MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288K10
Chromosome	6 (Build37)
Map Location	82,386,769 - 82,523,583
singlet/doublet	doublet
Overlap gene	Tacr1
Upstream gene	LOC232143, 1700009C05Rik, AW146020, Mrpl19, Tmem166, EG622198
Downstream gene	Pole4, LOC100043412, Hk2, EG622318, Sema4f, D6Mm5e, Dok1, Loxl3, Htra2, Aup1, Dqx1, Tlx2, Pcgf1, Lbx2, A230058J24Rik, Mrpl53, Gcs1, Wbp1, Znhit4, Rtkn, Wdr54, 1700003E16Rik, Dctn1, C330016K18Rik, Mthfd2, Mobk1b, Bola3, D230004J03Rik, Dguok, Actg2, Stambp
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC232143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	1700009C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74220 MGI:1921470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	AW146020 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330361 MGI:2141656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56284 MGI:1926274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232146 MGI:2385247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622198 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622198 MGI:3648353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tacr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21336 MGI:98475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pole4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66979 MGI:1914229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 72 ESTs

name	Hk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15277 MGI:1315197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622318 MGI:3646278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Sema4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20355 MGI:1340055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Mm5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110958 MGI:1315200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13448 MGI:893587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16950 MGI:1337004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64704 MGI:1928676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aup1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11993 MGI:107789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dqx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93838 MGI:2136388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21909 MGI:1350935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcgf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69837 MGI:1917087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lbx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16815 MGI:1342288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230058J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243510 MGI:3045292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68499 MGI:1915749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57377 MGI:1929872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22377 MGI:104710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Znhit4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70020 MGI:1917270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtkn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20166 MGI:107371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75659 MGI:1922909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700003E16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 54 ESTs, 3 Proteins

name	Dctn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13191 MGI:107745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330016K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232156 MGI:2443220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins

name	Mthfd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17768 MGI:1338850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobk1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232157 MGI:2442631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bola3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78653 MGI:1925903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230004J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194388 MGI:2446229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 174 ESTs, 5 Proteins

name	Dguok (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27369 MGI:1351602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11468 MGI:104589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stambp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70527 MGI:1917777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700009C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377942 GeneID:74220 MGI:1921470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700009C05 gene transcript_id : XM_896866.2

name	AW146020 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608162 GeneID:330361 MGI:2141656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW146020 transcript_id : NM_177884.3

name	Mrpl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608147 GeneID:56284 MGI:1926274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L19 transcript_id : NM_026490.2

name	Tmem166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704145 GeneID:232146 MGI:2385247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 166 transcript_id : NM_145570.1

name	Tacr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892945 GeneID:21336 MGI:98475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin receptor 1 transcript_id : NM_009313.4

name	Pole4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350372 GeneID:66979 MGI:1914229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), epsilon 4 (p12 subunit) transcript_id : NM_025882.2

name	LOC100043412 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255266 GeneID:100043412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 72 ESTs product : hypothetical protein LOC100043412 transcript_id : XM_001479664.1

name	Hk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892208 GeneID:15277 MGI:1315197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase 2 transcript_id : NM_013820.2

name	Sema4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543684 GeneID:20355 MGI:1340055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain transcript_id : NM_011350.2

name	D6Mm5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14861845 GeneID:110958 MGI:1315200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 6, Miriam Meisler 5, expressed transcript_id : NM_033079.1

name	Dok1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981795 GeneID:13448 MGI:893587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 1 transcript_id : NM_010070.3

name	Loxl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802822 GeneID:16950 MGI:1337004
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 3 transcript_id : NM_013586.3

name	Htra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980990 GeneID:64704 MGI:1928676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 2 transcript_id : NM_019752.2

name	Aup1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403600 GeneID:11993 MGI:107789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ancient ubiquitous protein transcript_id : NM_007517.3

name	Dqx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130827 GeneID:93838 MGI:2136388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAQ RNA-dependent ATPase transcript_id : NM_033606.3

name	Tlx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70912930 GeneID:21909 MGI:1350935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia, homeobox 2 transcript_id : NM_009392.2

name	Pcgf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574110 GeneID:69837 MGI:1917087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 1 transcript_id : NM_197992.1

name	Lbx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130088 GeneID:16815 MGI:1342288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ladybird homeobox homolog 2 (Drosophila) transcript_id : NM_010692.3

name	A230058J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486906 GeneID:243510 MGI:3045292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230058J24 gene transcript_id : NM_001081266.1

name	Mrpl53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506706 GeneID:68499 MGI:1915749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L53 transcript_id : NM_026744.3

name	Gcs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981105 GeneID:57377 MGI:1929872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase 1 transcript_id : NM_020619.2

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046223 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_001083923.1

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046261 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_001083922.1

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046241 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_016757.2

name	Znhit4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963728 GeneID:70020 MGI:1917270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT type 4 transcript_id : NM_023547.1

name	Rtkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677826 GeneID:20166 MGI:107371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhotekin transcript_id : NM_009106.1

name	Rtkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281637 GeneID:20166 MGI:107371
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhotekin transcript_id : NM_133641.1

name	Wdr54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963826 GeneID:75659 MGI:1922909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 54 transcript_id : NM_023790.1

name	1700003E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377952 GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 3 Proteins product : RIKEN cDNA 1700003E16 gene, transcript variant 3 transcript_id : XM_897806.2

name	1700003E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377953 GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 2 Proteins product : RIKEN cDNA 1700003E16 gene, transcript variant 2 transcript_id : XM_887968.2

name	Dctn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601016 GeneID:13191 MGI:107745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 1 transcript_id : NM_007835.2

name	C330016K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255274 GeneID:232156 MGI:2443220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : RIKEN cDNA C330016K18 gene, transcript variant 3 transcript_id : XM_888058.3

name	Mthfd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678951 GeneID:17768 MGI:1338850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase transcript_id : NM_008638.1

name	Mobk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704147 GeneID:232157 MGI:2442631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 1B (yeast) transcript_id : NM_145571.1

name	Bola3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374066 GeneID:78653 MGI:1925903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bolA-like 3 (E. coli) transcript_id : NM_175277.3

name	D230004J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377951 GeneID:194388 MGI:2446229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 174 ESTs, 5 Proteins product : RIKEN cDNA D230004J03 gene transcript_id : XM_886913.2

name	Dguok (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304998 GeneID:27369 MGI:1351602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyguanosine kinase transcript_id : NM_013764.1

name	Actg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752951 GeneID:11468 MGI:104589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, gamma 2, smooth muscle, enteric transcript_id : NM_009610.1

name	Stambp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17941276 GeneID:70527 MGI:1917777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Stam binding protein transcript_id : NM_024239.1

name	1700009C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029284 GeneID:74220 MGI:1921470
definition	codon_start : 1 product : hypothetical protein LOC74220 protein_id : XP_901959.1

name	AW146020 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608163 CCDS:CCDS20260.1 GeneID:330361 MGI:2141656
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330361 protein_id : NP_808552.2

name	Mrpl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385976 GeneID:56284 MGI:1926274
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L15 product : mitochondrial ribosomal protein L19 protein_id : NP_080766.1

name	Tmem166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704146 CCDS:CCDS20261.1 GeneID:232146 MGI:2385247
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC232146 protein_id : NP_663545.1

name	Tacr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543840 CCDS:CCDS20262.1 GeneID:21336 MGI:98475
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048265 - response to pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : NK1 receptor; neurokinin receptor 1; substance p receptor product : tachykinin receptor 1 protein_id : NP_033339.2

name	Pole4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385366 GeneID:66979 MGI:1914229
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : DNA polymerase epsilon subunit 4 protein_id : NP_080158.1

name	LOC100043412 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255267 GeneID:100043412
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479714.1

name	Hk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305143 CCDS:CCDS20263.1 GeneID:15277 MGI:1315197
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046835 - carbohydrate phosphorylation [Evidence IMP]; GO:0006006 - glucose metabolism [Evidence IMP]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : hexokinase 2 protein_id : NP_038848.1

name	Sema4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543685 CCDS:CCDS20264.1 GeneID:20355 MGI:1340055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0000299 - integral to membrane of membrane fraction [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030517 - negative regulation of axon extension [Evidence ISS]; GO:0007399 - nervous system development [Evidence IEA]; GO:0031290 - retinal ganglion cell axon guidance [Evidence ISS] codon_start : 1 exception : mismatches in translation note : Sema W product : sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain protein_id : NP_035480.2

name	D6Mm5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14861846 GeneID:110958 MGI:1315200
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC110958 protein_id : NP_149070.1

name	Dok1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981796 CCDS:CCDS20265.1 GeneID:13448 MGI:893587
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005158 - insulin receptor binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005066 - transmembrane receptor protein tyrosine kinase signaling protein activity [Evidence IPI] GO_process : GO:0000165 - MAPKKK cascade [Evidence TAS]; GO:0007243 - protein kinase cascade [Evidence IPI]; GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IPI] codon_start : 1 exception : mismatches in translation note : downstream of tyrosine kinase 1 product : docking protein 1 protein_id : NP_034200.3

name	Loxl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543127 CCDS:CCDS20266.1 GeneID:16950 MGI:1337004
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 note : lysyl oxidase-like 2 product : lysyl oxidase-like 3 protein_id : NP_038614.2

name	Htra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980991 CCDS:CCDS20267.1 GeneID:64704 MGI:1928676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005758 - mitochondrial intermembrane space [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007628 - adult walking behavior [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence IMP]; GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0048666 - neuron development [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0040014 - regulation of body size [Evidence IMP] codon_start : 1 exception : mismatches in translation note : serine protease OMI; motor neuron degeneration 2 product : protease, serine, 25 protein_id : NP_062726.2

name	Aup1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90403601 GeneID:11993 MGI:107789
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : ancient ubiquitous protein protein_id : NP_031543.2

name	Dqx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424112 CCDS:CCDS20268.1 GeneID:93838 MGI:2136388
definition	GO_function : GO:0016887 - ATPase activity [Evidence ISS] codon_start : 1 product : DEAQ RNA-dependent ATPase protein_id : NP_291084.1

name	Tlx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678367 CCDS:CCDS20269.1 GeneID:21909 MGI:1350935
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050774 - negative regulation of dendrite morphogenesis [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : enteric neuron homeobox; homeo box 11-like 1 product : T-cell leukemia, homeobox 2 protein_id : NP_033418.1

name	Pcgf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574111 CCDS:CCDS20270.1 GeneID:69837 MGI:1917087
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : nervous system polycomb 1 product : polycomb group ring finger 1 protein_id : NP_932109.1

name	Lbx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754512 CCDS:CCDS20271.1 GeneID:16815 MGI:1342288
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : lady bird-like homeobox 2 homolog product : ladybird homeobox homolog 2 protein_id : NP_034822.1

name	A230058J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486907 GeneID:243510 MGI:3045292
definition	codon_start : 1 product : hypothetical protein LOC243510 protein_id : NP_001074735.1

name	Mrpl53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313040 CCDS:CCDS20272.1 GeneID:68499 MGI:1915749
definition	codon_start : 1 product : mitochondrial ribosomal protein L53 protein_id : NP_081020.1

name	Gcs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981106 CCDS:CCDS20273.1 GeneID:57377 MGI:1929872
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glucosidase I product : glucosidase 1 protein_id : NP_065644.2

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046224 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : WW domain binding protein 1 isoform 3 protein_id : NP_001077392.1

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046262 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : WW domain binding protein 1 isoform 2 protein_id : NP_001077391.1

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046242 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : WW domain binding protein 1 isoform 1 protein_id : NP_058037.2

name	Znhit4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963729 GeneID:70020 MGI:1917270
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : high mobility group AT-hook 1-like 4 product : PAP-1 binding protein protein_id : NP_076036.1

name	Rtkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677827 CCDS:CCDS20274.1 GeneID:20166 MGI:107371
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence IDA]; GO:0005095 - GTPase inhibitor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045767 - regulation of anti-apoptosis [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation function : binds to p21rho and inhibits its GTPase activity note : isoform 1 is encoded by transcript variant 1 product : rhotekin isoform 1 protein_id : NP_033132.1

name	Rtkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281638 CCDS:CCDS20274.1 GeneID:20166 MGI:107371
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence IDA]; GO:0005095 - GTPase inhibitor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045767 - regulation of anti-apoptosis [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3 product : rhotekin isoform 3 protein_id : NP_598396.1

name	Wdr54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963827 CCDS:CCDS20275.1 GeneID:75659 MGI:1922909
definition	codon_start : 1 product : D3Mm3e protein protein_id : NP_076279.1

name	1700003E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029296 GeneID:71837 MGI:1919087
definition	codon_start : 1 product : hypothetical protein LOC71837 isoform 3 protein_id : XP_902899.1

name	1700003E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029294 GeneID:71837 MGI:1919087
definition	codon_start : 1 product : hypothetical protein LOC71837 isoform 2 protein_id : XP_893061.1

name	Dctn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601017 GeneID:13191 MGI:107745
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : dynactin 1, retrograde axonal transport product : dynactin 1 protein_id : NP_031861.2

name	C330016K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255275 GeneID:232156 MGI:2443220
definition	codon_start : 1 product : similar to electrogenic sodium bicarbonate cotransporter NBC4c isoform 3 protein_id : XP_893151.3

name	Mthfd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678952 CCDS:CCDS20277.1 GeneID:17768 MGI:1338850
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004477 - methenyltetrahydrofolate cyclohydrolase activity [Evidence IEA]; GO:0004487 - methylenetetrahydrofolate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0004488 - methylenetetrahydrofolate dehydrogenase (NADP+) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009396 - folic acid and derivative biosynthesis [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 product : methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase protein_id : NP_032664.1

name	Mobk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704148 GeneID:232157 MGI:2442631
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : Mob4B protein protein_id : NP_663546.1

name	Bola3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424938 CCDS:CCDS20278.1 GeneID:78653 MGI:1925903
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : bolA-like 3 protein_id : NP_780486.1

name	D230004J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029316 GeneID:194388 MGI:2446229
definition	codon_start : 1 product : hypothetical protein LOC194388 protein_id : XP_892006.1

name	Dguok (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304999 CCDS:CCDS20279.1 GeneID:27369 MGI:1351602
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004138 - deoxyguanosine kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation function : nucleoside metabolism product : deoxyguanosine kinase protein_id : NP_038792.1

name	Actg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752952 GeneID:11468 MGI:104589
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : actin, gamma 2, smooth muscle, enteric protein_id : NP_033740.1

name	Stambp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17941277 CCDS:CCDS20280.1 GeneID:70527 MGI:1917777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : associated molecule with the SH3 domain of STAM product : Stam binding protein protein_id : NP_077201.1

name	EG622198 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622198
definition	number : 1 pseudo : _no_value

name	EG622318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622318
definition	number : 2 pseudo : _no_value

name	EG622318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622318
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:125079
definition	standard_name : MHAa21b5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:124151
definition	standard_name : 35.MMHAP64FLD5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123874
definition	standard_name : 29.MMHAP75FRB11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179398
definition	standard_name : AW146020

name	(CDS detail)
type	STS
link
xref	UniSTS:167469
definition	standard_name : RH126592

name	(CDS detail)
type	STS
link
xref	UniSTS:130754
definition	standard_name : D6Mit210

name	(CDS detail)
type	STS
link
xref	UniSTS:130687
definition	standard_name : D6Mit144

name	(CDS detail)
type	STS
link
xref	UniSTS:130938
definition	standard_name : D6Mit386

name	(CDS detail)
type	STS
link
xref	UniSTS:220607
definition	standard_name : RH138520

name	(CDS detail)
type	STS
link
xref	UniSTS:121920
definition	standard_name : D4MGH17

name	(CDS detail)
type	STS
link
xref	UniSTS:480302
definition	standard_name : Tacr1

name	(CDS detail)
type	STS
link
xref	UniSTS:207981
definition	standard_name : RH127103

name	(CDS detail)
type	STS
link
xref	UniSTS:130670
definition	standard_name : D6Mit129

name	(CDS detail)
type	STS
link
xref	UniSTS:130671
definition	standard_name : D6Mit129.1

name	(CDS detail)
type	STS
link
xref	UniSTS:179399
definition	standard_name : AI642394

name	(CDS detail)
type	STS
link
xref	UniSTS:235473
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130709
definition	standard_name : D6Mit164

name	(CDS detail)
type	STS
link
xref	UniSTS:260414
definition	standard_name : D6UmiJ20

name	(CDS detail)
type	STS
link
xref	UniSTS:130830
definition	standard_name : D6Mit283

name	(CDS detail)
type	STS
link
xref	UniSTS:142637
definition	standard_name : D6Umi10

name	(CDS detail)
type	STS
link
xref	UniSTS:163393
definition	standard_name : AB022316

name	(CDS detail)
type	STS
link
xref	UniSTS:260416
definition	standard_name : D6UmiJ23

name	(CDS detail)
type	STS
link
xref	UniSTS:144393
definition	standard_name : Sema4f

name	(CDS detail)
type	STS
link
xref	UniSTS:260409
definition	standard_name : D6UmiJ16

name	(CDS detail)
type	STS
link
xref	UniSTS:130730
definition	standard_name : D6Mit189

name	(CDS detail)
type	STS
link
xref	UniSTS:123225
definition	standard_name : 14.MMHAP63FRE8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:260411
definition	standard_name : D6UmiJ18

name	(CDS detail)
type	STS
link
xref	UniSTS:142638
definition	standard_name : D6Umi1a

name	(CDS detail)
type	STS
link
xref	UniSTS:260412
definition	standard_name : D6UmiJ19

name	(CDS detail)
type	STS
link
xref	UniSTS:185673
definition	standard_name : AW557123

name	(CDS detail)
type	STS
link
xref	UniSTS:231082
definition	standard_name : MARC_4349-4350:991938479:1

name	(CDS detail)
type	STS
link
xref	UniSTS:260419
definition	standard_name : D6UmiJ26

name	(CDS detail)
type	STS
link
xref	UniSTS:161004
definition	standard_name : RH124140

name	(CDS detail)
type	STS
link
xref	UniSTS:179401
definition	standard_name : AI481710

name	(CDS detail)
type	STS
link
xref	UniSTS:161788
definition	standard_name : RH124966

name	(CDS detail)
type	STS
link
xref	UniSTS:142639
definition	standard_name : D6Umi2

name	(CDS detail)
type	STS
link
xref	UniSTS:260417
definition	standard_name : D6UmiJ24

name	(CDS detail)
type	STS
link
xref	UniSTS:492892
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130972
definition	standard_name : D6Mit70

name	(CDS detail)
type	STS
link
xref	UniSTS:164327
definition	standard_name : AU024121

name	(CDS detail)
type	STS
link
xref	UniSTS:260421
definition	standard_name : D6UmiJ4

name	(CDS detail)
type	STS
link
xref	UniSTS:260422
definition	standard_name : D6UmiJ5

name	(CDS detail)
type	STS
link
xref	UniSTS:209909
definition	standard_name : RH135911

name	(CDS detail)
type	STS
link
xref	UniSTS:210015
definition	standard_name : RH136019

name	(CDS detail)
type	STS
link
xref	UniSTS:260420
definition	standard_name : D6UmiJ27

name	(CDS detail)
type	STS
link
xref	UniSTS:260423
definition	standard_name : D6UmiJ9

name	(CDS detail)
type	STS
link
xref	UniSTS:260406
definition	standard_name : D6UmiJ11

name	(CDS detail)
type	STS
link
xref	UniSTS:144363
definition	standard_name : Rtkn

name	(CDS detail)
type	STS
link
xref	UniSTS:163392
definition	standard_name : U54638

name	(CDS detail)
type	STS
link
xref	UniSTS:164328
definition	standard_name : AU041756

name	(CDS detail)
type	STS
link
xref	UniSTS:142640
definition	standard_name : D6Umi3

name	(CDS detail)
type	STS
link
xref	UniSTS:162241
definition	standard_name : RH125419

name	(CDS detail)
type	STS
link
xref	UniSTS:142641
definition	standard_name : D6Umi4

name	(CDS detail)
type	STS
link
xref	UniSTS:124588
definition	standard_name : 45.MMHAP68FLG6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130755
definition	standard_name : D6Mit211

name	(CDS detail)
type	STS
link
xref	UniSTS:130756
definition	standard_name : D6Mit211.2

name	(CDS detail)
type	STS
link
xref	UniSTS:130913
definition	standard_name : D6Mit360.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130912
definition	standard_name : D6Mit360

name	(CDS detail)
type	STS
link
xref	UniSTS:270671
definition	standard_name : PMC133862P1

name	(CDS detail)
type	STS
link
xref	UniSTS:159524
definition	standard_name : M63445

name	(CDS detail)
type	STS
link
xref	UniSTS:179403
definition	standard_name : AW558851

name	(CDS detail)
type	STS
link
xref	UniSTS:260407
definition	standard_name : D6UmiJ14

name	(CDS detail)
type	STS
link
xref	UniSTS:235474
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:260408
definition	standard_name : D6UmiJ15

name	(CDS detail)
type	STS
link
xref	UniSTS:260413
definition	standard_name : D6UmiJ2

name	(CDS detail)
type	STS
link
xref	UniSTS:130669
definition	standard_name : D6Mit128

name	(CDS detail)
type	STS
link
xref	UniSTS:142583
definition	standard_name : D6Mit1006

name	(CDS detail)
type	STS
link
xref	UniSTS:163394
definition	standard_name : AJ133750

name	(CDS detail)
type	STS
link
xref	UniSTS:271939
definition	standard_name : PMC20377P1

name	(CDS detail)
type	STS
link
xref	UniSTS:260405
definition	standard_name : D6UmiJ1

name	(CDS detail)
type	STS
link
xref	UniSTS:179406
definition	standard_name : AW107289

name	(CDS detail)
type	STS
link
xref	UniSTS:220745
definition	standard_name : RH138658

name	(CDS detail)
type	STS
link
xref	UniSTS:161209
definition	standard_name : RH124387

name	(CDS detail)
type	STS
link
xref	UniSTS:270053
definition	standard_name : PMC100023P1

name	LOC232143 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255220 GeneID:232143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to High mobility group box 2 pseudo : _no_value transcript_id : XR_034125.1

clone name	MSMg01-486O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-213O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344C20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-165O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-270C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-072D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288K10.b	B6Ng01-288K10.g
ACC	GA086261	GA086262
length	869	852
definition	B6Ng01-288K10.b	B6Ng01-288K10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(82,522,718 - 82,523,583)	(82,386,769 - 82,387,616)
sequence	gaattcagattgtcagtcttggtggtaggtggctttacctgtggagctcc ctgctttgttccattcttttgttttattttgttttgtttttgttttttga gacagggtttctctgcatggccctggctgtcctggaactcactctgtaga ccaggctgacctcgaactcagaaatctgcctgcctctgcctcccaagtgc tgggattaaaggcttgttccatcctttatagtgcgtttcaggagcctcgg agaatgggtatcttcagaaccatggcacaggcttttcaaagcctggtccc agaatcagaatcagttctatggtttgtcagggtttggaggtccctttcgg agcctgctgactcacactgtccagggaatctacactagtctacgctcaca gagtgtggcgtgacctctggccacagccacagtagacctcactctctgct tctcagaaaattgaaacgatcatctggggaggcttttctgacagtttgct gtggcgccaccttcaccctttgtttcctctgctccctctgtgctctgcac agcagcatcctgctttcccagaaacgcttggccaagagttcttgtctttc cctcctggaaactcaactgctgtctctagagtcatccccacaggcaagga agcaagttcaagacttggccagcaaatgcaaattaaaatcccttccttgg ttctatactccctttaagttactgtgctattttcaaataattctctattt ttctttttttctttattgctaagatatggccttgctattattgctctggt tgacctagaaatcacaatatcgaccaggctgacctcaaaactcacagaat ttgagagtccacagagagc	gaattctggtcagtcaataaagattcccaaactgatttcctaaaatccag tgcttatttggctcttccacgtgccctgtccctgatggtaggcatgagaa cagaatctgcagttaataatgaaactgcaccagcccatagccatgtagtt tcccaaggagacatcttaatgagatccctagttactataaaatttaccag cggggagaattggtgtagttaaagtagcaaaaggaatggttttcccctgc tgtggattcagggtgtgcaggggggccttttatctaactatccttccacc gtcaccccttagtatctacagacatgggacgggattagcatgatatgatt ccattggatgccaacacacagatgccatttttgggaccccaacaggggat tctggtggaacattcagagaaggaattgcagaagtctaagagggtcgggc attctagtagctgatgcaagaaagtgccctggtttgggagcagtcttctg gagtgggcgaggactggaggcaagggaaggcatgcttccttcctgaagtg cagtgttgtaattagcccacaccagggagagagagtaggcacccacactt tgtttagcacttcaggctgtctcctcaggggagactgcctactgtgatgt gagggtgggggtggaacagggtgaaatggctcattacagaacagttcttt acatgggagtgggaagctctaatgtctgcttttctctctgcttaagaatg tggttgatcgttaccaagtcaaagggatgttctgtttccggtgaagaaga gagtatgatgaatagtctctcaaggttaatagagtagaataattgttgca ta
quality values	Open. Hide. 58 31 27 32 58 27 22 43 41 27 62 47 39 38 37 47 62 62 62 62 62 47 62 62 47 56 62 62 54 54 62 43 18 30 24 21 18 22 25 28 28 28 33 46 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 48 33 34 48 59 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 45 42 33 56 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 59 59 59 62 50 59 59 59 62 59 59 59 62 62 62 62 59 62 59 62 62 62 62 51 59 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 56 56 62 59 56 59 59 62 62 62 56 62 62 62 62 62 59 59 46 50 59 49 62 62 62 62 62 59 59 62 62 62 62 59 62 59 51 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 51 51 59 56 56 62 59 62 62 59 59 59 62 54 59 59 59 59 62 62 62 62 62 56 59 51 45 56 59 51 59 51 51 44 59 43 59 59 59 62 59 59 59 59 59 59 59 59 62 59 59 59 62 62 62 62 51 62 62 59 59 44 59 59 59 59 59 62 56 62 59 59 62 59 62 62 62 62 62 56 62 51 62 56 56 62 62 62 62 62 54 62 56 38 44 56 62 54 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 56 51 56 62 56 62 62 54 42 62 62 62 62 62 62 54 62 62 62 56 62 62 62 62 62 62 56 62 56 62 62 62 62 62 47 41 62 56 62 62 50 62 62 62 56 62 62 62 62 62 62 62 62 52 49 42 46 62 52 52 47 39 52 43 47 46 38 33 41 42 52 42 54 46 54 52 62 62 54 54 54 58 54 52 54 48 45 54 47 58 58 54 46 30 45 52 41 46 52 47 54 42 52 52 54 52 52 58 58 58 58 58 52 54 49 58 37 36 41 33 46 42 58 54 47 39 52 30 34 52 46 39 54 52 54 47 52 50 51 31 32 20 15 42 32 19 34 41 32 35 50 41 41 42 46 47 39 50 50 46 58 50 47 51 39 26 58 58 40 58 51 52 54 53 50 58 58 51 58 53 42 51 45 27 54 49 45 53 53 49 35 49 50 51 52 50 49 51 36 24 22 18 9 16 32 53 32 47 34 58 46 53 40 49 53 35 54 44 33 50 23 43 23 35 53 39 36 32 39 47 58 40 58 39 50 50 50 32 51 35 51 54 53 58 58 53 42 32 58 33 34 42 34 53 25 49 33 39 18 58 40 38 32 44 42 47 54 20 32 41 41 39 42 41 13 15 13 27 49 39 42 33 39 53 34 26 53 53 18 8 54 35 26 32 39 54 45 39 39 31 32 31 14 21 42 40 42 26 34 33 18 23 16 35 30 29 30 41 15 32 28 17 6 17 30 7 15 29 37 29 31 37 32 33 9 9 36 49 34 42 33 53 29 40 53 53 19 34 20 11 21 16 30 31 19	Open. Hide. 62 47 31 47 62 62 62 62 47 56 42 42 35 16 21 11 14 21 20 20 25 22 35 24 32 46 51 59 44 62 62 62 62 62 59 59 62 62 62 62 37 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 56 46 46 59 56 48 56 56 54 46 59 51 54 62 62 62 62 62 59 59 59 62 59 59 59 59 62 62 62 62 62 56 62 62 62 62 62 59 59 54 62 62 62 59 62 62 62 62 59 62 59 59 56 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 51 59 62 56 62 62 59 59 59 62 62 62 62 62 62 62 62 62 42 33 54 59 62 62 62 54 49 62 62 59 62 62 62 56 54 62 62 62 62 62 62 56 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 49 59 59 59 59 50 43 62 62 59 62 62 59 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 47 54 62 62 62 62 51 62 62 62 62 62 62 62 62 54 54 62 62 30 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 54 62 52 62 62 62 62 62 42 52 62 62 54 54 54 47 62 38 38 54 52 62 62 62 52 46 28 36 40 62 40 58 54 58 46 52 52 37 36 52 49 54 58 58 54 58 52 58 58 58 54 54 54 58 39 52 46 54 52 54 58 54 41 46 30 58 52 52 54 47 58 54 58 58 58 54 42 35 49 41 41 58 28 36 36 48 58 49 58 54 42 54 58 58 52 54 35 46 50 43 51 58 30 58 50 52 52 58 58 58 51 52 58 47 49 34 32 52 42 58 33 18 42 51 58 49 28 29 15 9 18 23 31 46 40 32 32 32 21 26 24 35 22 12 12 28 33 44 29 24 23 28 25 39 46 49 28 32 15 31 50 42 27 15 10 16 50 49 51 40 39 37 31 30 12 52 40 50 38 17 23 26 13 26 31 29 32 36 19 31 34 46 34 18 58 33 58 15 19 46 25 51 36 35 28 15 30 22 52 35 45 41 42 30 39 13 50 34 39 34 28 28 9 32 27 21 24 11 13 18 18 24 31 28 21 15 27 13 15 12 16 25 21 33 23 11 31 28 18 44 16 44 29 17 10 18 32 30 32 20 37 14 15 26 24 27 41 45 39 25 33 18 15 16 8 33 9 18 9 6 15 11 36 22 19 12 8 11 9 11 15 16 31 8 21 14 28 33 26 13 17 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_82522718_82523583
seq2: B6Ng01-288K10.b_45_913 (reverse)

seq1  GCTCTCTGTGGACTCTCAAATTCTGTGAG-TTTGAGGTCAGCCTGGTCGA  49
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GCTCTCTGTGGACTCTCAAATTCTGTGAGTTTTGAGGTCAGCCTGGTCGA  50

seq1  TATTGTGATTTCTAGGTCAACCAGAGCAATAATAGCAAGGCCATATCTTA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTGATTTCTAGGTCAACCAGAGCAATAATAGCAAGGCCATATCTTA  100

seq1  GCAATAAAGAAAAAAAG-AAAATAGAGAATTATTTGAAAATAGCACAGTA  148
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  GCAATAAAGAAAAAAAGAAAAATAGAGAATTATTTGAAAATAGCACAGTA  150

seq1  AC-TAAAGGGAGTATAGAACCAAGGAAGGGATTTTAATTTGCATTTGCTG  197
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAAGGGAGTATAGAACCAAGGAAGGGATTTTAATTTGCATTTGCTG  200

seq1  GCCAAGTCTTGAACTTGCTTCCTTGCCTGTGGGGATGACTCTAGAGACAG  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAAGTCTTGAACTTGCTTCCTTGCCTGTGGGGATGACTCTAGAGACAG  250

seq1  CAGTTGAGTTTCCAGGAGGGAAAGACAAGAACTCTTGGCCAAGCGTTTCT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTGAGTTTCCAGGAGGGAAAGACAAGAACTCTTGGCCAAGCGTTTCT  300

seq1  GGGAAAGCAGGATGCTGCTGTGCAGAGCACAGAGGGAGCAGAGGAAACAA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAAGCAGGATGCTGCTGTGCAGAGCACAGAGGGAGCAGAGGAAACAA  350

seq1  AGGGTGAAGGTGGCGCCACAGCAAACTGTCAGAAAAGCCTCCCCAGATGA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGAAGGTGGCGCCACAGCAAACTGTCAGAAAAGCCTCCCCAGATGA  400

seq1  TCGTTTCAATTTTCTGAGAAGCAGAGAGTGAGGTCTACTGTGGCTGTGGC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTTCAATTTTCTGAGAAGCAGAGAGTGAGGTCTACTGTGGCTGTGGC  450

seq1  CAGAGGTCACGCCACACTCTGTGAGCGTAGACTAGTGTAGATTCCCTGGA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGTCACGCCACACTCTGTGAGCGTAGACTAGTGTAGATTCCCTGGA  500

seq1  CAGTGTGAGTCAGCAGGCTCCGAAAGGGACCTCCAAACCCTGACAAACCA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTGAGTCAGCAGGCTCCGAAAGGGACCTCCAAACCCTGACAAACCA  550

seq1  TAGAACTGATTCTGATTCTGGGACCAGGCTTTGAAAAGCCTGTGCCATGG  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAACTGATTCTGATTCTGGGACCAGGCTTTGAAAAGCCTGTGCCATGG  600

seq1  TTCTGAAGATACCCATTCTCCGAGGCTCCTGAAACGCACTATAAAGGATG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAAGATACCCATTCTCCGAGGCTCCTGAAACGCACTATAAAGGATG  650

seq1  GAACAAGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAAGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCAGATTTCT  700

seq1  GAGTTCGAGGTCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCGAGGTCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGC  750

seq1  CATGCAGAGAAACCCTGTCTCAAAAAACAAAAACAAAACAAAATAAAACA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCAGAGAAACCCTGTCTCAAAAAACAAAAACAAAACAAAATAAAACA  800

seq1  AAAGAATGGAACAAAGCAGGGAGCTCCACAGGTAAAGCCACCTACCACCA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAATGGAACAAAGCAGGGAGCTCCACAGGTAAAGCCACCTACCACCA  850

seq1  AGACTGACAATCTGAATTC  866
      |||||||||||||||||||
seq2  AGACTGACAATCTGAATTC  869

seq1: chr6_82386769_82387616
seq2: B6Ng01-288K10.g_71_922

seq1  GAATTCTGGTCAGTCAATAAAGATTCCCAAACTGATTTCCTAAAATCCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGGTCAGTCAATAAAGATTCCCAAACTGATTTCCTAAAATCCAG  50

seq1  TGCTTATTTGGCTCTTCCACGTGCCCTGTCCCTGATGGTAGGCATGAGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTATTTGGCTCTTCCACGTGCCCTGTCCCTGATGGTAGGCATGAGAA  100

seq1  CAGAATCTGCAGTTAATAATGAAACTGCACCAGCCCATAGCCATGTAGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATCTGCAGTTAATAATGAAACTGCACCAGCCCATAGCCATGTAGTT  150

seq1  TCCCAAGGAGACATCTTAATGAGATCCCTAGTTACTATAAAATTTACCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAAGGAGACATCTTAATGAGATCCCTAGTTACTATAAAATTTACCAG  200

seq1  CGGGGAGAATTGGTGTAGTTAAAGTAGCAAAAGGAATGGTTTTCCCCTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGAGAATTGGTGTAGTTAAAGTAGCAAAAGGAATGGTTTTCCCCTGC  250

seq1  TGTGGATTCAGGGTGTGCAGGGGGGCCTTTTATCTAACTATCCTTCCACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGATTCAGGGTGTGCAGGGGGGCCTTTTATCTAACTATCCTTCCACC  300

seq1  GTCACCCCTTAGTATCTACAGACATGGGACGGGATTAGCATGATATGATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACCCCTTAGTATCTACAGACATGGGACGGGATTAGCATGATATGATT  350

seq1  CCATTGGATGCCAACACACAGATGCCATTTTTGGGACCCCAACAGGGGAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTGGATGCCAACACACAGATGCCATTTTTGGGACCCCAACAGGGGAT  400

seq1  TCTGGTGGAACATTCAGAGAAGGAATTGCAGAAGTCTAAGAGGGTCGGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGTGGAACATTCAGAGAAGGAATTGCAGAAGTCTAAGAGGGTCGGGC  450

seq1  ATTCTAGTAGCTGATGCAAGAAAGTGCCCTGGTTTGGGAGCAGTCTTCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTAGTAGCTGATGCAAGAAAGTGCCCTGGTTTGGGAGCAGTCTTCTG  500

seq1  GAGTGGGCGAGGACTGGAGGCAAGGGAAGGCATGCTTCCTTCCTGAAGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGGCGAGGACTGGAGGCAAGGGAAGGCATGCTTCCTTCCTGAAGTG  550

seq1  CAGTGTTGTAATTAGCCCACACCAGGGAGAGAGAGTAGGCACCCACACTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTTGTAATTAGCCCACACCAGGGAGAGAGAGTAGGCACCCACACTT  600

seq1  TGTTTAGCACTTCAGGCTGTCTCCTCAGGGGAGACTGCCTACTGTGATGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTAGCACTTCAGGCTGTCTCCTCAGGGGAGACTGCCTACTGTGATGT  650

seq1  GAGGGTGGGGGTGGAACAGGGTGAAATGGCTCATTACAGAACAGTTCTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGTGGGGGTGGAACAGGGTGAAATGGCTCATTACAGAACAGTTCTTT  700

seq1  ACATGGGAGTGGGAAGCTCTAATGTCTGC-TTTCTCTCTGCTTAAGAATG  749
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  ACATGGGAGTGGGAAGCTCTAATGTCTGCTTTTCTCTCTGCTTAAGAATG  750

seq1  TGGTTTGATCGTTACCAAGTC-AAGGGATGTTCTGTTT-CGGTGAAGAAG  797
      ||| ||||||||||||||||| |||||||||||||||| |||||||||||
seq2  TGG-TTGATCGTTACCAAGTCAAAGGGATGTTCTGTTTCCGGTGAAGAAG  799

seq1  AGAGTATGATGAATAGTCTCTCAA-GTTAAAAGAGTAG-ATAATTGTTGC  845
      |||||||||||||||||||||||| ||||| ||||||| |||||||||||
seq2  AGAGTATGATGAATAGTCTCTCAAGGTTAATAGAGTAGAATAATTGTTGC  849

seq1  ATA  848
      |||
seq2  ATA  852

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information