MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-317G21
Chromosome	6 (Build37)
Map Location	117,102,502 - 117,216,038
singlet/doublet	doublet
Overlap gene	Cxcl12, LOC213422
Upstream gene	LOC100043425, EG666634, EG666648, D6Wsu116e, Anubl1, March8, Alox5, LOC100043432, Olfr211, Olfr212, Olfr213, EG434080, Olfr214, Olfr215, Zfp422, Rassf4, 8430408G22Rik, C230095G01Rik, LOC100043439
Downstream gene	EG640142, LOC100043777, LOC621462, EG640370, EG621705, LOC100043779, Zfp637, Zfp239, 4933440N22Rik, Hnrpf, Fxyd4, LOC232338, Rasgef1a, Galnact2, Ret, 1700069P05Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043425 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG666634 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666634 MGI:3646499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 367 ESTs, 3 Proteins

name	EG666648 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666648 MGI:3643597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 566 ESTs, 8 Proteins

name	D6Wsu116e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28006 MGI:106463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anubl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67492 MGI:1914742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71779 MGI:1919029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alox5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11689 MGI:87999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr211 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258914 MGI:3030045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258019 MGI:3030046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258020 MGI:3030047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434080 MGI:3646594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 249 ESTs, 58 Proteins

name	Olfr214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258754 MGI:3030048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258438 MGI:3030049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp422 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67255 MGI:1914505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213391 MGI:2386853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430408G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213393 MGI:1918730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230095G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319776 MGI:2442707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043439 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Cxcl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20315 MGI:103556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC213422 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:213422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG640142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640142 MGI:3644618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043777 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC621462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG640370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640370 MGI:3645786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 19 ESTs

name	EG621705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621705 MGI:3645567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 4 Proteins

name	LOC100043779 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp637 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232337 MGI:2448537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp239 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22685 MGI:1306812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933440N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74471 MGI:1921721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	Hnrpf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98758 MGI:2138741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108017 MGI:1889005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC232338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232338
definition	note : Lasp1 pseudogene pseudo : _no_value

name	Rasgef1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70727 MGI:1917977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 4 Proteins

name	Galnact2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78752 MGI:1926002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ret (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19713 MGI:97902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700069P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73531 MGI:1920781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043425 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255270 GeneID:100043425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043425 transcript_id : XM_001480143.1

name	EG666634 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378040 GeneID:666634 MGI:3646499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 367 ESTs, 3 Proteins product : predicted gene, EG666634, transcript variant 1 transcript_id : XM_001000460.1

name	EG666648 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378044 GeneID:666648 MGI:3643597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 566 ESTs, 8 Proteins product : predicted gene, EG666648 transcript_id : XM_985182.1

name	D6Wsu116e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802662 GeneID:28006 MGI:106463
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 6, Wayne State University 116, expressed transcript_id : NM_026585.2

name	Anubl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486776 GeneID:67492 MGI:1914742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AN1, ubiquitin-like, homolog (Xenopus laevis) transcript_id : NM_001081317.1

name	March8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892872 GeneID:71779 MGI:1919029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 8 transcript_id : NM_027920.4

name	Alox5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686109 GeneID:11689 MGI:87999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 5-lipoxygenase transcript_id : NM_009662.2

name	Olfr211 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129064 GeneID:258914 MGI:3030045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 211 transcript_id : NM_146912.1

name	Olfr212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74271897 GeneID:258019 MGI:3030046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 212 transcript_id : NM_001011800.2

name	Olfr213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801367 GeneID:258020 MGI:3030047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 213 transcript_id : NM_001011801.1

name	EG434080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378048 GeneID:434080 MGI:3646594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 249 ESTs, 58 Proteins product : predicted gene, EG434080 transcript_id : XM_485817.4

name	Olfr214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129326 GeneID:258754 MGI:3030048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 214 transcript_id : NM_146759.1

name	Olfr215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239317 GeneID:258438 MGI:3030049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 215 transcript_id : NM_146446.1

name	Zfp422 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388585 GeneID:67255 MGI:1914505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 422 transcript_id : NM_026057.2

name	Rassf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254291 GeneID:213391 MGI:2386853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 4 transcript_id : NM_178045.3

name	8430408G22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122424 GeneID:213393 MGI:1918730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430408G22 gene transcript_id : NM_145980.1

name	C230095G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803540 GeneID:319776 MGI:2442707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230095G01 gene transcript_id : NM_178768.4

name	LOC100043439 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255272 GeneID:100043439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001480170.1

name	Cxcl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60279261 GeneID:20315 MGI:103556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 12 transcript_id : NM_001012477.1

name	Cxcl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60279260 GeneID:20315 MGI:103556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 12 transcript_id : NM_013655.3

name	Cxcl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60279259 GeneID:20315 MGI:103556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 12 transcript_id : NM_021704.2

name	EG640142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255276 GeneID:640142 MGI:3644618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG640142 transcript_id : XM_924578.3

name	LOC100043777 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255401 GeneID:100043777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to budding uninhibited by benzimidazoles 3 homolog transcript_id : XM_001480932.1

name	EG640370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255278 GeneID:640370 MGI:3645786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 19 ESTs product : predicted gene, EG640370 transcript_id : XM_001480196.1

name	EG621705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255403 GeneID:621705 MGI:3645567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 4 Proteins product : predicted gene, EG621705 transcript_id : XM_886102.3

name	LOC100043779 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255404 GeneID:100043779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043779 transcript_id : XM_001480941.1

name	Zfp637 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343306 GeneID:232337 MGI:2448537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 637 transcript_id : NM_177684.2

name	Zfp239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49087127 GeneID:22685 MGI:1306812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 239 transcript_id : NM_001001792.1

name	Zfp239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49087121 GeneID:22685 MGI:1306812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 239 transcript_id : NM_008616.2

name	4933440N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378052 GeneID:74471 MGI:1921721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : RIKEN cDNA 4933440N22 gene transcript_id : XM_986054.1

name	Hnrpf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527047 GeneID:98758 MGI:2138741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein F transcript_id : NM_133834.1

name	Fxyd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16258806 GeneID:108017 MGI:1889005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 4 transcript_id : NM_033648.1

name	Rasgef1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378055 GeneID:70727 MGI:1917977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 4 Proteins product : RasGEF domain family, member 1A transcript_id : XM_986257.1

name	Galnact2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861213 GeneID:78752 MGI:1926002
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chondroitin sulfate GalNAcT-2 transcript_id : NM_030165.3

name	Ret (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124256483 GeneID:19713 MGI:97902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ret proto-oncogene transcript_id : NM_009050.2

name	Ret (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124256486 GeneID:19713 MGI:97902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ret proto-oncogene transcript_id : NM_001080780.1

name	1700069P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255406 GeneID:73531 MGI:1920781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700069P05 gene transcript_id : XM_001480946.1

name	LOC100043425 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255271 GeneID:100043425
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480193.1

name	EG666634 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378041 GeneID:666634 MGI:3646499
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001000460.1

name	EG666648 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378045 GeneID:666648 MGI:3643597
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_990276.1

name	D6Wsu116e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27261816 CCDS:CCDS20450.1 GeneID:28006 MGI:106463
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004427 - inorganic diphosphatase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006796 - phosphate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC28006 protein_id : NP_080861.1

name	Anubl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486777 GeneID:67492 MGI:1914742
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : AN1, ubiquitin-like, homolog protein_id : NP_001074786.1

name	March8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229135 CCDS:CCDS20451.1 GeneID:71779 MGI:1919029
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : c-mir, cellular modulator of immune recognition product : membrane-associated ring finger (C3HC4) 8 protein_id : NP_082196.1

name	Alox5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526037 CCDS:CCDS20452.1 GeneID:11689 MGI:87999
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004051 - arachidonate 5-lipoxygenase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016165 - lipoxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IMP] codon_start : 1 product : arachidonate 5-lipoxygenase protein_id : NP_033792.1

name	Olfr211 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129065 CCDS:CCDS20453.1 GeneID:258914 MGI:3030045
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKN04-58127726-58128655; olfactory receptor MOR253-9 product : olfactory receptor 211 protein_id : NP_667123.1

name	Olfr212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801366 CCDS:CCDS20454.1 GeneID:258019 MGI:3030046
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKN04-58149882-58150865; olfactory receptor MOR119-4 product : olfactory receptor 212 protein_id : NP_001011800.1

name	Olfr213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801368 CCDS:CCDS20455.1 GeneID:258020 MGI:3030047
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKN04-58174409-58175392; olfactory receptor MOR119-3 product : olfactory receptor 213 protein_id : NP_001011801.1

name	EG434080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51717030 GeneID:434080 MGI:3646594
definition	codon_start : 1 product : similar to Chain C, Structure Of The Human Exon Junction Complex With A Trapped Dead-Box Helicase Bound To Rna protein_id : XP_485817.1

name	Olfr214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129327 CCDS:CCDS20457.1 GeneID:258754 MGI:3030048
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKN04-58190962-58191900; olfactory receptor MOR119-1 product : olfactory receptor 214 protein_id : NP_666970.1

name	Olfr215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239318 CCDS:CCDS20458.1 GeneID:258438 MGI:3030049
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKN04-58217732-58216800; olfactory receptor MOR119-2 product : olfactory receptor 215 protein_id : NP_666657.1

name	Zfp422 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076891 CCDS:CCDS20459.1 GeneID:67255 MGI:1914505
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042476 - odontogenesis [Evidence NAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Kruppel type zinc finger protein Krox26 product : zinc finger protein 422 protein_id : NP_080333.1

name	Rassf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254292 CCDS:CCDS20460.1 GeneID:213391 MGI:2386853
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ras association (RalGDS/AF-6) domain family 4 protein_id : NP_835146.2

name	8430408G22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122425 GeneID:213393 MGI:1918730
definition	codon_start : 1 note : fat-specific expressed product : RIKEN cDNA 8430408G22 protein_id : NP_666092.1

name	C230095G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982359 CCDS:CCDS20462.1 GeneID:319776 MGI:2442707
definition	codon_start : 1 product : hypothetical protein LOC319776 protein_id : NP_848883.2

name	LOC100043439 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255273 GeneID:100043439
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480220.1

name	Cxcl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305465 GeneID:20315 MGI:103556
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA] [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0007420 - brain development [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IEA]; GO:0007281 - germ cell development [Evidence IDA]; GO:0008354 - germ cell migration [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0008045 - motor axon guidance [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0030334 - regulation of cell migration [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform beta precursor is encoded by transcript variant 2; pre-B-cell growth-stimulating factor product : stromal cell derived factor 1 isoform beta precursor protein_id : NP_038683.1

name	Cxcl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60279262 CCDS:CCDS20463.1 GeneID:20315 MGI:103556
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA] [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0007420 - brain development [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IEA]; GO:0007281 - germ cell development [Evidence IDA]; GO:0008354 - germ cell migration [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0008045 - motor axon guidance [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0030334 - regulation of cell migration [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform gamma precursor is encoded by transcript variant 3; pre-B-cell growth-stimulating factor product : stromal cell derived factor 1 isoform gamma precursor protein_id : NP_001012495.1

name	Cxcl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025676 GeneID:20315 MGI:103556
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA] [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001667 - ameboidal cell migration [Evidence IMP]; GO:0007420 - brain development [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IEA]; GO:0007281 - germ cell development [Evidence IDA]; GO:0008354 - germ cell migration [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0008045 - motor axon guidance [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0030334 - regulation of cell migration [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform alpha precursor is encoded by transcript variant 1; pre-B-cell growth-stimulating factor product : stromal cell derived factor 1 isoform alpha precursor protein_id : NP_068350.1

name	EG640142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255277 GeneID:640142 MGI:3644618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_929671.3

name	LOC100043777 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255402 GeneID:100043777
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480982.1

name	EG640370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255279 GeneID:640370 MGI:3645786
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480246.1

name	EG621705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029604 GeneID:621705 MGI:3645567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891195.1

name	LOC100043779 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255405 GeneID:100043779
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480991.1

name	Zfp637 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244118 GeneID:232337 MGI:2448537
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 637 protein_id : NP_808352.1

name	Zfp239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49087128 CCDS:CCDS20466.1 GeneID:22685 MGI:1306812
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Kruppel zinc finger protein 2 product : zinc finger protein 239 protein_id : NP_001001792.1

name	Zfp239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49087122 CCDS:CCDS20466.1 GeneID:22685 MGI:1306812
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Kruppel zinc finger protein 2 product : zinc finger protein 239 protein_id : NP_032642.2

name	4933440N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378053 GeneID:74471 MGI:1921721
definition	codon_start : 1 product : hypothetical protein LOC74471 protein_id : XP_991148.1

name	Hnrpf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527048 CCDS:CCDS20467.1 GeneID:98758 MGI:2138741
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein F protein_id : NP_598595.1

name	Fxyd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16258807 CCDS:CCDS20468.1 GeneID:108017 MGI:1889005
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : channel inducing factor product : corticosteroid-induced protein protein_id : NP_387468.1

name	Rasgef1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378056 GeneID:70727 MGI:1917977
definition	codon_start : 1 product : RasGEF domain family, member 1A protein_id : XP_991351.1

name	Galnact2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560032 CCDS:CCDS20469.1 GeneID:78752 MGI:1926002
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047237 - glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030166 - proteoglycan biosynthesis [Evidence ISS] codon_start : 1 product : chondroitin sulfate GalNAcT-2 protein_id : NP_084441.3

name	Ret (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124256484 CCDS:CCDS20470.1 GeneID:19713 MGI:97902
definition	EC_number : 2.7.10.1 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence TAS] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0001838 - embryonic epithelial tube formation [Evidence IGI] [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0000165 - MAPKKK cascade [Evidence IGI]; GO:0009653 - morphogenesis [Evidence TAS]; GO:0007399 - nervous system development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 2 product : ret proto-oncogene isoform a protein_id : NP_033076.2

name	Ret (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124256487 GeneID:19713 MGI:97902
definition	EC_number : 2.7.10.1 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence TAS] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0001838 - embryonic epithelial tube formation [Evidence IGI] [Evidence IDA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0000165 - MAPKKK cascade [Evidence IGI]; GO:0009653 - morphogenesis [Evidence TAS]; GO:0007399 - nervous system development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 note : isoform c is encoded by transcript variant 4 product : ret proto-oncogene isoform c protein_id : NP_001074249.1

name	1700069P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255407 GeneID:73531 MGI:1920781
definition	codon_start : 1 product : hypothetical protein LOC73531 protein_id : XP_001480996.1

name	LOC100043432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043432
definition	number : 1 pseudo : _no_value

name	LOC100043432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043432
definition	number : 2 pseudo : _no_value

name	LOC213422 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:213422
definition	number : 1 pseudo : _no_value

name	LOC621462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621462
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130696
definition	standard_name : D6Mit150.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130695
definition	standard_name : D6Mit150

name	(CDS detail)
type	STS
link
xref	UniSTS:157324
definition	standard_name : GDB:451604

name	(CDS detail)
type	STS
link
xref	UniSTS:124502
definition	standard_name : 43.MMHAP4FRG10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142646
definition	standard_name : D6Wsu116e

name	(CDS detail)
type	STS
link
xref	UniSTS:161701
definition	standard_name : RH124879

name	(CDS detail)
type	STS
link
xref	UniSTS:118875
definition	standard_name : D4Rat83

name	(CDS detail)
type	STS
link
xref	UniSTS:179444
definition	standard_name : AV260042

name	(CDS detail)
type	STS
link
xref	UniSTS:235531
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179443
definition	standard_name : AI850497

name	(CDS detail)
type	STS
link
xref	UniSTS:494361
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489466
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494346
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489428
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495601
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485096
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:185680
definition	standard_name : AI586137

name	(CDS detail)
type	STS
link
xref	UniSTS:130658
definition	standard_name : D6Mit115

name	(CDS detail)
type	STS
link
xref	UniSTS:167493
definition	standard_name : AU021719

name	(CDS detail)
type	STS
link
xref	UniSTS:130921
definition	standard_name : D6Mit367

name	(CDS detail)
type	STS
link
xref	UniSTS:130884
definition	standard_name : D6Mit330

name	(CDS detail)
type	STS
link
xref	UniSTS:144385
definition	standard_name : Sdf1

name	(CDS detail)
type	STS
link
xref	UniSTS:179445
definition	standard_name : AI174028

name	(CDS detail)
type	STS
link
xref	UniSTS:235532
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159562
definition	standard_name : L12030

name	(CDS detail)
type	STS
link
xref	UniSTS:144384
definition	standard_name : Sdf1

name	(CDS detail)
type	STS
link
xref	UniSTS:269759
definition	standard_name : MARC_7283-7284:996687724:1

name	(CDS detail)
type	STS
link
xref	UniSTS:130835
definition	standard_name : D6Mit288

name	(CDS detail)
type	STS
link
xref	UniSTS:159276
definition	standard_name : AI464484

name	(CDS detail)
type	STS
link
xref	UniSTS:130886
definition	standard_name : D6Mit332

name	(CDS detail)
type	STS
link
xref	UniSTS:68334
definition	standard_name : D7S504

name	(CDS detail)
type	STS
link
xref	UniSTS:123751
definition	standard_name : 26.MMHAP69FRA11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:236801
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164340
definition	standard_name : AI646709

name	(CDS detail)
type	STS
link
xref	UniSTS:235533
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143895
definition	standard_name : Zfp239

name	(CDS detail)
type	STS
link
xref	UniSTS:143896
definition	standard_name : Zfp239

name	(CDS detail)
type	STS
link
xref	UniSTS:123431
definition	standard_name : 19.MMHAP41FLG1.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:159563
definition	standard_name : AI267073

name	(CDS detail)
type	STS
link
xref	UniSTS:210356
definition	standard_name : RH136366

name	(CDS detail)
type	STS
link
xref	UniSTS:278670
definition	standard_name : LOC221002

name	(CDS detail)
type	STS
link
xref	UniSTS:164339
definition	standard_name : AI835194

name	(CDS detail)
type	STS
link
xref	UniSTS:237289
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:208026
definition	standard_name : AI662799

name	(CDS detail)
type	STS
link
xref	UniSTS:144346
definition	standard_name : Ret

clone name	MSMg01-196J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307I22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-401L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-201I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-317G21.b	B6Ng01-317G21.g
ACC	GA107575	GA107576
length	1,005	954
definition	B6Ng01-317G21.b	B6Ng01-317G21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(117,215,032 - 117,216,038)	(117,102,502 - 117,103,459)
sequence	catacacaaaagaagcaaaagaaggtagttattcctgactggacatgcca gtcataattcagccaaaacacagggccagagctttctagacaagcacgaa gtgtgatgatgtgctttgagaggagtaacaagagtttctctgcagtgaag ccatgcggggggaagtctgagactttggcgttccagagacagatcagagt ctgacaggtcaagttccagcatgaacaatgcagcaggacttggtatcaaa tccaaaaaaggacagaatccagtgaacggggcagtgggtaatttttcttt catggcacatgcagttacagcactgtggccaggagtgtgtgcgtcaaata ctagccccccaagaaactaggcaaaaagaaaacacacaagggagttggat aaaattggttttgttgcccactgagaaacttttaaacatcgaataaacag aatacaaagacccaggagccctgaataatagtagcaacaaacccaaagag gtgaatagcaaaattaatgaatgtggcatatcggctacaggcacactgtt aacgcaatagtcataaacatcaattactaaagtaacctttataagatgct gtgagtcttcgactgctctgttttaagcaaagcagaaatcctgagaccct tgacctctgagtgccatgcacagaagcctgggtacaatggcggaggggaa taacgcttaagcacgtagaacataaacgcggctttctatcaaagactccc ctgtgtggaacagccgagtgtgaagatcccagaacatggaagtctgctag ctgtcttcacctggatgtggcagtctagcagtgcatttaaaccttaactt accaaagacaacccaatacaatgcacttagagagctactgtacttgggag tattggtatggtattggtataaggttattcaaagggcattttcacactga gcaaagaataaatccacctaatagtgggttacctactacctaaattatct actag	gaattcctatacttctctatgctggagagctacccttcaaatgcatgtcc ttgtcacctgaggtccctggagagtgaccagcttcaacagtaagaatcag gacgcttccaaaagtttcgcactggcataatacctttgcagccaaaggct ttgctcaatcatgttggtaaatgaggatgctggctcaaggtgtgaaatgg atcagcaggaagagctacctgacagacaggcagcaggccttacaggcctc atccttgccagggttaggcatatctcagatgtctcctgagcctgcttcct tcttagattaacagatgaggatgcagttgcctgcctacagactatgttct gtgtctatggtagtaaataagaactatttactacagtaaataacagtaaa cgttcaggtttcctaacttcaaccccttctgtagttcagcatttcataca ctgaagatactacatgggtttagaagatgatggtccattgtggacttggg aggatggctatgaatgccagtgactctaggtctgatcgtagggccacata ctgtatggttggcgccaccgttgtttactatgagatctgggagaaggggc tggaattcctgaacccacaaagcacctttgtgtgccacccaatgctacct gactcacactgggccttgccagggtctggaatcagtggaaaggcaacgct gcctctgcccatcttgctaaggtgtggggagagcacagtaagggacaagg gacagtgctgtcctgaagctgccgatggccagctgtgagtgcttgggtgg gattctggagctggccaggtgccagcccctacacttgccaattcccccgg gttctctgctaagtgcagtggggaggttttgaagggttttgcacatttca tactgatgagtgtatgtttttaatttgtggaattttgagtatcactcaga attt
quality values	Open. Hide. 43 33 62 56 54 42 47 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 26 38 38 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 59 62 62 59 62 59 59 62 54 59 62 62 54 49 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 54 59 62 54 62 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 33 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 46 62 62 54 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 38 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 52 49 58 49 58 58 58 58 58 54 58 58 58 58 54 54 54 43 46 54 54 54 54 54 52 58 46 58 41 58 52 58 58 54 58 58 54 58 54 58 58 54 52 54 43 52 58 54 58 50 54 58 52 58 58 42 52 54 52 54 52 44 54 52 52 54 46 58 58 52 52 52 58 54 58 58 42 42 31 58 58 58 51 58 42 28 47 49 53 51 49 49 26 51 49 19 43 35 52 58 49 50 49 51 48 58 54 33 54 54 52 47 31 41 49 37 46 29 48 46 58 41 50 50 50 39 13 49 49 48 58 30 39 51 43 32 40 48 58 41 31 53 35 48 40 47 50 50 50 36 51 50 42 39 50 52 54 44 39 31 46 50 49 40 58 33 33 40 27 50 50 52 31 58 53 50 39 29 50 41 31 26 43 32 46 39 51 50 58 31 40 50 25 37 40 49 46 36 44 22 37 51 52 52 47 33 32 29 26 26 50 39 33 24 53 51 40 28 40 49 29 53 53 30 39 38 42 47 34 39 33 29 42 37 53 29 39 39 40 40 22 40 32 31 33 53 33 32 53 32 37 38 31 45 32 21 34 28 37 23 42 34 32 24 45 21 28 31 52 47 31 52 23 18 40 42 31 23 32 31 40 45 31 32 32 25 53 43 39 32 12 15 28 21 40 34 31 24 25 30 32 31 29 30 39 25 29 32 36 43 35 30 42 25 43 31 34 31 29 31 33 45 22 31 36 32 33 30 47 32 42 24 33 25 26 31 40 28 31 15 24 17 29 13 32 31 23 31 25 19 25 31 14 28 12 36 6 16 9 19 18 33 8 11 9 12 25 31 28 34 27 28 31 31 21 8 24 6 15 18 14 22 31 31 20 30 8 9 11 31 17 24 32 22 19 6 7 13 18 11 11 14 20 12 19 10 6 24 32 18 10 5 9 9 29 9 14 31 8 14 22 20 19 10 28 15 12 10 7 10 22 6 9 25 14 10 9	Open. Hide. 62 47 56 47 62 62 62 54 62 62 42 56 38 38 38 56 56 44 44 51 62 62 62 62 62 59 59 59 62 62 59 62 59 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 54 59 59 62 62 62 62 59 59 59 62 59 59 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 47 62 47 62 52 54 54 58 54 58 58 54 58 58 58 43 58 58 54 49 54 58 58 35 54 47 54 54 58 58 54 58 54 52 52 58 54 54 58 58 42 58 34 54 54 58 58 58 54 36 58 54 35 58 58 58 52 54 58 58 49 52 54 41 48 58 54 58 58 52 38 31 41 33 54 47 52 54 50 50 48 38 39 48 49 58 58 53 58 53 42 48 48 37 38 58 40 50 51 52 58 50 49 37 42 58 51 58 38 34 51 53 39 42 52 52 50 58 35 58 54 49 48 46 53 46 49 32 48 58 58 39 53 50 51 58 50 40 40 52 46 50 52 58 51 58 58 53 42 52 27 35 32 47 50 51 49 40 44 39 39 41 40 50 23 43 40 31 40 35 35 32 44 41 52 28 42 11 38 35 54 32 46 54 54 51 39 25 39 29 40 36 42 37 39 42 53 53 32 54 15 29 18 35 46 30 54 38 32 23 40 47 45 53 45 52 53 20 28 41 37 35 37 54 28 52 37 32 45 51 19 31 30 31 38 27 42 32 35 53 45 32 33 31 32 17 31 32 30 31 47 30 51 30 31 36 47 23 25 9 31 31 30 46 46 33 16 30 36 38 25 16 21 30 13 25 30 33 34 31 15 23 41 46 46 29 24 33 25 31 31 31 32 28 22 25 11 33 31 42 33 43 37 40 17 18 33 27 13 33 31 34 36 24 31 30 38 26 36 30 25 23 18 35 27 27 37 46 46 31 36 20 30 31 48 48 33 22 31 33 11 41 25 31 38 38 29 16 10 6 25 11 10 43 38 11 13 31 21 31 29 32 22 22 12 27 6 13 25 17 15 26 32 17 36 32 32 27 8 16 29 36 31 29 10 28 11 19 14 6 29 4 21 23 28 11 10 19 16 33 31 28 13 29 7 7 13 11 33 39 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_117215032_117216038
seq2: B6Ng01-317G21.b_57_1061 (reverse)

seq1  CTAGTAGTAAATTTTAGGTAGTTGGTAACCCACTCTTCGTTGAATTTATT  50
      ||||||| | | |||||||||| ||||||||||| || | || |||||||
seq2  CTAGTAG-ATAATTTAGGTAGTAGGTAACCCACTATTAGGTGGATTTATT  49

seq1  CCTTTGCTCAGTGTGAAAATGCCCTATGAATAACCTTATACCAATACCAT  100
       |||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  -CTTTGCTCAGTGTGAAAATGCCCTTTGAATAACCTTATACCAATACCAT  98

seq1  ACCAATACTCCCAAGTACAGTAGCTCTCTAAGTGCATTGTATTGGGTTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATACTCCCAAGTACAGTAGCTCTCTAAGTGCATTGTATTGGGTTGT  148

seq1  CTTTGGTAAGTTAAGGTTTAAATGCACTGCTAGACTGCCACATCCAGGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGGTAAGTTAAGGTTTAAATGCACTGCTAGACTGCCACATCCAGGTG  198

seq1  AAGACAGCTAGCAGACTTCCATGTTCTGGGATCTTCACACTCGGCTGTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGCTAGCAGACTTCCATGTTCTGGGATCTTCACACTCGGCTGTTC  248

seq1  CACACAGGGGAGTCTTTGATAGAAAGCCGCGTTTATGTTCTACGTGCTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGGGGAGTCTTTGATAGAAAGCCGCGTTTATGTTCTACGTGCTTA  298

seq1  AGCGTTATTCCCCTCCGCCATTGTACCCAGGCTTCTGTGCATGGCACTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGTTATTCCCCTCCGCCATTGTACCCAGGCTTCTGTGCATGGCACTCA  348

seq1  GAGGTCAAGGGTCTCAGGATTTCTGCTTTGCTTAAAACAGAGCAGTCGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTCAAGGGTCTCAGGATTTCTGCTTTGCTTAAAACAGAGCAGTCGAA  398

seq1  GACTCACAGCATCTTATAAAGGTTACTTTAGTAATTGATGTTTATGACTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCACAGCATCTTATAAAGGTTACTTTAGTAATTGATGTTTATGACTA  448

seq1  TTGCGTTAACAGTGTGCCTGTAGCCGATATGCCACATTCATTAATTTTGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCGTTAACAGTGTGCCTGTAGCCGATATGCCACATTCATTAATTTTGC  498

seq1  TATTCACCTCTTTGGGTTTGTTGCTACTATTATTCAGGGCTCCTGGGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCACCTCTTTGGGTTTGTTGCTACTATTATTCAGGGCTCCTGGGTCT  548

seq1  TTGTATTCTGTTTATTCGATGTTTAAAAGTTTCTCAGTGGGCAACAAAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATTCTGTTTATTCGATGTTTAAAAGTTTCTCAGTGGGCAACAAAAC  598

seq1  CAATTTTATCCAACTCCCTTGTGTGTTTTCTTTTTGCCTAGTTTCTTGGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTTTATCCAACTCCCTTGTGTGTTTTCTTTTTGCCTAGTTTCTTGGG  648

seq1  GGGCTAGTATTTGACGCACACACTCCTGGCCACAGTGCTGTAACTGCATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTAGTATTTGACGCACACACTCCTGGCCACAGTGCTGTAACTGCATG  698

seq1  TGCCATGAAAGAAAAATTACCCACTGCCCCGTTCACTGGATTCTGTCCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCATGAAAGAAAAATTACCCACTGCCCCGTTCACTGGATTCTGTCCTT  748

seq1  TTTTGGATTTGATACCAAGTCCTGCTGCATTGTTCATGCTGGAACTTGAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGGATTTGATACCAAGTCCTGCTGCATTGTTCATGCTGGAACTTGAC  798

seq1  CTGTCAGACTCTGATCTGTCTCTGGAACGCCAAAGTCTCAGACTTCCCCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAGACTCTGATCTGTCTCTGGAACGCCAAAGTCTCAGACTTCCCCC  848

seq1  CGCATGGCTTCACTGCAGAGAAACTCTTGTTACTCCTCTCAAAGCACATC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCATGGCTTCACTGCAGAGAAACTCTTGTTACTCCTCTCAAAGCACATC  898

seq1  ATCACACTTCGTGCTTGTCTAGAAAGCTCTGGCCCTGTGTTTTGGCTGAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACACTTCGTGCTTGTCTAGAAAGCTCTGGCCCTGTGTTTTGGCTGAA  948

seq1  TTATGACTGGCATGTCCAGTCAGGAATAACTACCTTCTTTTGCTTCTTTT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGACTGGCATGTCCAGTCAGGAATAACTACCTTCTTTTGCTTCTTTT  998

seq1  GTGTATG  1007
      |||||||
seq2  GTGTATG  1005

seq1: chr6_117102502_117103459
seq2: B6Ng01-317G21.g_68_1021

seq1  GAATTCCTATACTTCTCTATGCTGGAGAGCTACCCTTCAAATGCATGTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTATACTTCTCTATGCTGGAGAGCTACCCTTCAAATGCATGTCC  50

seq1  TTGTCACCTGAGGTCCCTGGAGAGTGACCAGCTTCAACAGTAAGAATCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCACCTGAGGTCCCTGGAGAGTGACCAGCTTCAACAGTAAGAATCAG  100

seq1  GACGCTTCCAAAAGTTTCGCACTGGCATAATACCTTTGCAGCCAAAGGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGCTTCCAAAAGTTTCGCACTGGCATAATACCTTTGCAGCCAAAGGCT  150

seq1  TTGCTCAATCATGTTGGTAAATGAGGATGCTGGCTCAAGGTGTGAAATGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTCAATCATGTTGGTAAATGAGGATGCTGGCTCAAGGTGTGAAATGG  200

seq1  ATCAGCAGGAAGAGCTACCTGACAGACAGGCAGCAGGCCTTACAGGCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCAGGAAGAGCTACCTGACAGACAGGCAGCAGGCCTTACAGGCCTC  250

seq1  ATCCTTGCCAGGGTTAGGCATATCTCAGATGTCTCCTGAGCCTGCTTCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTGCCAGGGTTAGGCATATCTCAGATGTCTCCTGAGCCTGCTTCCT  300

seq1  TCTTAGATTAACAGATGAGGATGCAGTTGCCTGCCTACAGACTATGTTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGATTAACAGATGAGGATGCAGTTGCCTGCCTACAGACTATGTTCT  350

seq1  GTGTCTATGGTAGTAAATAAGAACTATTTACTACAGTAAATAACAGTAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTATGGTAGTAAATAAGAACTATTTACTACAGTAAATAACAGTAAA  400

seq1  CGTTCAGGTTTCCTAACTTCAACCCCTTCTGTAGTTCAGCATTTCATACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTCAGGTTTCCTAACTTCAACCCCTTCTGTAGTTCAGCATTTCATACA  450

seq1  CTGAAGATACTACATGGGTTTAGAAGATGATGGTCCATTGTGGACTTGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAGATACTACATGGGTTTAGAAGATGATGGTCCATTGTGGACTTGGG  500

seq1  AGGATGGCTATGAATGCCAGTGACTCTAGGTCTGATCGTAGGGCCACATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGGCTATGAATGCCAGTGACTCTAGGTCTGATCGTAGGGCCACATA  550

seq1  CTGTATGGTTGGCGCCACCGTTGTTTACTATGAGATCTGGGAGAAGGGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTATGGTTGGCGCCACCGTTGTTTACTATGAGATCTGGGAGAAGGGGC  600

seq1  TGGAATTCCTGAACCCACAAAGCACCTTTGTGTGCCACCCAATGCTACCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATTCCTGAACCCACAAAGCACCTTTGTGTGCCACCCAATGCTACCT  650

seq1  GACTCACACTGGGCCTTGCCAGGGTCTGGAATCAGTGGAAAGGCAACGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCACACTGGGCCTTGCCAGGGTCTGGAATCAGTGGAAAGGCAACGCT  700

seq1  GCCTCTGCCCATCTTGCTAAGGTGTGGGGAGAGCACAGTAAGGGACAAGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCTGCCCATCTTGCTAAGGTGTGGGGAGAGCACAGTAAGGGACAAGG  750

seq1  GACAGTGCTGTCCTGAAGCTGCCGATGGCCAGCTGTGAGTGCTTGGGTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGTGCTGTCCTGAAGCTGCCGATGGCCAGCTGTGAGTGCTTGGGTGG  800

seq1  GATTCTGGAGCTGGCCAGGTGCCAGCCCCTACACTTGCCAATTCCCCCGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCTGGAGCTGGCCAGGTGCCAGCCCCTACACTTGCCAATTCCCCCGG  850

seq1  GTTCTCTGCTAAGTGCAGTGGGGAGGTTTTGAAGGGTTTTGCACATTTCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCTGCTAAGTGCAGTGGGGAGGTTTTGAAGGGTTTTGCACATTTCA  900

seq1  TACTGATGAGTGTATGTTTTTAATTTTGTGGAATTTTTGAGTATCAACTC  950
      ||||||||||||||||||||||| ||||||||| ||||||||||| ||||
seq2  TACTGATGAGTGTATGTTTTTAA-TTTGTGGAA-TTTTGAGTATC-ACTC  947

seq1  AGGAATTT  958
      | ||||||
seq2  A-GAATTT  954

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information