MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-296C10
Chromosome	6 (Build37)
Map Location	38,467,535 - 38,589,492
singlet/doublet	doublet
Overlap gene	3110054G05Rik, 1110001J03Rik, LOC621228, Luc7l2, Klrg2
Upstream gene	Akr1d1, LOC665046, Ybx1-ps2, LOC100039636, LOC665102, Trim24, Svopl, Atp6v0a4, LOC100039657, D630002J15Rik, D630045J12Rik, LOC665125, Zc3hav1l, Zc3hav1, Rpl30-ps1, Ttc26, D130059P03Rik
Downstream gene	LOC665180, Hipk2, Tbxas1, 1700025N23Rik, Parp12, 4930599N23Rik, A630082K20Rik, Slc37a3, Rab19, Mkrn1, ENSMUSG00000068601, Dennd2a, Adck2, Ndufb2, Braf
Link	Open Mouse BAC browser

Click to get alignment info.

name	Akr1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208665 MGI:2384785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665046 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665046
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ybx1-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94283 MGI:2137671
definition	gene_synonym : Msy-3 note : Y box protein 1, pseudogene 2 pseudo : _no_value

name	LOC100039636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 666 ESTs, 13 Proteins

name	LOC665102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Trim24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21848 MGI:109275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svopl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320590 MGI:2444335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140494 MGI:2153480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039657 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	D630002J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77522 MGI:1924772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 1 Protein

name	D630045J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330286 MGI:2669829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 104 ESTs, 1 Protein

name	LOC665125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	Zc3hav1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209032 MGI:2443387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3hav1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78781 MGI:1926031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl30-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19947 MGI:1321399
definition	gene_synonym : RpL30-2 note : ribosomal protein L30, pseudogene 1 pseudo : _no_value

name	Ttc26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:264134 MGI:2444853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D130059P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320538 MGI:2444236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110054G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73239 MGI:1920489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	1110001J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66117 MGI:1913367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Luc7l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192196 MGI:2183260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74253 MGI:1921503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins

name	Hipk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15258 MGI:1314872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbxas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21391 MGI:98497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69986 MGI:1917236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Parp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243771 MGI:2143990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930599N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75379 MGI:1922629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	A630082K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338523 MGI:2443388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc37a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72144 MGI:1919394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19331 MGI:103292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mkrn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54484 MGI:1859353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000068601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621427 MGI:3642504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Dennd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209773 MGI:2444961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68198 MGI:1915448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Braf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109880 MGI:88190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akr1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703733 GeneID:208665 MGI:2384785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member D1 transcript_id : NM_145364.1

name	LOC100039636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255053 GeneID:100039636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 666 ESTs, 13 Proteins product : similar to vacuolar H(+)-ATPase transcript_id : XM_001473491.1

name	Trim24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94420997 GeneID:21848 MGI:109275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 24 transcript_id : NM_145076.3

name	Svopl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387964 GeneID:320590 MGI:2444335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SV2 related protein homolog (rat)-like transcript_id : NM_177200.3

name	Atp6v0a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371245 GeneID:140494 MGI:2153480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit A4 transcript_id : NM_080467.2

name	LOC100039657 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255055 GeneID:100039657
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100039657 transcript_id : XM_001473543.1

name	D630002J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377270 GeneID:77522 MGI:1924772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 1 Protein product : RIKEN cDNA D630002J15 gene transcript_id : XM_885435.2

name	D630045J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377271 GeneID:330286 MGI:2669829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 104 ESTs, 1 Protein product : RIKEN cDNA D630045J12 gene transcript_id : XM_974678.1

name	Zc3hav1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803007 GeneID:209032 MGI:2443387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH-type, antiviral 1-like transcript_id : NM_172467.2

name	Zc3hav1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383007 GeneID:78781 MGI:1926031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type, antiviral 1 transcript_id : NM_028864.2

name	Ttc26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734470 GeneID:264134 MGI:2444853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 26 transcript_id : NM_153600.2

name	D130059P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560745 GeneID:320538 MGI:2444236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130059P03 gene transcript_id : NM_177185.3

name	3110054G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255049 GeneID:73239 MGI:1920489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 3110054G05 gene transcript_id : XM_001472971.1

name	1110001J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801827 GeneID:66117 MGI:1913367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110001J03 gene transcript_id : NM_025363.3

name	Luc7l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373166 GeneID:192196 MGI:2183260
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LUC7-like 2 (S. cerevisiae) transcript_id : NM_138680.1

name	Klrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964697 GeneID:74253 MGI:1921503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily G, member 2 transcript_id : NM_001033171.2

name	LOC665180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255062 GeneID:665180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins product : similar to CD69-like protein transcript_id : XM_975103.2

name	Hipk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754197 GeneID:15258 MGI:1314872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain interacting protein kinase 2 transcript_id : NM_010433.1

name	Tbxas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750132 GeneID:21391 MGI:98497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thromboxane A synthase 1, platelet transcript_id : NM_011539.3

name	1700025N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377273 GeneID:69986 MGI:1917236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025N23 gene transcript_id : XM_978377.1

name	Parp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802986 GeneID:243771 MGI:2143990
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 12 transcript_id : NM_172893.2

name	A630082K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374237 GeneID:338523 MGI:2443388
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630082K20 gene transcript_id : NM_001033430.2

name	Slc37a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71143149 GeneID:72144 MGI:1919394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 37 (glycerol-3-phosphate transporter), member 3 transcript_id : NM_028123.2

name	Rab19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859607 GeneID:19331 MGI:103292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB19, member RAS oncogene family transcript_id : NM_011226.1

name	Mkrn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055273 GeneID:54484 MGI:1859353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : makorin, ring finger protein, 1 transcript_id : NM_018810.1

name	ENSMUSG00000068601 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255064 GeneID:621427 MGI:3642504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, ENSMUSG00000068601 transcript_id : XM_001474075.1

name	Dennd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366403 GeneID:209773 MGI:2444961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 2A transcript_id : NM_172477.2

name	Adck2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803492 GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 2 transcript_id : NM_178873.3

name	Ndufb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386282 GeneID:68198 MGI:1915448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 transcript_id : NM_026612.2

name	Braf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801723 GeneID:109880 MGI:88190
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Braf transforming gene transcript_id : NM_139294.4

name	Akr1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703734 CCDS:CCDS20007.1 GeneID:208665 MGI:2384785
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0047568 - 3-oxo-5-beta-steroid 4-dehydrogenase activity [Evidence IEA] [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006699 - bile acid biosynthesis [Evidence ISS]; GO:0030573 - bile acid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 product : aldo-keto reductase family 1, member D1 protein_id : NP_663339.1

name	LOC100039636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255054 GeneID:100039636
definition	codon_start : 1 product : similar to vacuolar H(+)-ATPase protein_id : XP_001473541.1

name	Trim24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94420998 CCDS:CCDS20008.1 GeneID:21848 MGI:109275
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016922 - ligand-dependent nuclear receptor binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : transcriptional intermediary factor 1, alpha product : tripartite motif protein 24 protein_id : NP_659542.3

name	Svopl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893221 CCDS:CCDS20009.1 GeneID:320590 MGI:2444335
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SV2 related protein homolog (rat)-like protein_id : NP_796174.1

name	Atp6v0a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371246 CCDS:CCDS20010.1 GeneID:140494 MGI:2153480
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005903 - brush border [Evidence IDA]; GO:0016471 - hydrogen-translocating V-type ATPase complex [Evidence IPI] [Evidence ISS] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS] [Evidence IPI] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence IPI] [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATPase, H+ transporting, lysosomal (vacuolar proton pump) noncatalytic accessory protein 1B; V-ATPase alpha 4; vacuolar proton translocating ATPase 100 kDa a4 subunit product : ATPase, H+ transporting, lysosomal V0 subunit A isoform 4 protein_id : NP_536715.2

name	LOC100039657 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255056 GeneID:100039657
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473593.1

name	D630002J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82900837 GeneID:77522 MGI:1924772
definition	codon_start : 1 product : hypothetical protein LOC77522 protein_id : XP_890528.1

name	D630045J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377272 GeneID:330286 MGI:2669829
definition	codon_start : 1 product : hypothetical protein LOC330286 protein_id : XP_979772.1

name	Zc3hav1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369640 CCDS:CCDS20011.1 GeneID:209032 MGI:2443387
definition	codon_start : 1 product : zinc finger CCCH-type, antiviral 1-like protein_id : NP_766055.1

name	Zc3hav1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746169 CCDS:CCDS20012.1 GeneID:78781 MGI:1926031
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009615 - response to virus [Evidence ISS]; GO:0019081 - viral protein biosynthesis [Evidence ISS] codon_start : 1 product : zinc finger CCCH type, antiviral 1 protein_id : NP_083140.1

name	Ttc26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734471 GeneID:264134 MGI:2444853
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 26 protein_id : NP_705828.2

name	D130059P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560746 GeneID:320538 MGI:2444236
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC320538 protein_id : NP_796159.2

name	3110054G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255050 GeneID:73239 MGI:1920489
definition	codon_start : 1 product : hypothetical protein LOC73239 protein_id : XP_001473021.1

name	1110001J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384728 CCDS:CCDS20014.1 GeneID:66117 MGI:1913367
definition	codon_start : 1 product : hypothetical protein LOC66117 protein_id : NP_079639.1

name	Luc7l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373167 CCDS:CCDS20015.1 GeneID:192196 MGI:2183260
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : probably involved in pre-mRNA-splicing note : CGI-74-like SR-rich product : LUC7-like 2 protein_id : NP_619621.1

name	Klrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964698 CCDS:CCDS20016.1 GeneID:74253 MGI:1921503
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily G, member 2 protein_id : NP_001028343.2

name	LOC665180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255063 GeneID:665180
definition	codon_start : 1 product : similar to CD69-like protein protein_id : XP_980197.2

name	Hipk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754198 CCDS:CCDS20017.1 GeneID:15258 MGI:1314872
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0016605 - PML body [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence TAS] [Evidence ISS] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0046790 - virion binding [Evidence ISS] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence IGI]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IGI] [Evidence IDA] [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0046330 - positive regulation of JNK cascade [Evidence ISS]; GO:0030511 - positive regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007224 - smoothened signaling pathway [Evidence IGI]; GO:0006350 - transcription [Evidence IEA]; GO:0019048 - virus-host interaction [Evidence ISS] codon_start : 1 exception : mismatches in translation function : phosphorylates homeodomain transcription factors product : homeodomain interacting protein kinase 2 protein_id : NP_034563.1

name	Tbxas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750133 CCDS:CCDS20018.1 GeneID:21391 MGI:98497
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0004796 - thromboxane-A synthase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA] codon_start : 1 product : thromboxane A synthase 1, platelet protein_id : NP_035669.3

name	1700025N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377274 GeneID:69986 MGI:1917236
definition	codon_start : 1 product : hypothetical protein LOC69986 protein_id : XP_983471.1

name	Parp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370366 CCDS:CCDS20019.1 GeneID:243771 MGI:2143990
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 1 product : poly (ADP-ribose) polymerase family, member 12 protein_id : NP_766481.1

name	A630082K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701945 GeneID:338523 MGI:2443388
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC338523 protein_id : NP_001028602.1

name	Slc37a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71143150 CCDS:CCDS20020.1 GeneID:72144 MGI:1919394
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 37 (glycerol-3-phosphate transporter), member 3 protein_id : NP_082399.2

name	Rab19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859608 CCDS:CCDS20021.1 GeneID:19331 MGI:103292
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB19, member RAS oncogene family protein_id : NP_035356.1

name	Mkrn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055274 CCDS:CCDS20022.1 GeneID:54484 MGI:1859353
definition	GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : makorin, ring finger protein, 1 protein_id : NP_061280.1

name	ENSMUSG00000068601 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255065 GeneID:621427 MGI:3642504
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474125.1

name	Dennd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369652 CCDS:CCDS20023.1 GeneID:209773 MGI:2444961
definition	codon_start : 1 product : DENN/MADD domain containing 2A protein_id : NP_766065.1

name	Adck2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725855 CCDS:CCDS20024.1 GeneID:57869 MGI:1889336
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 2 protein_id : NP_849204.1

name	Ndufb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386096 CCDS:CCDS20025.1 GeneID:68198 MGI:1915448
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 protein_id : NP_080888.1

name	Braf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199767 GeneID:109880 MGI:88190
definition	EC_number : 2.7.11.1 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : B-Raf proto-oncogene serine/threonine-protein kinase (p94) product : Braf transforming protein_id : NP_647455.2

name	LOC665046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665046
definition	number : 1 pseudo : _no_value

name	LOC665102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665102
definition	number : 2 pseudo : _no_value

name	LOC665102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665102
definition	number : 1 pseudo : _no_value

name	LOC621228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621228
definition	number : 4 pseudo : _no_value

name	LOC621228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621228
definition	number : 3 pseudo : _no_value

name	LOC621228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621228
definition	number : 2 pseudo : _no_value

name	LOC621228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621228
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:235412
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142580
definition	standard_name : D6Jpk1

name	(CDS detail)
type	STS
link
xref	UniSTS:216279
definition	standard_name : RH132996

name	(CDS detail)
type	STS
link
xref	UniSTS:235413
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491879
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167470
definition	standard_name : D6Ertd160e

name	(CDS detail)
type	STS
link
xref	UniSTS:123056
definition	standard_name : 10.MMHAP8FRD7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130848
definition	standard_name : D6Mit298

name	(CDS detail)
type	STS
link
xref	UniSTS:124671
definition	standard_name : 47.MMHAP91FLH5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125502
definition	standard_name : N28141

name	(CDS detail)
type	STS
link
xref	UniSTS:161882
definition	standard_name : RH125060

name	(CDS detail)
type	STS
link
xref	UniSTS:142576
definition	standard_name : D6Bwg1452e

name	(CDS detail)
type	STS
link
xref	UniSTS:445466
definition	standard_name : stSG602774

name	(CDS detail)
type	STS
link
xref	UniSTS:141463
definition	standard_name : D0Nds34

name	(CDS detail)
type	STS
link
xref	UniSTS:235415
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235416
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130699
definition	standard_name : D6Mit154

name	(CDS detail)
type	STS
link
xref	UniSTS:166621
definition	standard_name : Kifl1-ps

name	(CDS detail)
type	STS
link
xref	UniSTS:161309
definition	standard_name : RH124487

name	(CDS detail)
type	STS
link
xref	UniSTS:235417
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:209701
definition	standard_name : RH126578

name	(CDS detail)
type	STS
link
xref	UniSTS:235414
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130992
definition	standard_name : D6Mit91

name	(CDS detail)
type	STS
link
xref	UniSTS:179363
definition	standard_name : AI414054

name	(CDS detail)
type	STS
link
xref	UniSTS:179361
definition	standard_name : AW122724

name	(CDS detail)
type	STS
link
xref	UniSTS:76007
definition	standard_name : GDB:4585413

name	(CDS detail)
type	STS
link
xref	UniSTS:116605
definition	standard_name : D6Mit80

name	(CDS detail)
type	STS
link
xref	UniSTS:123860
definition	standard_name : 29.MMHAP37FRB11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125130
definition	standard_name : MHAa30g3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130770
definition	standard_name : D6Mit222

name	(CDS detail)
type	STS
link
xref	UniSTS:116604
definition	standard_name : D6Mit90

name	(CDS detail)
type	STS
link
xref	UniSTS:144551
definition	standard_name : Tbxas1

name	(CDS detail)
type	STS
link
xref	UniSTS:235418
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179362
definition	standard_name : L18868

name	(CDS detail)
type	STS
link
xref	UniSTS:124878
definition	standard_name : L18868

name	(CDS detail)
type	STS
link
xref	UniSTS:162580
definition	standard_name : RH125836

name	(CDS detail)
type	STS
link
xref	UniSTS:142577
definition	standard_name : D6Bwg16e

name	(CDS detail)
type	STS
link
xref	UniSTS:161108
definition	standard_name : RH124286

name	(CDS detail)
type	STS
link
xref	UniSTS:235426
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:185661
definition	standard_name : BB041802

name	(CDS detail)
type	STS
link
xref	UniSTS:179364
definition	standard_name : AU044904

name	(CDS detail)
type	STS
link
xref	UniSTS:130980
definition	standard_name : D6Mit78

name	(CDS detail)
type	STS
link
xref	UniSTS:129448
definition	standard_name : D2Mit529

name	(CDS detail)
type	STS
link
xref	UniSTS:142654
definition	standard_name : D6Wsu1e

name	(CDS detail)
type	STS
link
xref	UniSTS:165012
definition	standard_name : Mkrn1

name	(CDS detail)
type	STS
link
xref	UniSTS:235424
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130717
definition	standard_name : D6Mit173

name	(CDS detail)
type	STS
link
xref	UniSTS:161491
definition	standard_name : RH124669

name	(CDS detail)
type	STS
link
xref	UniSTS:185663
definition	standard_name : BB006057

name	(CDS detail)
type	STS
link
xref	UniSTS:167497
definition	standard_name : AU015031

name	(CDS detail)
type	STS
link
xref	UniSTS:219348
definition	standard_name : RH137260

name	(CDS detail)
type	STS
link
xref	UniSTS:159496
definition	standard_name : AI447469

name	(CDS detail)
type	STS
link
xref	UniSTS:235421
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235419
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235425
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235420
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:141185
definition	standard_name : Braf

name	(CDS detail)
type	STS
link
xref	UniSTS:130698
definition	standard_name : D6Mit153

name	LOC665125 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255047 GeneID:665125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to Rps16 protein pseudo : _no_value transcript_id : XR_030916.1

name	4930599N23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94377277 GeneID:75379 MGI:1922629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 4930599N23 gene transcript_id : XR_002348.1

clone name	MSMg01-498K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345H06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445L02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-493N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099A12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-509D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342N22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-296C10.b	B6Ng01-296C10.g
ACC	GA091834	GA091835
length	427	931
definition	B6Ng01-296C10.b	B6Ng01-296C10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(38,589,060 - 38,589,492)	(38,467,535 - 38,468,632)
sequence	caggacagccagggctacacagagaaaccctgtctcaaaaaaaagaaaag aaaagaaaagaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaagg aaaggaaaggaaaggaaaggaaaggaaaggaaaggaaagaaaaaagaaaa gaaaaattctggcctggcagtggtggtgctcgcctttaatctcagcactt gggaggcagacaggggcaggcagatttctgatttctaggccagcctggtc tacagagtgagttccaggacagccaggactacacagagaaaccctgtctc gaataaaaggaaaggtagaaagagcagaggtttaaaatgcactatggaca tggactgagggtgggacagttctgttaagataaggttgatggtgacaaag ggcgctatggattatgcctggtgtgag	gaattcaatttgtagagtggttttaaactcgaatacaaatatctgtggtc tgttcattcatttgaatggtttttgccttctgtgttctctacttttctct gtagaggtcttacagactatcatttcagtacccaatggttgtcattttca caaaaagatcctagtctctattttctgtacttttgttacttgtgttaaag aatgtaattagccaagcagggtcgcacactcctgtatccttcaaactcaa atagctgaggcagaaggctcttgactttgagctcaactttgtccactgag tgagactgtcaaatgtcaaagcaggagcttgggtggggaggaggacagag aacacgctaaggggaggagggaggcgggagtagtattaggggctggagaa tggcttagcacttaggatggcttgctcagctcttcttgaggatacaggtt tgattaccagcatccacatggcaactgggagccatttgccactccaggcc caggagatttattgccctcttctagactctcttgggtgccaggcaagcac atggcatggagacatacatgtaggtaaaacacatatacacttgaaataat catcatcatgaattaaaatcctttatttttgttcttaaagtagcattaga tttgaggatgacaggatagaattcttttaatgggaagataaatacggaat aaggagaaaagacttggaacacatggaattttagctgaagcactgactgg gctgttgcctcgtgctctcttctctcaacctcctgatgttgactccatgc tacctttgcccagctttgctctctccctcccctccacctctcttcttctc cagctttcctcatctgaacacttgcagatgtgcaacaagacgcttttatt taccgctcgcctcccccccccccccccacca
quality values	Open. Hide. 27 14 51 54 25 42 31 54 54 32 31 54 54 49 49 49 51 54 45 58 46 51 36 32 38 58 44 51 58 24 25 22 17 26 58 46 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 49 18 41 47 38 31 31 30 28 39 58 58 58 58 49 49 58 58 58 58 58 58 41 36 49 58 58 58 58 58 49 49 49 58 49 41 49 58 58 49 49 58 49 58 58 41 38 58 58 58 58 58 58 58 58 49 49 58 49 58 58 49 33 35 25 20 22 32 29 21 41 27 52 52 47 49 58 49 28 21 27 12 20 16 16 19 21 22 12 12 12 5 12 16 34 24 20 19 12 15 27 17 16 20 41 39 41 24 41 32 27 31 12 28 25 32 19 22 13 27 35 34 25 35 23 10 25 13 22 19 19 25 13 9 19 9 19 12 11 28 40 27 22 19 47 42 33 19 17 13 33 17 13 9 33 28 24 28 17 22 19 24 21 19 18 23 25 27 29 23 23 17 17 24 24 27 27 26 27 24 28 24 19 21 17 12 29 19 22 26 29 19 27 26 20 22 17 15 18 29 20 9 10 21 19 14 11 10 26 30 32 25 21 9 18 15 6 20 9 24 23 16 15 22 16 14 26 15 16 13 19 10 18 20 5 9 18 12 18 14 30 20 19 13 16 25 11 25 13 18 15 22 22 31 19 15 10 9 20 16 22 23 17 22 13 13 16 17 40 28 12 6 12 29 9 4 9 19 20 15 9 24 27 13 14 16 19 16 9 10 15 16 13 16 23 14 10 18 10 15 15 21 16 21 25 15 21 22 27 12 10 9 10 15 12 24 18 12 13 23 25 18 16 15 16 11 16 13 21 24 9 19 15 6 11 12 13 9 9 9 9 11 6 6 15 4 9 9 9 6 10 14 9 15 11 9 12 6	Open. Hide. 62 47 51 47 62 44 44 62 62 62 34 34 25 19 13 27 28 28 38 28 38 49 49 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 38 38 56 59 62 54 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 54 54 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 51 62 62 62 62 62 62 59 62 59 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 59 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 56 47 62 56 62 62 62 56 62 54 54 47 54 62 62 56 47 62 62 62 62 62 62 62 62 62 62 47 54 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 47 62 56 62 62 62 62 62 62 62 62 62 43 54 56 56 56 56 56 56 56 62 62 62 54 47 62 62 62 62 62 62 54 62 62 62 62 62 46 62 43 36 44 52 54 62 52 43 38 38 39 42 42 43 52 50 52 54 52 46 54 58 58 58 54 52 54 54 58 54 52 54 48 54 54 58 52 49 58 43 43 54 41 49 54 58 52 42 30 58 54 54 49 52 46 54 52 52 42 54 42 54 54 58 58 49 54 41 58 54 50 58 54 28 52 52 58 42 42 54 37 45 33 26 42 50 37 54 47 49 49 51 41 58 47 50 30 45 46 41 46 46 42 35 46 32 32 26 14 44 18 41 52 32 42 58 50 32 39 52 50 32 41 50 28 50 21 30 23 58 39 51 32 50 32 51 39 30 26 49 26 50 52 16 23 18 58 51 35 51 58 18 21 49 53 45 52 50 35 42 50 51 51 31 32 42 19 58 28 25 37 28 39 19 13 33 39 35 39 34 37 39 37 41 39 45 28 29 40 24 47 51 49 24 27 16 35 32 25 34 32 14 12 42 31 37 20 21 20 33 33 37 37 35 21 41 25 37 26 31 22 40 34 39 25 22 23 28 24 14 16 31 28 11 13 33 25 42 41 33 27 41 52 45 53 22 42 15 24 42 47 32 47 24 19 12 9 22 9 9 25 32 18 30 19 34 47 51 26 31 26 51 34 37 42 31 37 21 38 18 21 25 18 11 7 28 13 41 20 31 28 33 24 15 18 17 23 27 25 9 9 9 9 27 31 30 46 46 27 42 48 46 13 25 41 9 15 23 41 31 10 9 43 31 27 24 25 18 25 22 25 31 30 31 31 28 31 20 11 15 10 10 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_38589060_38589492
seq2: B6Ng01-296C10.b_49_481 (reverse)

seq1  CTCACACCTGGCATAATCCCTAGCGCCCTTTGTCACCATCAACCTTCTCT  50
      |||||||| |||||||||| |||||||||||||||||||||||||| |||
seq2  CTCACACCAGGCATAATCCATAGCGCCCTTTGTCACCATCAACCTTATCT  50

seq1  TAACAGAACTGTCCCACCCTCAGTCCATGTCCCTAGTGCATTTTAAACCT  100
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TAACAGAACTGTCCCACCCTCAGTCCATGTCCATAGTGCATTTTAAACCT  100

seq1  CTGCTCTTTCTACCTTTCCTTTTTTTCGAGACAGGGTTTCTCTGTGTAGT  150
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  CTGCTCTTTCTACCTTTCCTTTTATTCGAGACAGGGTTTCTCTGTGTAGT  150

seq1  CCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTAGAAATCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTAGAAATCAG  200

seq1  AAATCTGCCTGCCCCTGTCTGCCTCCCAAGTGCTGAGATTAAAGGCGAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTGCCTGCCCCTGTCTGCCTCCCAAGTGCTGAGATTAAAGGCGAGC  250

seq1  ACCACCACTGCCAGGCTAGAATTTTTCTTTTCTTTTTTCTTTCCTTTCCT  300
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  ACCACCACTGCCAGGCCAGAATTTTTCTTTTCTTTTTTCTTTCCTTTCCT  300

seq1  TTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCT  350

seq1  TTCCTTTCCTTTCCTTTCTTTTCTTTTCTTTTCTTTTTTTTGAGACAGGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTCCTTTCCTTTCTTTTCTTTTCTTTTCTTTTTTTTGAGACAGGG  400

seq1  TTTCTCTGTGTAGCCCTGGCTGTCCTGGAATTC  433
      |||||||||||||||||||||||||||||||||
seq2  TTTCTCTGTGTAGCCCTGGCTGTCCTGGAATTC  433

seq1: chr6_38467535_38468632
seq2: B6Ng01-296C10.g_69_999

seq1  GAATTCAATTTGTAGAGTGGTTTTAAACTCGAATACAAATATCTGTGGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATTTGTAGAGTGGTTTTAAACTCGAATACAAATATCTGTGGTC  50

seq1  TGTTCATTCATTTGAATGGTTTTTGCCTTCTGTGTTCTCTACTTTTCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCATTCATTTGAATGGTTTTTGCCTTCTGTGTTCTCTACTTTTCTCT  100

seq1  GTAGAGGTCTTACAGACTATCATTTCAGTACCCAATGGTTGTCATTTTCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAGGTCTTACAGACTATCATTTCAGTACCCAATGGTTGTCATTTTCA  150

seq1  CAAAAAGATCCTAGTCTCTATTTTCTGTACTTTTGTTACTTGTGTTAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAAGATCCTAGTCTCTATTTTCTGTACTTTTGTTACTTGTGTTAAAG  200

seq1  AATGTAATTAGCCAAGCAGGGTCGCACACTCCTGTATCCTTCAAACTCAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAATTAGCCAAGCAGGGTCGCACACTCCTGTATCCTTCAAACTCAA  250

seq1  ATAGCTGAGGCAGAAGGCTCTTGACTTTGAGCTCAACTTTGTCCACTGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCTGAGGCAGAAGGCTCTTGACTTTGAGCTCAACTTTGTCCACTGAG  300

seq1  TGAGACTGTCAAATGTCAAAGCAGGAGCTTGGGTGGGGAGGAGGACAGAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGACTGTCAAATGTCAAAGCAGGAGCTTGGGTGGGGAGGAGGACAGAG  350

seq1  AACACGCTAAGGGGAGGAGGGAGGCGGGAGTAGTATTAGGGGCTGGAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACGCTAAGGGGAGGAGGGAGGCGGGAGTAGTATTAGGGGCTGGAGAA  400

seq1  TGGCTTAGCACTTAGGATGGCTTGCTCAGCTCTTCTTGAGGATACAGGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTTAGCACTTAGGATGGCTTGCTCAGCTCTTCTTGAGGATACAGGTT  450

seq1  TGATTACCAGCATCCACATGGCAACTGGGAGCCATTTGCCACTCCAGGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTACCAGCATCCACATGGCAACTGGGAGCCATTTGCCACTCCAGGCC  500

seq1  CAGGAGATTTATTGCCCTCTTCTAGACTCTCTTGGGTGCCAGGCAAGCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGATTTATTGCCCTCTTCTAGACTCTCTTGGGTGCCAGGCAAGCAC  550

seq1  ATGGCATGGAGACATACATGTAGGTAAAACACATATACACTTGAAATAAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCATGGAGACATACATGTAGGTAAAACACATATACACTTGAAATAAT  600

seq1  CATCATCATGAATTAAAATCCTTTATTTTTGTTCTTAAAGTAGCATTAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATCATGAATTAAAATCCTTTATTTTTGTTCTTAAAGTAGCATTAGA  650

seq1  TTTGAGGATGACAGGATAGAATTCTTTTAATGGGAAGATAAATACGGAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGGATGACAGGATAGAATTCTTTTAATGGGAAGATAAATACGGAAT  700

seq1  AAGGAG-AAAGACTTGGAACACATGGAATTTAAGCTGAAGCACTGACTGG  749
      |||||| |||||||||||||||||||||||| ||||||||||||||||||
seq2  AAGGAGAAAAGACTTGGAACACATGGAATTTTAGCTGAAGCACTGACTGG  750

seq1  GCTGTTGCCTCGTGCTCTCTTCTCTCAACCTCCTGATGTTGACTCCATGC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTTGCCTCGTGCTCTCTTCTCTCAACCTCCTGATGTTGACTCCATGC  800

seq1  TACC-TTGCCCAGCTTTGCTCTCTCCCTCCCCTCCACCTCTC-TCTTCTC  847
      |||| ||||||||||||||||||||||||||||||||||||| |||||||
seq2  TACCTTTGCCCAGCTTTGCTCTCTCCCTCCCCTCCACCTCTCTTCTTCTC  850

seq1  CAGCTTTCCTCATCTGAACAC-TGCAGATGTGCAACAAGACGC-TTTATT  895
      ||||||||||||||||||||| ||||||||||||||||||||| ||||||
seq2  CAGCTTTCCTCATCTGAACACTTGCAGATGTGCAACAAGACGCTTTTATT  900

seq1  TACCGCTCGCCT--CCCCCCCCCCCCCACCACTTCTTTTCTGCTCTGCCA  943
      ||||||||||||  |||||||||||||||||                   
seq2  TACCGCTCGCCTCCCCCCCCCCCCCCCACCA-------------------  931

seq1  GATGGGGCCCAGACACTCCACAATGGAGCCACAGTGAGGCTTTGCTATAT  993
                                                        
seq2  --------------------------------------------------  931

seq1  ATTACTCAATTTCCCTCACTGCTATTTTGTGGCAGGATCTGGCCTTGAGC  1043
                                                        
seq2  --------------------------------------------------  931

seq1  AGAAAGTTCTCTTGATTCAGCTACCTAAGTGCTGGCTTGCAGGTTTGTAC  1093
                                                        
seq2  --------------------------------------------------  931

seq1  CACCA  1098
           
seq2  -----  931

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information