MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-334M18
Chromosome	6 (Build37)
Map Location	87,006,137 - 87,205,196
singlet/doublet	doublet
Overlap gene	Gfpt1, D6Ertd527e, Antxr1
Upstream gene	Add2, Tgfa, LOC665233, LOC100043094, LOC100043527, 2010309E21Rik, Snrpg, Pcyox1, Tia1, C87436, 2310040G24Rik, Pcbp1, Asprv1, Mxd1, 2610209M04Rik, Gmcl1, Anxa4, 2610306M01Rik, Aak1, LOC100043555, Nfu1
Downstream gene	Gkn1, Gkn2, 1190003M12Rik, Bmp10, Arhgap25, Prokr1, 2010301N04Rik, 1810020O05Rik, AB041550, LOC100043118, EG545864, Gp9, Rab43, Isy1, Cnbp, Copg, 8430410A17Rik, LOC665416, H1fx, EG434064, LOC100043131, Rab7, Rpn1, Gata2, Dnajb8
Link	Open Mouse BAC browser

Click to get alignment info.

name	Add2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11519 MGI:87919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins pseudo : _no_value

name	LOC100043094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins

name	2010309E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66488 MGI:1913738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66881 MGI:1914131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21841 MGI:107914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232196 MGI:2141787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040G24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	Pcbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23983 MGI:1345635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asprv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67855 MGI:1915105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17119 MGI:96908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610209M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23885 MGI:1345156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11746 MGI:88030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610306M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs

name	Aak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269774 MGI:1098687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins

name	Nfu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Ertd527e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs

name	Antxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69538 MGI:1916788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gkn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190003M12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12154 MGI:1338820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prokr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58182 MGI:1929676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010301N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72103 MGI:1919353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810020O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:613264 MGI:3586838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	AB041550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58229 MGI:1931020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043118 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG545864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545864 MGI:3647624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 2630 ESTs, 8 Proteins

name	Gp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54368 MGI:1860137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Isy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57905 MGI:1923310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12785 MGI:88431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	8430410A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232210 MGI:1914053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins pseudo : _no_value

name	H1fx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243529 MGI:2685307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434064 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100043131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rab7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19349 MGI:105068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103963 MGI:98084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gata2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14461 MGI:95662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Add2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349159 GeneID:11519 MGI:87919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adducin 2 (beta) transcript_id : NM_013458.3

name	Tgfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130077 GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor alpha transcript_id : NM_031199.2

name	LOC100043094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255227 GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043094 transcript_id : XM_001479475.1

name	LOC100043527 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255323 GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_001480106.1

name	2010309E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981258 GeneID:66488 MGI:1913738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010309E21 gene transcript_id : NM_025591.2

name	Snrpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378958 GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide G transcript_id : NM_026506.2

name	Pcyox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981175 GeneID:66881 MGI:1914131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenylcysteine oxidase 1 transcript_id : NM_025823.3

name	Tia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750236 GeneID:21841 MGI:107914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytotoxic granule-associated RNA binding protein 1 transcript_id : NM_011585.3

name	C87436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384996 GeneID:232196 MGI:2141787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C87436 transcript_id : NM_146170.3

name	2310040G24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255327 GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : RIKEN cDNA 2310040G24 gene transcript_id : XM_001480154.1

name	Pcbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271536 GeneID:23983 MGI:1345635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 1 transcript_id : NM_011865.3

name	Asprv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502129 GeneID:67855 MGI:1915105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartic peptidase, retroviral-like 1 transcript_id : NM_026414.2

name	Mxd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370244 GeneID:17119 MGI:96908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX dimerization protein 1 transcript_id : NM_010751.2

name	2610209M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802219 GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610209M04 gene transcript_id : NM_025665.2

name	Gmcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981389 GeneID:23885 MGI:1345156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-less homolog 1 (Drosophila) transcript_id : NM_011818.2

name	Anxa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304888 GeneID:11746 MGI:88030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A4 transcript_id : NM_013471.1

name	2610306M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255229 GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs product : RIKEN cDNA 2610306M01 gene transcript_id : XM_001479511.1

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046263 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_001040106.2

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046243 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_177762.6

name	LOC100043555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255329 GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins product : similar to Aak1 protein transcript_id : XM_001480194.1

name	Nfu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130523 GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) transcript_id : NM_020045.2

name	Gfpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980779 GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 1 transcript_id : NM_013528.2

name	D6Ertd527e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377982 GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs product : DNA segment, Chr 6, ERATO Doi 527, expressed transcript_id : XM_489144.3

name	Antxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971258 GeneID:69538 MGI:1916788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anthrax toxin receptor 1 transcript_id : NM_054041.2

name	Gkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384881 GeneID:66283 MGI:1913533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 1 transcript_id : NM_025466.1

name	Gkn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384883 GeneID:66284 MGI:1913534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrokine 2 transcript_id : NM_025467.1

name	1190003M12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326172 GeneID:68888 MGI:1916138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190003M12 gene transcript_id : NM_026860.1

name	Bmp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857762 GeneID:12154 MGI:1338820
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 10 transcript_id : NM_009756.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582810 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_001037727.1

name	Arhgap25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582812 GeneID:232201 MGI:2443687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 25 transcript_id : NM_175476.3

name	Prokr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254342 GeneID:58182 MGI:1929676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prokineticin receptor 1 transcript_id : NM_021381.3

name	2010301N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361671 GeneID:72103 MGI:1919353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010301N04 gene transcript_id : NM_024251.3

name	1810020O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255231 GeneID:613264 MGI:3586838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : Riken cDNA 1810020O05 gene transcript_id : XM_001479524.1

name	AB041550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946781 GeneID:58229 MGI:1931020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein, MNCb-4779 transcript_id : NM_021418.1

name	LOC100043118 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255233 GeneID:100043118
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to coiled-coil domain containing 48 transcript_id : XM_001479529.1

name	Gp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055225 GeneID:54368 MGI:1860137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein 9 (platelet) transcript_id : NM_018762.1

name	Rab43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476068 GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB43, member RAS oncogene family transcript_id : NM_001039394.1

name	Rab43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476067 GeneID:69834 MGI:1917084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB43, member RAS oncogene family transcript_id : NM_133717.2

name	Isy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372613 GeneID:57905 MGI:1923310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ISY1 splicing factor homolog (S. cerevisiae) transcript_id : NM_133934.3

name	Cnbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476048 GeneID:12785 MGI:88431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cellular nucleic acid binding protein transcript_id : NM_013493.2

name	Copg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130780 GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma transcript_id : NM_017477.2

name	Copg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059162 GeneID:54161 MGI:1858696
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma transcript_id : NM_201244.1

name	8430410A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343454 GeneID:232210 MGI:1914053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430410A17 gene transcript_id : NM_173737.2

name	H1fx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348565 GeneID:243529 MGI:2685307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member X transcript_id : NM_198622.1

name	EG434064 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255236 GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG434064 transcript_id : XM_976858.2

name	LOC100043131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255237 GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043131 transcript_id : XM_001479559.1

name	Rab7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679598 GeneID:19349 MGI:105068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB7, member RAS oncogene family transcript_id : NM_009005.1

name	Rpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802696 GeneID:103963 MGI:98084
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribophorin I transcript_id : NM_133933.3

name	Gata2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378318 GeneID:14461 MGI:95662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 2 transcript_id : NM_008090.4

name	Dnajb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910415 GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 8 transcript_id : NM_019964.1

name	Add2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560504 CCDS:CCDS20308.1 GeneID:11519 MGI:87919
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IDA] GO_process : GO:0030097 - hemopoiesis [Evidence IMP] codon_start : 1 note : snoRNA MBII-396 product : adducin 2 (beta) protein_id : NP_038486.2

name	Tgfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654266 GeneID:21802 MGI:98724
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001948 - glycoprotein binding [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : waved 1; transforming growth factor-alpha product : transforming growth factor alpha protein_id : NP_112476.1

name	LOC100043094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255228 GeneID:100043094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479525.1

name	LOC100043527 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255324 GeneID:100043527
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_001480156.1

name	2010309E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385042 CCDS:CCDS20309.1 GeneID:66488 MGI:1913738
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : hypothetical protein LOC66488 protein_id : NP_079867.1

name	Snrpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385994 GeneID:68011 MGI:1915261
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence ISS]; GO:0005681 - spliceosome complex [Evidence ISS] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0008380 - RNA splicing [Evidence ISS]; GO:0000245 - spliceosome assembly [Evidence ISS] codon_start : 1 product : small nuclear ribonucleoprotein polypeptide G protein_id : NP_080782.1

name	Pcyox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385294 CCDS:CCDS20311.1 GeneID:66881 MGI:1914131
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0001735 - prenylcysteine oxidase activity [Evidence IMP] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030328 - prenylcysteine catabolism [Evidence IMP] codon_start : 1 note : prenylcysteine lyase product : prenylcysteine oxidase 1 protein_id : NP_080099.1

name	Tia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755783 CCDS:CCDS20312.1 GeneID:21841 MGI:107914
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0017091 - AU-specific RNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042036 - negative regulation of cytokine biosynthesis [Evidence IMP]; GO:0016478 - negative regulation of translation [Evidence IMP] codon_start : 1 note : cytotoxic granule-associated RNA-binding protein 1 product : cytotoxic granule-associated RNA binding protein 1 protein_id : NP_035715.1

name	C87436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30911109 CCDS:CCDS20313.1 GeneID:232196 MGI:2141787
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC232196 protein_id : NP_666282.2

name	2310040G24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255328 GeneID:381792 MGI:1916897
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480204.1

name	Pcbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754994 CCDS:CCDS20314.1 GeneID:23983 MGI:1345635
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008494 - translation activator activity [Evidence TAS] GO_process : GO:0006397 - mRNA processing [Evidence TAS] codon_start : 1 note : poly(rC)-binding protein 1; hnRNP E1 product : poly(rC) binding protein 1 protein_id : NP_035995.1

name	Asprv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502130 GeneID:67855 MGI:1915105
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : TPA-induced aspartic proteinase-like; skin-specific retroviral-like aspartic protease product : skin aspartic protease protein_id : NP_080690.2

name	Mxd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754604 GeneID:17119 MGI:96908
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Max dimerization protein protein_id : NP_034881.1

name	2610209M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228990 CCDS:CCDS20315.1 GeneID:66618 MGI:1913868
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : putative nucleic acid binding protein RY-1 protein_id : NP_079941.1

name	Gmcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981390 CCDS:CCDS20316.1 GeneID:23885 MGI:1345156
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence TAS] codon_start : 1 exception : mismatches in translation product : germ cell-less protein_id : NP_035948.2

name	Anxa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304889 GeneID:11746 MGI:88030
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] GO_process : GO:0001822 - kidney development [Evidence ISS] codon_start : 1 exception : mismatches in translation note : annexin IV product : annexin A4 protein_id : NP_038499.1

name	2610306M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255230 GeneID:67170 MGI:1914420
definition	codon_start : 1 product : hypothetical protein LOC67170 protein_id : XP_001479561.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91992157 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : AP2 associated kinase 1 isoform 1 protein_id : NP_001035195.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73695877 CCDS:CCDS20317.1 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : AP2 associated kinase 1 isoform 2 protein_id : NP_808430.2

name	LOC100043555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255330 GeneID:100043555
definition	codon_start : 1 product : similar to Aak1 protein protein_id : XP_001480244.1

name	Nfu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910264 GeneID:56748 MGI:1913290
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HIRA-interacting protein 5 product : histone cell cycle regulation defective interacting protein 5 protein_id : NP_064429.1

name	Gfpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305085 GeneID:14583 MGI:95698
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutamine:fructose-6-phosphate amidotransferase 1 product : glutamine fructose-6-phosphate transaminase 1 protein_id : NP_038556.1

name	D6Ertd527e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029415 GeneID:52372 MGI:1261919
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489144.2

name	Antxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189436 CCDS:CCDS20318.1 GeneID:69538 MGI:1916788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tumor endothelial marker 8 product : anthrax toxin receptor 1 protein_id : NP_473382.1

name	Gkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384882 CCDS:CCDS20319.1 GeneID:66283 MGI:1913533
definition	GO_component : GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : foveolin product : gastrokine 1 protein_id : NP_079742.1

name	Gkn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384884 GeneID:66284 MGI:1913534
definition	codon_start : 1 product : blottin protein_id : NP_079743.1

name	1190003M12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326173 CCDS:CCDS20320.1 GeneID:68888 MGI:1916138
definition	codon_start : 1 product : hypothetical protein LOC68888 protein_id : NP_081136.1

name	Bmp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857763 GeneID:12154 MGI:1338820
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] [Evidence IC] GO_function : GO:0005125 - cytokine activity [Evidence IC] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IC] [Evidence IEA] GO_process : GO:0010002 - cardioblast differentiation [Evidence IC]; GO:0007267 - cell-cell signaling [Evidence IC]; GO:0009790 - embryonic development [Evidence NAS]; GO:0035050 - embryonic heart tube development [Evidence NAS]; GO:0040007 - growth [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IC] codon_start : 1 exception : mismatches in translation product : bone morphogenetic protein 10 preproprotein protein_id : NP_033886.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582811 CCDS:CCDS20321.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : Rho GTPase activating protein 25 isoform a protein_id : NP_001032816.1

name	Arhgap25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582813 CCDS:CCDS20322.1 GeneID:232201 MGI:2443687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : Rho GTPase activating protein 25 isoform b protein_id : NP_780685.2

name	Prokr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254343 CCDS:CCDS20323.1 GeneID:58182 MGI:1929676
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 73 protein_id : NP_067356.2

name	2010301N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541860 CCDS:CCDS20324.1 GeneID:72103 MGI:1919353
definition	codon_start : 1 product : hypothetical protein LOC72103 protein_id : NP_077213.2

name	1810020O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255232 GeneID:613264 MGI:3586838
definition	codon_start : 1 product : similar to hCG20001 protein_id : XP_001479574.1

name	AB041550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946782 CCDS:CCDS20326.1 GeneID:58229 MGI:1931020
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC58229 protein_id : NP_067393.1

name	LOC100043118 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255234 GeneID:100043118
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479579.1

name	Gp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055226 CCDS:CCDS20328.1 GeneID:54368 MGI:1860137
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : platelet glycoprotein IX product : glycoprotein 9 (platelet) protein_id : NP_061232.1

name	Rab43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476069 CCDS:CCDS20329.1 GeneID:69834 MGI:1917084
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : RAB43, member RAS oncogene family isoform a protein_id : NP_001034483.1

name	Rab43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746181 CCDS:CCDS20330.1 GeneID:69834 MGI:1917084
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RAB43, member RAS oncogene family isoform b protein_id : NP_598478.1

name	Isy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149316 GeneID:57905 MGI:1923310
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : ISY1 splicing factor homolog protein_id : NP_598695.1

name	Cnbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304969 GeneID:12785 MGI:88431
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : cellular nucleic acid binding protein 1 product : cellular nucleic acid binding protein protein_id : NP_038521.1

name	Copg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567338 GeneID:54161 MGI:1858696
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; coatomer protein complex, subunit gamma 1 product : coatomer protein complex, subunit gamma isoform 1 protein_id : NP_059505.1

name	Copg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059163 GeneID:54161 MGI:1858696
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; coatomer protein complex, subunit gamma 1 product : coatomer protein complex, subunit gamma isoform 2 protein_id : NP_957696.1

name	8430410A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424571 GeneID:232210 MGI:1914053
definition	codon_start : 1 product : hypothetical protein LOC232210 protein_id : NP_776098.1

name	H1fx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348566 CCDS:CCDS20331.1 GeneID:243529 MGI:2685307
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H1 histone family, member X protein_id : NP_941024.1

name	EG434064 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377989 GeneID:434064 MGI:3648213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981952.1

name	LOC100043131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255238 GeneID:100043131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479609.1

name	Rab7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679599 GeneID:19349 MGI:105068
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA] [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAB7, member RAS oncogene family protein_id : NP_033031.1

name	Rpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543605 CCDS:CCDS20332.1 GeneID:103963 MGI:98084
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribophorin I protein_id : NP_598694.2

name	Gata2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982351 CCDS:CCDS20333.1 GeneID:14461 MGI:95662
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IEA]; GO:0021983 - pituitary gland development [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GATA-binding protein 2 product : GATA binding protein 2 protein_id : NP_032116.3

name	Dnajb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910416 CCDS:CCDS20334.1 GeneID:56691 MGI:1922801
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DnaJ homolog 6 product : DnaJ homolog, subfamily B, member 8 protein_id : NP_064348.1

name	(CDS detail)
type	STS
link
xref	UniSTS:460101
definition	standard_name : stSG633446

name	(CDS detail)
type	STS
link
xref	UniSTS:144608
definition	standard_name : Tgfa

name	(CDS detail)
type	STS
link
xref	UniSTS:159533
definition	standard_name : AI448340

name	(CDS detail)
type	STS
link
xref	UniSTS:210059
definition	standard_name : RH136064

name	(CDS detail)
type	STS
link
xref	UniSTS:221980
definition	standard_name : RH139896

name	(CDS detail)
type	STS
link
xref	UniSTS:159535
definition	standard_name : C87436

name	(CDS detail)
type	STS
link
xref	UniSTS:162100
definition	standard_name : RH125278

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:491475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165474
definition	standard_name : AA986851

name	(CDS detail)
type	STS
link
xref	UniSTS:165476
definition	standard_name : AW122478

name	(CDS detail)
type	STS
link
xref	UniSTS:125870
definition	standard_name : X83106

name	(CDS detail)
type	STS
link
xref	UniSTS:207989
definition	standard_name : AU022368

name	(CDS detail)
type	STS
link
xref	UniSTS:159529
definition	standard_name : AI449063

name	(CDS detail)
type	STS
link
xref	UniSTS:212122
definition	standard_name : RH128814

name	(CDS detail)
type	STS
link
xref	UniSTS:164687
definition	standard_name : Gcl

name	(CDS detail)
type	STS
link
xref	UniSTS:235484
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207990
definition	standard_name : BB540852

name	(CDS detail)
type	STS
link
xref	UniSTS:159539
definition	standard_name : AI265406

name	(CDS detail)
type	STS
link
xref	UniSTS:179409
definition	standard_name : AW106930

name	(CDS detail)
type	STS
link
xref	UniSTS:130837
definition	standard_name : D6Mit29

name	(CDS detail)
type	STS
link
xref	UniSTS:130877
definition	standard_name : D6Mit323

name	(CDS detail)
type	STS
link
xref	UniSTS:215646
definition	standard_name : RH132363

name	(CDS detail)
type	STS
link
xref	UniSTS:179408
definition	standard_name : AU067724

name	(CDS detail)
type	STS
link
xref	UniSTS:164330
definition	standard_name : AU067726

name	(CDS detail)
type	STS
link
xref	UniSTS:207988
definition	standard_name : RH126710

name	(CDS detail)
type	STS
link
xref	UniSTS:167472
definition	standard_name : RH126656

name	(CDS detail)
type	STS
link
xref	UniSTS:162071
definition	standard_name : RH125249

name	(CDS detail)
type	STS
link
xref	UniSTS:165475
definition	standard_name : AI324119

name	(CDS detail)
type	STS
link
xref	UniSTS:159538
definition	standard_name : AI449986

name	(CDS detail)
type	STS
link
xref	UniSTS:167494
definition	standard_name : D6Ertd527e

name	(CDS detail)
type	STS
link
xref	UniSTS:159534
definition	standard_name : AU043841

name	(CDS detail)
type	STS
link
xref	UniSTS:235487
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235488
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130991
definition	standard_name : D6Mit9

name	(CDS detail)
type	STS
link
xref	UniSTS:496636
definition	standard_name : Bmp10

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:130758
definition	standard_name : D6Mit213

name	(CDS detail)
type	STS
link
xref	UniSTS:179410
definition	standard_name : AI452191

name	(CDS detail)
type	STS
link
xref	UniSTS:130774
definition	standard_name : D6Mit228

name	(CDS detail)
type	STS
link
xref	UniSTS:490558
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:270581
definition	standard_name : PMC129049P1

name	(CDS detail)
type	STS
link
xref	UniSTS:256435
definition	standard_name : Gp9

name	(CDS detail)
type	STS
link
xref	UniSTS:219169
definition	standard_name : RH137081

name	(CDS detail)
type	STS
link
xref	UniSTS:163395
definition	standard_name : AB007464

name	(CDS detail)
type	STS
link
xref	UniSTS:235491
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235490
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179411
definition	standard_name : AW490415

name	(CDS detail)
type	STS
link
xref	UniSTS:159536
definition	standard_name : AI181014

name	(CDS detail)
type	STS
link
xref	UniSTS:210545
definition	standard_name : RH136565

name	(CDS detail)
type	STS
link
xref	UniSTS:141362
definition	standard_name : Cnbp

name	(CDS detail)
type	STS
link
xref	UniSTS:25935
definition	standard_name : SHGC-77307

name	(CDS detail)
type	STS
link
xref	UniSTS:216088
definition	standard_name : RH132805

name	(CDS detail)
type	STS
link
xref	UniSTS:161571
definition	standard_name : RH124749

name	(CDS detail)
type	STS
link
xref	UniSTS:479151
definition	standard_name : Cnbp

name	(CDS detail)
type	STS
link
xref	UniSTS:224585
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:271437
definition	standard_name : PMC15869P1

name	(CDS detail)
type	STS
link
xref	UniSTS:210532
definition	standard_name : RH136550

name	(CDS detail)
type	STS
link
xref	UniSTS:142652
definition	standard_name : RH125682

name	(CDS detail)
type	STS
link
xref	UniSTS:167498
definition	standard_name : D6Ertd71e

name	(CDS detail)
type	STS
link
xref	UniSTS:207991
definition	standard_name : AW546958

name	(CDS detail)
type	STS
link
xref	UniSTS:124773
definition	standard_name : D18356

name	(CDS detail)
type	STS
link
xref	UniSTS:207992
definition	standard_name : RH127177

name	(CDS detail)
type	STS
link
xref	UniSTS:254130
definition	standard_name : SRCR23H

name	(CDS detail)
type	STS
link
xref	UniSTS:144311
definition	standard_name : Rab7-ps1

name	(CDS detail)
type	STS
link
xref	UniSTS:270460
definition	standard_name : PMC124275P2

name	(CDS detail)
type	STS
link
xref	UniSTS:225345
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167477
definition	standard_name : RH126941

name	(CDS detail)
type	STS
link
xref	UniSTS:144310
definition	standard_name : Rab7

name	(CDS detail)
type	STS
link
xref	UniSTS:210244
definition	standard_name : RH136250

name	(CDS detail)
type	STS
link
xref	UniSTS:142648
definition	standard_name : D6Wsu137e

name	(CDS detail)
type	STS
link
xref	UniSTS:130946
definition	standard_name : D6Mit40

name	(CDS detail)
type	STS
link
xref	UniSTS:273134
definition	standard_name : PMC327172P1

name	(CDS detail)
type	STS
link
xref	UniSTS:468005
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:270438
definition	standard_name : PMC123124P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273367
definition	standard_name : PMC58532P1

name	(CDS detail)
type	STS
link
xref	UniSTS:464674
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:159531
definition	standard_name : AB000096

name	(CDS detail)
type	STS
link
xref	UniSTS:159537
definition	standard_name : AI326313

name	LOC665233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255319 GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034541.1

name	EG545864 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255333 GeneID:545864 MGI:3647624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1272 ESTs, 4 Proteins product : predicted gene, EG545864 transcript_id : XR_035706.1

name	LOC665416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255235 GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : similar to Rps19 protein pseudo : _no_value transcript_id : XR_034267.1

clone name	MSMg01-326J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447A22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-485N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-334M18.b	B6Ng01-334M18.g
ACC	GA120214	GA120215
length	1,191	1,131
definition	B6Ng01-334M18.b	B6Ng01-334M18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,204,005 - 87,205,196)	(87,006,137 - 87,007,264)
sequence	gaattcctcacataaagtcaggaaaatggaagtaaacctaatgtatctta tgagggaaaacagatcatcataacaatggaacctcggggaggcgtttgca gcaggcaagatctgaatttaaagacgtgtgactcagtggctgtccaggag agatggagggaggtctggttccagaagggcagatgctgggagcctggtta ttatttgcatctggcgtccatcacagggacaattcctgacttctgtctgc agtgataaacagcagccacagggggctgtagtttccatcacactgggtgc tcctgggcttcaatcctttctgcttggcagcccagaggcttaggagggaa ggaaggcagaccacacccacacgcagctcaccgcccactctgggtcttct ccttgtggccccagaagacagggggtctaacgctatttttaagttaggaa aactgaaggacacacctttttttctctccttgacaccttgaaaccctctt aattgtgtttagacacaagcagcggcttcctcatagacatctggaatctc tggcttgggataatatcaaacattgaaagcattcagttagttttatttaa cattgggactgctcttgtgtgtccaaaatgtgtgtgctgtttgaaaccat ttttcattgtccacaatgtagaagctgcttccaaagtcactgtaaatccc cagtctcaaggaaaggcagaaactctcggaggatttgattttttcatccc aaaacagtgagcttttgaactggccttctgtgagggcaaaccctaggggt tagggatcgtgttcggaggggacaagacccgggacagccctgcacttgcc agttgatctgtgaactctgatgtctcatccctttgttcttcctttcctgg tatgcccttgggcaccacctgtgggccagcccgcccctcattcactcaga gaaatacatgccactggagcaggcagcagcttgaacagcaaactcagtcc acttccagcacagccttgagggctgcagagacagagggactccatctcag aggatttgcttgtcacacagcaaacccgtgtgctcgaaagcaaaagtgcc ttaaccacaggtgacacctcgtctcaagtgcagaattaaagctcaatgtc attctaggaccaaacacattgaaaggcaattcaacctttaa	gaattcattgttattcataatggaatcatcaccaactacaaagacttgaa aaagtttctggtaagcgaggtgaccctggaagacgccgtcttctgagagt gggaggtagtttgttggggtgtgcagcgttatgcggacatgttcaagtaa ttaccataattatctccagggtgtggcgtttcattgcatttctctgctga cagtggaacagaattgatttctctttttttaataatttattttattttta ttttatgtgcattggtgtcctgcctaaatgcacgtgtgttagggtgtcag aaattggggttacagactgttgtgagccgccatgtggttgctgggaatcg aatcccagtcctctggaagagcagtcagtgctcccaagtgctgagccatc tccaaccccacagttctgattccttacatggcattttgaggacaagcttt attctgtagtgtgacagggccatctcagtgtcgtctgttgagtttctgca gtgatgagaactctctgtatctagcattgtgggagctgtgcctataggac cgctgaactgctccgacagagaaactgggttttaagttttagtgtaaata accatgcatagctaatggatcttcattggacagttgaggatcaccaaata actgttgctcatgaaattagtattttgaatattatatatcctactatatt ttcattacagtttaattcatatgcggcaaatctaagttaagccttttgag ttgtattttgaattctctacaatcagattttaattttgattaaaattaat tttaattattttattaactatattaattgattcttatttattaaatttgc cattataaattaattttttaggtaatttaaattttgagtagaataaattc agtatgacatcaaaaaaagttagtaattagtaagatctattaggttgatg aggtgactcagtgggtaaagcggttgccagcggacagcggtgagtttgtc cctgaaccccacagaaaggtggacagctaaagctgatgatgcctcatggt ggtcctctaatccctcaagcacacaccatggtggacccattagccctgta cttacaggaccttacacacgcatatagtgtg
quality values	Open. Hide. 58 47 30 39 62 62 62 62 41 31 47 47 62 62 62 49 47 47 41 37 62 62 62 62 62 44 43 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 59 62 59 59 59 62 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 56 54 46 51 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 45 52 51 54 58 58 54 54 54 58 58 58 51 58 58 58 58 58 58 54 48 58 51 58 58 53 58 54 54 54 58 58 58 58 49 53 58 58 51 49 58 58 51 45 58 58 58 58 58 50 58 58 58 58 51 51 58 58 54 58 53 58 51 50 51 37 58 58 51 54 58 39 58 58 58 58 58 58 58 58 53 58 58 51 51 58 51 48 44 40 51 58 58 58 51 53 50 46 58 58 49 51 51 50 53 51 51 52 58 50 54 37 49 58 35 54 49 51 50 44 43 35 50 32 51 39 47 52 53 45 49 52 54 53 50 49 44 51 41 54 46 34 40 47 47 53 54 39 29 49 45 54 32 49 42 40 54 23 52 39 54 54 54 51 54 53 54 52 54 35 51 14 51 28 21 54 54 42 31 17 54 54 54 54 33 42 32 52 40 54 49 26 51 54 52 42 33 52 52 53 53 32 45 53 54 54 40 40 53 52 31 32 45 46 21 40 39 44 32 45 52 32 34 40 23 49 33 27 26 52 31 13 40 52 52 40 9 49 49 40 33 40 40 31 47 30 30 31 35 31 31 51 30 43 31 29 30 35 14 51 47 46 29 23 31 42 30 41 28 46 33 28 51 51 19 29 34 38 31 46 31 33 31 30 28 36 32 24 30 26 22 28 33 30 32 31 31 29 30 31 43 30 32 37 31 31 31 33 31 31 31 27 42 31 32 31 33 25 33 31 48 37 29 47 31 39 17 24 36 35 30 28 29 31 47 43 36 37 34 31 37 17 22 18 32 31 47 31 19 19 30 48 41 31 26 24 30 24 10 5 10 28 14 16 44 15 30 22 23 32 27 36 26 33 37 36 28 24 18 27 27 32 32 32 33 32 30 33 24 17 38 14 32 48 18 17 21 34 24 32 33 14 21 12 25 24 21 26 8 14 23 6 13 13 4 9 11 22 32 31 32 22 18 21 30 19 21 16 22 32 33 48 32 19 30 24 19 31 31 29 28 31 32 25 25 8 21 26 21 19 13 19 25 7 21 13 19 14 26 28 13 40 21 11 17 19 18 6 22 23 13 8 4 6 7 27 15 34 13 7 7 18 11 30 14 19 12 8 6 7 9 3 3 3 5 3 27 18 27 21 21 6 28 24 17 10 13 7 12 13 15 9 19 23 21 4 22 6 8 1 3 1 4 13 13 16 5 14 11 21 7 10 17 28 23 25 5 4 5 8 8 10 11 14 7 9 6 5 14 6 4 4 6 10 9 6 3 4 9 15 16 4 2 4 6 11 3 7 11 6 7 8 5 5 9 15 18 17 3 15 9 2 4 11 4 6 7 3 3 3 2 3 4 6 7 10 9 4 5 11 9 7 4 13 2 4 1 3 3 7 4 3 5 27 6 4 15 7 5 8 24 15 3 1 5 5 4 14 25 5 16 18	Open. Hide. 62 47 43 59 62 59 44 62 62 62 62 35 62 59 62 54 43 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 54 59 59 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 56 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 54 58 58 58 58 45 35 58 58 58 58 58 58 54 54 58 58 54 58 58 58 52 58 52 52 46 54 49 58 58 54 48 58 58 58 47 53 58 58 54 54 58 54 58 58 58 54 45 45 54 58 46 52 58 50 50 49 49 40 58 50 58 58 49 50 54 49 58 58 52 58 58 43 58 48 43 33 58 36 32 52 46 51 58 58 49 49 46 40 37 25 42 50 58 33 58 39 32 52 41 43 50 50 58 36 41 58 50 52 51 58 42 51 49 50 51 52 50 53 54 58 49 32 52 52 53 50 46 46 38 58 58 51 51 49 44 53 53 47 50 53 41 41 51 51 49 50 58 53 52 41 38 49 49 39 51 58 58 50 39 32 41 35 36 50 38 53 36 51 52 30 40 34 28 21 32 49 51 50 51 53 53 51 31 33 54 41 40 49 45 53 39 31 35 28 30 51 42 50 39 32 53 54 53 45 45 35 33 52 54 34 29 25 54 54 54 52 34 33 27 33 42 42 52 42 33 39 26 37 45 53 37 31 53 12 54 54 31 18 36 33 54 54 41 37 33 20 31 20 52 52 32 24 48 35 42 32 53 53 31 32 37 33 33 25 31 32 52 31 29 45 35 32 31 35 33 35 31 31 36 31 33 29 14 36 41 31 28 31 35 31 30 42 31 46 27 29 22 31 26 46 22 24 51 46 37 38 39 32 24 45 31 32 36 51 31 37 38 29 33 26 51 51 48 32 6 6 6 23 12 25 21 21 32 28 22 31 23 19 46 48 44 30 33 28 31 31 24 31 27 17 14 9 6 9 25 34 30 14 19 15 27 29 31 32 22 33 30 21 41 39 37 39 41 44 31 35 27 19 17 29 13 28 31 41 24 25 30 17 23 30 31 35 26 14 19 25 27 31 39 37 14 34 25 31 31 27 13 24 10 12 21 32 11 21 19 22 23 25 32 48 31 9 6 47 33 24 31 33 38 15 15 27 18 15 21 19 38 15 19 20 14 27 31 34 30 30 6 17 22 15 33 39 21 20 31 9 43 37 19 20 16 4 6 24 17 11 5 4 15 15 30 32 10 19 15 15 33 33 17 18 10 14 19 21 14 40 29 14 23 26 31 33 32 24 27 23 26 23 21 28 15 7 9 15 11 4 14 24 6 10 28 10 20 17 10 22 7 19 11 13 21 18 14 16 16 12 7 4 3 3 3 4 16 5 12 26 20 5 8 9 8 6 6 9 6 13 9 8 8 10 29 9 7 16 13 9 10 9 14 7 4 6 12 8 11 9 16 6 7 4 9 4 3 4 8 5 19 5 5 4 7 7 5 4 6 7 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_87204005_87205196
seq2: B6Ng01-334M18.b_49_1239 (reverse)

seq1  TTAAAG--TGAA-TGCCTTTCATGGTGTTTTGGTCTTAGAATGACATTGA  47
      ||||||  |||| |||||||||  ||| ||||||| ||||||||||||||
seq2  TTAAAGGTTGAATTGCCTTTCAATGTG-TTTGGTCCTAGAATGACATTGA  49

seq1  G-TTTAAATCTGCACTTGGAGACGA-GTGTCA-CTGT-GTTAAGGCACTT  93
      | ||||| ||||||||| ||||||| |||||| |||| ||||||||||||
seq2  GCTTTAATTCTGCACTT-GAGACGAGGTGTCACCTGTGGTTAAGGCACTT  98

seq1  TTGCTTTTCGAGCACCACCGGTTTTGCTGTGTGACAAGCAAATTCCCTCT  143
      |||| ||||||||||   ||| |||||||||||||||||||||  |||||
seq2  TTGC-TTTCGAGCAC--ACGGGTTTGCTGTGTGACAAGCAAAT--CCTCT  143

seq1  GAGATGGAGTCCCTCTGTCTCCTGCAGCCCTCAAGGCTGTGCTGGAAGTG  193
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GAGATGGAGTCCCTCTGTCT-CTGCAGCCCTCAAGGCTGTGCTGGAAGTG  192

seq1  GACTGAGTTTGCTGTTCAAGCTGCTGCCCTGCTCCAGTGGCATGTATTTC  243
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  GACTGAGTTTGCTGTTCAAGCTGCTG-CCTGCTCCAGTGGCATGTATTTC  241

seq1  TCTGAGTGAATGAGGGGCGGGCTGG-CCACAGGTGGTGCCCAAGGGCATA  292
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TCTGAGTGAATGAGGGGCGGGCTGGCCCACAGGTGGTGCCCAAGGGCATA  291

seq1  CCAGGAAAGGAAGAACAAAGGGATGAGACATCAGAGTTCACAGATCAACT  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGAAAGGAAGAACAAAGGGATGAGACATCAGAGTTCACAGATCAACT  341

seq1  GGCAAGTGCAGGGCTGTCCCGGGTCTTGTCCCCTCCGAACACGATCCCTA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAGTGCAGGGCTGTCCCGGGTCTTGTCCCCTCCGAACACGATCCCTA  391

seq1  ACCCCTAGGGTTTGCCCTCACAGAAGGCCAGTTCAAAAGCTCACTGTTTT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCTAGGGTTTGCCCTCACAGAAGGCCAGTTCAAAAGCTCACTGTTTT  441

seq1  GGGATGAAAAAATCAAATCCTCCGAGAGTTTCTGCCTTTCCTTGAGACTG  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATGAAAAAATCAAATCCTCCGAGAGTTTCTGCCTTTCCTTGAGACTG  491

seq1  GGGATTTACAGTGACTTTGGAAGCAGCTTCTACATTGTGGACAATGAAAA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATTTACAGTGACTTTGGAAGCAGCTTCTACATTGTGGACAATGAAAA  541

seq1  ATGGTTTCAAACAGCACACACATTTTGGACACACAAGAGCAGTCCCAATG  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTTTCAAACAGCACACACATTTTGGACACACAAGAGCAGTCCCAATG  591

seq1  TTAAATAAAACTAACTGAATGCTTTCAATGTTTGATATTATCCCAAGCCA  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATAAAACTAACTGAATGCTTTCAATGTTTGATATTATCCCAAGCCA  641

seq1  GAGATTCCAGATGTCTATGAGGAAGCCGCTGCTTGTGTCTAAACACAATT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATTCCAGATGTCTATGAGGAAGCCGCTGCTTGTGTCTAAACACAATT  691

seq1  AAGAGGGTTTCAAGGTGTCAAGGAGAGAAAAAAAGGTGTGTCCTTCAGTT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGGTTTCAAGGTGTCAAGGAGAGAAAAAAAGGTGTGTCCTTCAGTT  741

seq1  TTCCTAACTTAAAAATAGCGTTAGACCCCCTGTCTTCTGGGGCCACAAGG  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTAACTTAAAAATAGCGTTAGACCCCCTGTCTTCTGGGGCCACAAGG  791

seq1  AGAAGACCCAGAGTGGGCGGTGAGCTGCGTGTGGGTGTGGTCTGCCTTCC  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGACCCAGAGTGGGCGGTGAGCTGCGTGTGGGTGTGGTCTGCCTTCC  841

seq1  TTCCCTCCTAAGCCTCTGGGCTGCCAAGCAGAAAGGATTGAAGCCCAGGA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTCCTAAGCCTCTGGGCTGCCAAGCAGAAAGGATTGAAGCCCAGGA  891

seq1  GCACCCAGTGTGATGGAAACTACAGCCCCCTGTGGCTGCTGTTTATCACT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCCAGTGTGATGGAAACTACAGCCCCCTGTGGCTGCTGTTTATCACT  941

seq1  GCAGACAGAAGTCAGGAATTGTCCCTGTGATGGACGCCAGATGCAAATAA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACAGAAGTCAGGAATTGTCCCTGTGATGGACGCCAGATGCAAATAA  991

seq1  TAACCAGGCTCCCAGCATCTGCCCTTCTGGAACCAGACCTCCCTCCATCT  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCAGGCTCCCAGCATCTGCCCTTCTGGAACCAGACCTCCCTCCATCT  1041

seq1  CTCCTGGACAGCCACTGAGTCACACGTCTTTAAATTCAGATCTTGCCTGC  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGGACAGCCACTGAGTCACACGTCTTTAAATTCAGATCTTGCCTGC  1091

seq1  TGCAAACGCCTCCCCGAGGTTCCATTGTTATGATGATCTGTTTTCCCTCA  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAACGCCTCCCCGAGGTTCCATTGTTATGATGATCTGTTTTCCCTCA  1141

seq1  TAAGATACATTAGGTTTACTTCCATTTTCCTGACTTTATGTGAGGAATTC  1192
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATACATTAGGTTTACTTCCATTTTCCTGACTTTATGTGAGGAATTC  1191

seq1: chr6_87006137_87007264
seq2: B6Ng01-334M18.g_64_1194

seq1  GAATTCATTGTTATTCATAATGGAATCATCACCAACTACAAAGACTTGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTGTTATTCATAATGGAATCATCACCAACTACAAAGACTTGAA  50

seq1  AAAGTTTCTGGTAAGCGAGGTGACCCTGGAAGACGCCGTCTTCTGAGAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTTCTGGTAAGCGAGGTGACCCTGGAAGACGCCGTCTTCTGAGAGT  100

seq1  GGGAGGTAGTTTGTTGGGGTGTGCAGCGTTATGCGGACATGTTCAAGTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGTAGTTTGTTGGGGTGTGCAGCGTTATGCGGACATGTTCAAGTAA  150

seq1  TTACCATAATTATCTCCAGGGTGTGGCGTTTCATTGCATTTCTCTGCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCATAATTATCTCCAGGGTGTGGCGTTTCATTGCATTTCTCTGCTGA  200

seq1  CAGTGGAACAGAATTGATTTCTCTTTTTTTAATAATTTATTTTATTTTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGGAACAGAATTGATTTCTCTTTTTTTAATAATTTATTTTATTTTTA  250

seq1  TTTTATGTGCATTGGTGTCCTGCCTAAATGCACGTGTGTTAGGGTGTCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATGTGCATTGGTGTCCTGCCTAAATGCACGTGTGTTAGGGTGTCAG  300

seq1  AAATTGGGGTTACAGACTGTTGTGAGCCGCCATGTGGTTGCTGGGAATCG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGGGGTTACAGACTGTTGTGAGCCGCCATGTGGTTGCTGGGAATCG  350

seq1  AATCCCAGTCCTCTGGAAGAGCAGTCAGTGCTCCCAAGTGCTGAGCCATC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCCAGTCCTCTGGAAGAGCAGTCAGTGCTCCCAAGTGCTGAGCCATC  400

seq1  TCCAACCCCACAGTTCTGATTCCTTACATGGCATTTTGAGGACAAGCTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACCCCACAGTTCTGATTCCTTACATGGCATTTTGAGGACAAGCTTT  450

seq1  ATTCTGTAGTGTGACAGGGCCATCTCAGTGTCGTCTGTTGAGTTTCTGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGTAGTGTGACAGGGCCATCTCAGTGTCGTCTGTTGAGTTTCTGCA  500

seq1  GTGATGAGAACTCTCTGTATCTAGCATTGTGGGAGCTGTGCCTATAGGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGAGAACTCTCTGTATCTAGCATTGTGGGAGCTGTGCCTATAGGAC  550

seq1  CGCTGAACTGCTCCGACAGAGAAACTGGGTTTTAAGTTTTAGTGTAAATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTGAACTGCTCCGACAGAGAAACTGGGTTTTAAGTTTTAGTGTAAATA  600

seq1  ACCATGCATAGCTAATGGATCTTCATTGGACAGTTGAGGATCACCAAATA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGCATAGCTAATGGATCTTCATTGGACAGTTGAGGATCACCAAATA  650

seq1  ACTGTTGCTCATGAAATTAGTATTTTGAATATTATATATCCTACTATATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTTGCTCATGAAATTAGTATTTTGAATATTATATATCCTACTATATT  700

seq1  TTCATTACAGTTTAATTCATATGCGGCAAATCTAAGTTAAGCCTTTTGAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTACAGTTTAATTCATATGCGGCAAATCTAAGTTAAGCCTTTTGAG  750

seq1  TTGTATTTTGAATTCTCTACAATCAGATTTTAATTTTGATTAAAATTAAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATTTTGAATTCTCTACAATCAGATTTTAATTTTGATTAAAATTAAT  800

seq1  TTTAATTATTTTATTAACTATATTAATTGATTCTTATTTATTAAATTTGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTATTTTATTAACTATATTAATTGATTCTTATTTATTAAATTTGC  850

seq1  CATTATAAATTAA-TTTTTAGGTAATTTAAATTTTGAGTAGAATAAATTC  899
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  CATTATAAATTAATTTTTTAGGTAATTTAAATTTTGAGTAGAATAAATTC  900

seq1  AGTATGACATCAAAAAAAGTTAGTAATTAGTAAGATCTATTAGGTTGATG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATGACATCAAAAAAAGTTAGTAATTAGTAAGATCTATTAGGTTGATG  950

seq1  AGGTGACTCAGTGGGTAAAGCGGTTGCCAGCGGACAGCGGTGAGTTTGTT  999
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AGGTGACTCAGTGGGTAAAGCGGTTGCCAGCGGACAGCGGTGAGTTTG-T  999

seq1  CCCTGAAACCCACAGAAAGGTGGACAGCTAAAGCTGATGATGCCTCATGG  1049
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGAACCCCACAGAAAGGTGGACAGCTAAAGCTGATGATGCCTCATGG  1049

seq1  TGGTCCTCTAA-CCCTCAAGCACACACCATGGT-GACACATTTAGCCTGT  1097
      ||||||||||| ||||||||||||||||||||| ||| ||||   |||||
seq2  TGGTCCTCTAATCCCTCAAGCACACACCATGGTGGACCCATTAGCCCTGT  1099

seq1  ACTTACA-GACC-TACACACGCATATATGTGTG  1128
      ||||||| |||| |||||||||||||| |||||
seq2  ACTTACAGGACCTTACACACGCATATA-GTGTG  1131

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information