 58 58 54 47 58 58 58 51 54 51 48 58 54 51 58 58 54 58 40 54 50 58 50 51 53 54 58 58 54 58 54 58 50 53 50 58 54 52 53 46 54 58 52 54 50 58 58 50 49 40 50 58 51 51 58 46 58 58 46 49 31 52 52 52 50 36 58 58 40 52 41 49 58 50 51 41 33 39 58 53 53 39 51 51 58 58 46 39 41 26 58 58 58 39 49 53 54 53 51 50 58 58 53 35 49 42 49 53 53 52 53 53 49 52 53 58 51 47 42 58 51 51 41 42 31 43 38 21 54 53 45 52 38 28 30 54 49 37 38 40 26 35 52 52 53 37 54 38 39 41 49 46 35 34 49 53 53 42 49 52 52 36 54 54 54 35 53 54 37 53 45 53 43 53 44 54 54 37 54 54 52 37 37 33 54 54 42 42 40 42 24 54 39 45 39 41 33 41 32 28 27 27 31 32 42 38 29 23 28 29 47 35 33 32 45 29 26 32 34 53 31 43 45 53 31 35 31 33 31 26 40 53 29 47 40 32 52 53 53 32 33 42 25 32 31 31 33 32 31 38 30 33 43 42 33 36 31 32 31 31 42 30 28 31 36 45 28 45 51 31 29 36 30 33 26 45 32 29 38 31 25 20 19 17 32 31 31 34 42 42 29 33 25 18 46 8 33 33 22 46 16 30 38 23 46 46 42 20 46 46 21 17 11 29 32 31 33 27 37 24 28 27 31 41 24 18 21 31 28 46 27 29 16 30 31 48 30 36 24 18 12 33 46 25 43 30 31 24 28 31 18 15 31 32 37 18 34 32 36 16 31 30 21 31 31 18 47 31 31 23 35 19 44 32 13 31 13 34 26 21 24 31 25 32 34 32 31 29 9 9 16 20 21 34 19 10 14 19 32 27 13 25 27 32 29 9 10 16 31 32 25 34 21 15 31 7 10 16 13 23 32 11 21 11 24 37 48 37 26 19 9 6 29 15 27 8 19 7 9 30 9 15 11 22 26 7 5 4 8 13 20 40 15 8 15 12 7 7 8 8 19 18 13 40 18 6 17 6 16 47 21 6 6 8 10 10 5 4 31 21 9 18 9 13 16 13 10 6 6 8 5 8 15 10 8 7 10 8 27 5 10 9 5 12 5 26 4 2 4 12 10 7 5 11 5 11 7 3 9 6 7 13 9 5 5 12 4 11 8 10 16 13 6 4 4 4 13 7 13 4 18 9 8 4 9 10 5 12 4 4 4 12 5 6 14 9 6 5 21 7 18 9 19 10 5 19 18 21 9 7 17 3 5 5 21 21 8 5 20 5 3 4 9 7 8 8 9 11 10 15 10 5 6 4 3 6 16 8 23 8 9 6 4 6 12 9 8 9 7 3	Open. Hide. 62 47 43 47 62 42 42 54 62 62 62 42 42 44 32 56 39 62 62 62 62 56 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 59 62 54 54 59 62 62 59 59 59 59 46 37 54 62 59 59 62 62 62 54 59 62 59 59 59 59 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 47 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 54 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 54 52 58 58 46 58 54 58 53 58 58 58 58 58 58 58 58 58 54 53 54 58 58 54 58 54 58 58 58 47 42 54 58 58 58 58 58 58 58 58 54 54 58 54 52 58 58 58 58 49 54 58 58 58 58 54 42 41 58 58 58 52 58 50 58 53 58 58 58 49 46 58 51 47 58 52 53 52 51 45 43 51 58 58 51 52 52 53 51 19 58 58 58 58 53 53 52 51 51 50 51 58 54 58 54 58 51 58 50 58 58 49 53 53 41 58 47 46 53 33 51 54 52 41 46 53 46 40 49 41 39 46 53 51 40 58 53 51 49 54 51 50 40 54 58 49 50 46 52 52 46 52 51 39 51 54 52 50 52 37 46 41 39 46 41 58 54 52 32 58 50 49 31 49 39 52 49 36 33 40 54 42 32 53 50 49 41 51 58 50 53 47 40 54 49 47 47 27 49 41 32 31 40 52 32 32 54 27 40 51 39 54 51 46 36 54 54 54 31 35 41 38 34 53 45 50 40 24 51 29 20 39 51 54 54 46 33 51 54 54 51 54 49 38 41 38 31 49 35 54 37 37 54 54 51 47 54 33 45 40 39 40 40 27 24 19 31 34 33 19 47 24 26 32 53 31 53 28 33 32 31 26 32 32 36 35 37 32 37 41 53 53 52 53 53 32 32 40 28 36 30 52 32 24 33 31 8 49 47 30 33 33 21 31 33 51 51 38 25 31 31 21 21 25 31 24 33 31 43 51 31 30 29 46 25 8 25 14 31 31 40 13 24 29 30 28 20 32 19 34 30 30 31 23 30 17 9 18 15 31 21 32 36 32 16 27 11 25 14 25 31 31 32 26 15 25 48 46 30 30 25 31 48 31 26 15 27 32 32 25 34 32 31 30 25 16 27 34 31 30 33 30 47 24 31 15 30 31 35 35 33 48 23 24 30 24 15 24 24 26 44 19 29 29 14 21 25 22 27 12 6 22 25 23 17 31 26 14 12 9 27 26 19 33 27 16 29 18 12 16 14 23 36 22 17 19 21 12 24 11 15 26 27 34 23 21 18 20 19 21 10 13 10 6 21 22 33 48 14 26 19 33 17 21 34 32 9 17 4 30 28 32 21 16 16 12 21 8 5 5 14 17 17 8 8 30 9 6 12 27 13 28 10 9 8 13 6 7 6 18 34 13 11 11 20 13 15 18 19 20 6 47 17 23 20 8 12 3 6 19 6 14 28 31 10 5 6 24 26 8 7 26 34 17 6 13 29 22 4 8 9 18 22 7 6 4 8 15 18 6 6 8 6 7 9 11 8 12 23 9 21 7 13 10 12 5 14 11 13 6 17 8 11 2 1 3 3 1 2 2 6 4 13 8 6 9 8 13 24 5 24 14 11 8 7 22 20 7 15 6 11 16 14 7 6 5 2 3 3 15 5 3 1

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_40606098_40607271
seq2: B6Ng01-286E15.b_46_1208 (reverse)

seq1  GTCTGTCT-ACGTAATCACACAAGCATCAATCAAGTCTTATTTAGGGTCT  49
      |||||| | |||||||||| ||||||||| ||| ||  ||||   |||||
seq2  GTCTGTTTCACGTAATCAC-CAAGCATCATTCAGGTTCTATT--AGGTCT  47

seq1  ATGACCACTTGAATAC-AGTGCTCTGGTTATATTGTAAGGTGTAGAAGGA  98
      |||||  |||||  || ||||||| |||||||||||||||||||||| ||
seq2  ATGACACCTTGATAACAAGTGCTC-GGTTATATTGTAAGGTGTAGAA-GA  95

seq1  ACAAGCAAGGGGTGTACCACAGTGAGATACCTGGCCGGGAGATGTTTTCT  148
      |||||||| ||||||| ||||||||||||||||||||||||||  |||||
seq2  ACAAGCAA-GGGTGTAACACAGTGAGATACCTGGCCGGGAGATTGTTTCT  144

seq1  CTTTTGGTATCTATGGGGACCTGTCAGAGGAAGGCTTGGAGAGGGGGTAT  198
      | |||||||||||| ||||||||||||||  | ||||||||| |||||||
seq2  C-TTTGGTATCTAT-GGGACCTGTCAGAG--AAGCTTGGAGA-GGGGTAT  189

seq1  TGTGTTGGTGAGCTGTGGAGATCACTTGTCTGTGGAGAGTACTGAGTCTT  248
      |||||| ||||||||||||||||||||||||||||||||||||||||| |
seq2  TGTGTT-GTGAGCTGTGGAGATCACTTGTCTGTGGAGAGTACTGAGTC-T  237

seq1  TCTCTCCCTACTTCTCACTCATGTCTGTGTTTACCTCCCATGTTTAGGTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCCTACTTCTCACTCATGTCTGTGTTTACCTCCCATGTTTAGGTT  287

seq1  TGACTCAAGTATTGGGCCCCTCCTCTTCTCTGACCAGTTCCTGCAGTTCT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTCAAGTATTGGGCCCCTCCTCTTCTCTGACCAGTTCCTGCAGTTCT  337

seq1  CTACCCACCTGCCAAGTGCTAATGTATATGGTCTGGGTGAACATGTGCAC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCCACCTGCCAAGTGCTAATGTATATGGTCTGGGTGAACATGTGCAC  387

seq1  CAGCAGTACCGACACAATATGAATTGGAAGACCTGGCCCATGTTTTCCAG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGTACCGACACAATATGAATTGGAAGACCTGGCCCATGTTTTCCAG  437

seq1  AGACACAACCCCGAATGAGGTAAGCTTTCAGGCTTCTTTCCTCTAATCTT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACACAACCCCGAATGAGGTAAGCTTTCAGGCTTCTTTCCTCTAATCTT  487

seq1  GAGGGTCACATAGTATAGTTGTTTAGAGTGAAAATCTAAACCGAGGCTGC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGTCACATAGTATAGTTGTTTAGAGTGAAAATCTAAACCGAGGCTGC  537

seq1  TTTGCTTTGGAGATCTTCTACTTATCAACTACATGATTCTGGGCAAGTTG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCTTTGGAGATCTTCTACTTATCAACTACATGATTCTGGGCAAGTTG  587

seq1  TTACCTCTTTGGGTGTTCAATTCCACATTGGGGTTCTACAATTGGGGTAA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCTCTTTGGGTGTTCAATTCCACATTGGGGTTCTACAATTGGGGTAA  637

seq1  TTACATATGCTTAGCTAGCTCATTCAGGAGTTGTGGAACTTAAAAGTGGG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACATATGCTTAGCTAGCTCATTCAGGAGTTGTGGAACTTAAAAGTGGG  687

seq1  GTTCATATACTCTCCTTGAAGCTGGTGATAAGGGTTAAATGACTAAAAGA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATATACTCTCCTTGAAGCTGGTGATAAGGGTTAAATGACTAAAAGA  737

seq1  TGTCAAGTATCTAGAAGACTAAATATCACAAAGAACATGCCCAATAACTT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAAGTATCTAGAAGACTAAATATCACAAAGAACATGCCCAATAACTT  787

seq1  TCCCATTGAAATCAAATTAGGAGCCCATGGTAAACTGTTTTTCAGGCAGC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCATTGAAATCAAATTAGGAGCCCATGGTAAACTGTTTTTCAGGCAGC  837

seq1  AGAGACAGCATCTTATTCTCACCCTGTCTCACTTAAACACATGCTTGCTG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACAGCATCTTATTCTCACCCTGTCTCACTTAAACACATGCTTGCTG  887

seq1  CCCAAATACCTGTCAGAAAAGTGGAAAATGTGTTTCGAGAGCAGTTTATG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAATACCTGTCAGAAAAGTGGAAAATGTGTTTCGAGAGCAGTTTATG  937

seq1  TGGAGCAGCTGGTGGTGATGACCTAATCTGGAGCTTTAGACCTTTGCTGG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCAGCTGGTGGTGATGACCTAATCTGGAGCTTTAGACCTTTGCTGG  987

seq1  CCAAGGGGTAAAGCATAAACAACACCAAGGAGCAGTGTGGACTTTCAGAC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGGGTAAAGCATAAACAACACCAAGGAGCAGTGTGGACTTTCAGAC  1037

seq1  CCTGTAGGGCTCTGTATGGTGGTTATTTATATTAAAACTCAATAGACCAC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTAGGGCTCTGTATGGTGGTTATTTATATTAAAACTCAATAGACCAC  1087

seq1  CTGCAGATAAGGTTAAGCTGGGGTCAGGAAGGCTTCTTTGAGAAGAGAGA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAGATAAGGTTAAGCTGGGGTCAGGAAGGCTTCTTTGAGAAGAGAGA  1137

seq1  TTCTATGAACTATGTTTTCAGAATTC  1174
      ||||||||||||||||||||||||||
seq2  TTCTATGAACTATGTTTTCAGAATTC  1163

seq1: chr6_40483081_40484224
seq2: B6Ng01-286E15.g_67_1198

seq1  GAATTCAAGGCTATTCTTTGAGCATTTTGTTAGTTGCTAATTGATGTAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGCTATTCTTTGAGCATTTTGTTAGTTGCTAATTGATGTAGG  50

seq1  ATGGACCAGTTCCAAGCCAGAGATGGGAGATGCAGAATGGTGGGATGCTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGACCAGTTCCAAGCCAGAGATGGGAGATGCAGAATGGTGGGATGCTA  100

seq1  TCTCTAAGCAAGTGAACCTAGGATGCATTTAAAAAGTAGCAAAGCAAGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTAAGCAAGTGAACCTAGGATGCATTTAAAAAGTAGCAAAGCAAGCC  150

seq1  AAAAGGCAGCACTCCTCCATGGTCTCTTCTTCAGTTCCAGTCCCCATGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGCAGCACTCCTCCATGGTCTCTTCTTCAGTTCCAGTCCCCATGTT  200

seq1  CCTGCCTTGAGCCCTCCTCTCCTGGCTTCCCTTAGTGATGGACTAGAAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCTTGAGCCCTCCTCTCCTGGCTTCCCTTAGTGATGGACTAGAAGC  250

seq1  TGGAAATGAAGACAAACCTTTTCCTCACTAAGATGCTTATGGTCATGGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAATGAAGACAAACCTTTTCCTCACTAAGATGCTTATGGTCATGGTG  300

seq1  TTTATCACAGCTATAGAAACCAGACTAAAACAAGTTGGGAAAAAACTATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATCACAGCTATAGAAACCAGACTAAAACAAGTTGGGAAAAAACTATA  350

seq1  GAAAAATGTCTCAAGAGAAAAATCCAAGTGATTTGTGTCATGATATATTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAATGTCTCAAGAGAAAAATCCAAGTGATTTGTGTCATGATATATTT  400

seq1  ATTAATAAGAGTTAAGGTATATGTGTTCTTTAGGAAGATGATAATTGTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATAAGAGTTAAGGTATATGTGTTCTTTAGGAAGATGATAATTGTTT  450

seq1  TGATTCCTTAAAAAGTTTTGAGAGTGGGGAAATAATTGGTCCCTTGGGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTCCTTAAAAAGTTTTGAGAGTGGGGAAATAATTGGTCCCTTGGGAA  500

seq1  TCAGGTAGAAAACTTTTCAGTGTTGAAAATATTTTCCTTATTTAATGGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGTAGAAAACTTTTCAGTGTTGAAAATATTTTCCTTATTTAATGGTT  550

seq1  CCTTCCATTTTGTTGAAAATGATGTCATTAATTTACACAATGAATAACAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCATTTTGTTGAAAATGATGTCATTAATTTACACAATGAATAACAT  600

seq1  TCTTGTGTTTTTATGATCATTCCATCAACAGTAGCTGTCTAGTTTGATCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGTGTTTTTATGATCATTCCATCAACAGTAGCTGTCTAGTTTGATCT  650

seq1  ATATCTTAGCTATAAACATGAACATGAAGGCATCTCTGTGGTGTGATGAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCTTAGCTATAAACATGAACATGAAGGCATCTCTGTGGTGTGATGAC  700

seq1  TTCATTTCCTTTGTTTTTATAGCACAGGGAGAGGAGAGAGGGCTGTGATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTTCCTTTGTTTTTATAGCACAGGGAGAGGAGAGAGGGCTGTGATT  750

seq1  GGGAGGTAATATGAATAAGACAATAAATTATGGCAAGTAAAAAAGGAGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGTAATATGAATAAGACAATAAATTATGGCAAGTAAAAAAGGAGGA  800

seq1  AAGGAGGGGAAGCTTTTATCAAGATGTGGGTAAATTAATTAATTAGTTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGGGGAAGCTTTTATCAAGATGTGGGTAAATTAATTAATTAGTTAG  850

seq1  TTAATTAATTAAAATTGGCAATAGTAAAACGTTTCTGGATGCCCAATGAC  900
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATT-ATTAAAATTGGCAATAGTAAAACGTTTCTGGATGCCCAATGAC  899

seq1  CAAACACTACTTTGAATTGAAATGTGTGACAAGCCTGAGGTGATGCTGGC  950
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CAAACACTACTTTGAATTGAAATGTGTGACAAGCCTGA-GTGATGCTGGC  948

seq1  CATGCTCAGACATACTGCCTCATGTGCTTTAGCCGCAGCCTCATGAATGC  1000
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CATGCTCAGACATACTGCCTCATGTGCTTTAGCCGCAG-CTCATGAATGC  997

seq1  AGATGTAAGTGAGACCTAGACTTTCACGAACCCTTTCATGGCATACCCCA  1050
      |||||| ||||||||||||||||||||||| |||||||| ||||| ||||
seq2  AGATGTTAGTGAGACCTAGACTTTCACGAA-CCTTTCAT-GCATA-CCCA  1044

seq1  TGATTTCCCCACCCCAGTTTACACTGGCATGCTCTAGAGCTCGGACTTTT  1100
      ||| |||||||||| || |||||||| ||||||||||||||||||  |||
seq2  TGA-TTCCCCACCCAAG-TTACACTGCCATGCTCTAGAGCTCGGAACTTT  1092

seq1  AGTGGTATGTTATTAAAGTTTATGGTGGCATGATGAGCCTTTCA  1144
      ||| | |||||  | ||||||||||| |||||||||  ||||||
seq2  AGT-GCATGTTTATTAAGTTTATGGT-GCATGATGA--CTTTCA  1132

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information