MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-057B07
Chromosome	6 (Build37)
Map Location	57,959,314 - 57,959,972
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG434016, V1rc32, V1rc30, V1rc1, V1rc3, EG626397, V1rc4, V1rc5, V1rc7, V1rc6, LOC100041445, V1r-ps6, V1rc29, V1rc16, V1rc26, V1rc27, EG434017, LOC666822, Ppm1k, Herc5, Pigy, Lancl2, AW146242, V1rc28, LOC626582, V1rc23, V1rc24, LOC100041514, V1rc18, V1rc8, V1rc17
Downstream gene	EG633683, LOC626649, LOC626659, LOC626672, LOC666893, LOC100041571, V1rc33, LOC626724, V1rc25, V1rc2, LOC666928, V1rc22, LOC626817, EG626828, LOC666954, Abcg2, Herc3, Nap1l5, D430015B01Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG434016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434016 MGI:3644380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 Proteins

name	V1rc32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171205 MGI:2159469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171203 MGI:2159466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113858 MGI:2148522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113860 MGI:2148524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626397 MGI:3645555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 Proteins

name	V1rc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113861 MGI:2148525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	V1rc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113862 MGI:2148526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113864 MGI:2148528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113863 MGI:2148527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	V1r-ps6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113874 MGI:2148536
definition	note : vomeronasal 1 receptor, pseudogene 6 pseudo : _no_value

name	V1rc29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171202 MGI:2159465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171189 MGI:2159452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171199 MGI:2159462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171200 MGI:2159463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434017 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434017 MGI:3644381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 Proteins

name	LOC666822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppm1k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243382 MGI:2442111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Herc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 62 ESTs, 3 Proteins

name	Pigy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66459 MGI:1913709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lancl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71835 MGI:1919085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW146242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232023 MGI:2141658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171201 MGI:2159464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626582 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 Proteins

name	V1rc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171196 MGI:2159459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171197 MGI:2159460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	V1rc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171191 MGI:2159454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113865 MGI:2148529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171190 MGI:2159453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG633683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633683 MGI:3647234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 910 ESTs, 7 Proteins

name	LOC626649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins pseudo : _no_value

name	LOC626659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins pseudo : _no_value

name	LOC626672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC666893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1rc33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171206 MGI:2159470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	V1rc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171198 MGI:2159461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113859 MGI:2148523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666928 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 Proteins pseudo : _no_value

name	V1rc22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171195 MGI:2159458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG626828 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626828 MGI:3649162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 Proteins

name	LOC666954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Abcg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26357 MGI:1347061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Herc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73998 MGI:1921248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nap1l5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58243 MGI:1923555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430015B01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58909 MGI:1889842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255142 GeneID:434016 MGI:3644380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 Proteins product : predicted gene, EG434016 transcript_id : XM_620311.3

name	V1rc32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821673 GeneID:171205 MGI:2159469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C32 transcript_id : NM_134187.3

name	V1rc30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717698 GeneID:171203 MGI:2159466
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C30 transcript_id : NM_134185.1

name	V1rc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200346 GeneID:113858 MGI:2148522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C1 transcript_id : NM_053231.2

name	V1rc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716548 GeneID:113860 MGI:2148524
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C3 transcript_id : NM_053233.1

name	EG626397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82901075 GeneID:626397 MGI:3645555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 Proteins product : predicted gene, EG626397 transcript_id : XM_890986.1

name	V1rc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611162 GeneID:113862 MGI:2148526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C5 transcript_id : NM_053235.2

name	V1rc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611160 GeneID:113864 MGI:2148528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C7 transcript_id : NM_053237.2

name	V1rc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716554 GeneID:113863 MGI:2148527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C6 transcript_id : NM_053236.1

name	V1rc29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611911 GeneID:171202 MGI:2159465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C29 transcript_id : NM_134184.2

name	V1rc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717670 GeneID:171189 MGI:2159452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C16 transcript_id : NM_134171.1

name	V1rc26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717690 GeneID:171199 MGI:2159462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C26 transcript_id : NM_134181.1

name	V1rc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717684 GeneID:171200 MGI:2159463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C27 transcript_id : NM_134182.1

name	EG434017 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51711991 GeneID:434017 MGI:3644381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 Proteins product : predicted gene, EG434017 transcript_id : XM_485760.1

name	Ppm1k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130282 GeneID:243382 MGI:2442111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1K (PP2C domain containing) transcript_id : NM_175523.4

name	Herc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255197 GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 61 ESTs, 3 Proteins product : hect domain and RLD 5, transcript variant 1 transcript_id : XM_001478484.1

name	Herc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255199 GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 1 Protein product : hect domain and RLD 5, transcript variant 2 transcript_id : XM_001478497.1

name	Pigy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133930791 GeneID:66459 MGI:1913709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class Y transcript_id : NM_025574.3

name	Lancl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526935 GeneID:71835 MGI:1919085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LanC (bacterial lantibiotic synthetase component C)-like 2 transcript_id : NM_133737.1

name	AW146242 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122698 GeneID:232023 MGI:2141658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW146242 transcript_id : NM_146168.1

name	V1rc28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717694 GeneID:171201 MGI:2159464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C28 transcript_id : NM_134183.1

name	LOC626582 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255147 GeneID:626582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 Proteins product : similar to vomeronasal receptor V1RC18 transcript_id : XM_001476469.1

name	V1rc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717676 GeneID:171196 MGI:2159459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C23 transcript_id : NM_134178.1

name	V1rc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717686 GeneID:171197 MGI:2159460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C24 transcript_id : NM_134179.1

name	V1rc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717674 GeneID:171191 MGI:2159454
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C18 transcript_id : NM_134173.1

name	V1rc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611164 GeneID:113865 MGI:2148529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C8 transcript_id : NM_053238.2

name	V1rc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717664 GeneID:171190 MGI:2159453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C17 transcript_id : NM_134172.1

name	EG633683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377389 GeneID:633683 MGI:3647234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 909 ESTs, 7 Proteins product : predicted gene, EG633683 transcript_id : XM_986705.1

name	V1rc33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717792 GeneID:171206 MGI:2159470
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C33 transcript_id : NM_134436.1

name	V1rc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717680 GeneID:171198 MGI:2159461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C25 transcript_id : NM_134180.1

name	V1rc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716546 GeneID:113859 MGI:2148523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C2 transcript_id : NM_053232.1

name	V1rc22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717682 GeneID:171195 MGI:2159458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C22 transcript_id : NM_134177.1

name	EG626828 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255150 GeneID:626828 MGI:3649162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 Proteins product : predicted gene, EG626828 transcript_id : XM_891437.2

name	Abcg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815847 GeneID:26357 MGI:1347061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family G (WHITE), member 2 transcript_id : NM_011920.3

name	Herc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27777641 GeneID:73998 MGI:1921248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hect domain and RLD 3 transcript_id : NM_028705.2

name	Nap1l5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946797 GeneID:58243 MGI:1923555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 5 transcript_id : NM_021432.1

name	D430015B01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887799 GeneID:58909 MGI:1889842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430015B01 gene transcript_id : NM_153574.2

name	EG434016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255143 GeneID:434016 MGI:3644380
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC31 protein_id : XP_620311.3

name	V1rc32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717693 CCDS:CCDS20174.1 GeneID:171205 MGI:2159469
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal 1 receptor, C30 product : vomeronasal 1 receptor, C32 protein_id : NP_598948.1

name	V1rc30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717699 GeneID:171203 MGI:2159466
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C30 protein_id : NP_598946.1

name	V1rc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200347 GeneID:113858 MGI:2148522
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C1 protein_id : NP_444461.2

name	V1rc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716549 CCDS:CCDS20175.1 GeneID:113860 MGI:2148524
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C3 protein_id : NP_444463.1

name	EG626397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901076 GeneID:626397 MGI:3645555
definition	codon_start : 1 product : similar to vomeronasal 1 receptor, C7 protein_id : XP_896079.1

name	V1rc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611163 CCDS:CCDS20176.1 GeneID:113862 MGI:2148526
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C5 protein_id : NP_444465.2

name	V1rc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611161 CCDS:CCDS20177.1 GeneID:113864 MGI:2148528
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C7 protein_id : NP_444467.2

name	V1rc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716555 CCDS:CCDS20178.1 GeneID:113863 MGI:2148527
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C6 protein_id : NP_444466.1

name	V1rc29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611912 CCDS:CCDS20179.1 GeneID:171202 MGI:2159465
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C29 protein_id : NP_598945.2

name	V1rc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717671 CCDS:CCDS20180.1 GeneID:171189 MGI:2159452
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C16 protein_id : NP_598932.1

name	V1rc26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717691 CCDS:CCDS20181.1 GeneID:171199 MGI:2159462
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C26 protein_id : NP_598942.1

name	V1rc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717685 CCDS:CCDS20182.1 GeneID:171200 MGI:2159463
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C27 protein_id : NP_598943.1

name	EG434017 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901084 GeneID:434017 MGI:3644381
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC33 protein_id : XP_485760.3

name	Ppm1k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425290 CCDS:CCDS20183.1 GeneID:243382 MGI:2442111
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] codon_start : 1 product : protein phosphatase 1K (PP2C domain containing) protein_id : NP_780732.1

name	Herc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255198 GeneID:67138 MGI:1914388
definition	codon_start : 1 product : hect domain and RLD 5 isoform 1 protein_id : XP_001478534.1

name	Herc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255200 GeneID:67138 MGI:1914388
definition	codon_start : 1 product : hect domain and RLD 5 isoform 2 protein_id : XP_001478547.1

name	Pigy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313456 CCDS:CCDS20184.1 GeneID:66459 MGI:1913709
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000506 - glycosylphosphatidylinositol-N- acetylglucosaminyltransferase (GPI-GnT) complex [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0009893 - positive regulation of metabolism [Evidence ISS] codon_start : 1 note : phosphatidylinositol glycan, class Y product : pre-Y homolog protein_id : NP_079850.1

name	Lancl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526936 CCDS:CCDS20185.1 GeneID:71835 MGI:1919085
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0031179 - peptide modification [Evidence ISS] codon_start : 1 product : LanC (bacterial lantibiotic synthetase component C)-like 2 protein_id : NP_598498.1

name	AW146242 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122699 GeneID:232023 MGI:2141658
definition	codon_start : 1 product : hypothetical protein LOC232023 protein_id : NP_666280.1

name	V1rc28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717695 CCDS:CCDS20186.1 GeneID:171201 MGI:2159464
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C28 protein_id : NP_598944.1

name	LOC626582 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255148 GeneID:626582
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC18 protein_id : XP_001476519.1

name	V1rc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717677 CCDS:CCDS20187.1 GeneID:171196 MGI:2159459
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C23 protein_id : NP_598939.1

name	V1rc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717687 GeneID:171197 MGI:2159460
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C24 protein_id : NP_598940.1

name	V1rc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717675 CCDS:CCDS20188.1 GeneID:171191 MGI:2159454
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C18 protein_id : NP_598934.1

name	V1rc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611165 CCDS:CCDS20189.1 GeneID:113865 MGI:2148529
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C8 protein_id : NP_444468.2

name	V1rc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717665 CCDS:CCDS20190.1 GeneID:171190 MGI:2159453
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C17 protein_id : NP_598933.1

name	EG633683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377390 GeneID:633683 MGI:3647234
definition	codon_start : 1 product : similar to insulinoma protein (rig) protein_id : XP_991799.1

name	V1rc33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717793 CCDS:CCDS20192.1 GeneID:171206 MGI:2159470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C33 protein_id : NP_602318.1

name	V1rc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717681 CCDS:CCDS20193.1 GeneID:171198 MGI:2159461
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C25 protein_id : NP_598941.1

name	V1rc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716547 CCDS:CCDS20194.1 GeneID:113859 MGI:2148523
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C2 protein_id : NP_444462.1

name	V1rc22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717683 GeneID:171195 MGI:2159458
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 note : vomeronasal 1 receptor, C9 product : vomeronasal 1 receptor, C22 protein_id : NP_598938.1

name	EG626828 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255151 GeneID:626828 MGI:3649162
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC16 protein_id : XP_896530.2

name	Abcg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752944 CCDS:CCDS20195.1 GeneID:26357 MGI:1347061
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitoxantrone resistance protein 1 product : ATP-binding cassette, sub-family G, member 2 protein_id : NP_036050.1

name	Herc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777642 CCDS:CCDS20196.1 GeneID:73998 MGI:1921248
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hect domain and RLD 3 protein_id : NP_082981.2

name	Nap1l5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946798 CCDS:CCDS20197.1 GeneID:58243 MGI:1923555
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : nucleosome assembly protein 1-like 5 protein_id : NP_067407.1

name	D430015B01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956368 GeneID:58909 MGI:1889842
definition	codon_start : 1 product : family with sequence similarity 13, member A1 protein_id : NP_705802.1

name	V1rc4 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:113861
definition	number : 1 pseudo : _no_value

name	V1rc4 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:113861
definition	number : 2 pseudo : _no_value

name	LOC100041445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041445
definition	number : 1 pseudo : _no_value

name	LOC100041445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041445
definition	number : 2 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 3 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 2 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 1 pseudo : _no_value

name	LOC100041514 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041514
definition	number : 1 pseudo : _no_value

name	LOC626649 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626649
definition	number : 1 pseudo : _no_value

name	LOC626659 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626659
definition	number : 1 pseudo : _no_value

name	LOC626672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626672
definition	number : 1 pseudo : _no_value

name	LOC626672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626672
definition	number : 2 pseudo : _no_value

name	LOC666893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666893
definition	number : 1 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 1 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 2 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 3 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 4 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 5 pseudo : _no_value

name	LOC626724 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626724
definition	number : 1 pseudo : _no_value

name	LOC626817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626817
definition	number : 1 pseudo : _no_value

name	LOC666954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666954
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:489279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492639
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492639
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487396
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495552
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488214
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494018
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490618
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495553
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487397
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493142
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494239
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484927
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492638
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484926
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495563
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492643
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159512
definition	standard_name : AI451296

name	(CDS detail)
type	STS
link
xref	UniSTS:130870
definition	standard_name : D6Mit317

name	(CDS detail)
type	STS
link
xref	UniSTS:179380
definition	standard_name : AI847956

name	(CDS detail)
type	STS
link
xref	UniSTS:179381
definition	standard_name : AW146242

name	(CDS detail)
type	STS
link
xref	UniSTS:235454
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491563
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130937
definition	standard_name : D6Mit385

name	(CDS detail)
type	STS
link
xref	UniSTS:494238
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495334
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492637
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:152622
definition	standard_name : D11S3380

name	(CDS detail)
type	STS
link
xref	UniSTS:494019
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487437
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488215
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488286
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489276
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:479302
definition	standard_name : V1rc17

name	(CDS detail)
type	STS
link
xref	UniSTS:125061
definition	standard_name : MHAa15b9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:236108
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492643
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484926
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494017
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488213
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494024
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487437
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488215
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125061
definition	standard_name : MHAa15b9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:225011
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159513
definition	standard_name : AI428558

name	(CDS detail)
type	STS
link
xref	UniSTS:220668
definition	standard_name : RH138581

name	(CDS detail)
type	STS
link
xref	UniSTS:179382
definition	standard_name : AI646603

name	(CDS detail)
type	STS
link
xref	UniSTS:271813
definition	standard_name : PMC196544P2

name	(CDS detail)
type	STS
link
xref	UniSTS:250383
definition	standard_name : AI409755

name	(CDS detail)
type	STS
link
xref	UniSTS:159509
definition	standard_name : AI462012

name	(CDS detail)
type	STS
link
xref	UniSTS:235455
definition

name	LOC666928 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255201 GeneID:666928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 Proteins product : similar to vomeronasal receptor V1RC18 pseudo : _no_value transcript_id : XR_033790.1

clone name	MSMg01-506N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-334D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-533F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-189P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-391F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-153L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-367M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-401P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144K02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-057B07.T7 (MSMg01no057_b07.b1)	MSMg01-057B07.TJ (MSMg01no057_b07.g1)
ACC	AG284328	AG284329
length	705	710
length of high quality (start - end)	661 (45 - 705)	634 (77 - 710)
definition	CHROMAT_FILE: MSMg01no057_b07.b1 PHD_FILE: MSMg01no057_b07.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:58:54 2005	CHROMAT_FILE: MSMg01no057_b07.g1 PHD_FILE: MSMg01no057_b07.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 16:58:54 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCACAAAGGGTTCTAATTGGATGAGAACTAAACTGGACTCATCTAGAC TCATTTAGAACCATGTTGCTAATACAATTAATTGGTTCTGGAAGTTACAC TAATGGTCTTCCACTGTATCTATGTTTGTCATTCGAGATTCTGAGAATGT AAGATTTCATGAGAAAAGAAACATTAAAAAGGATGAATTGAGATAGACCC TTGCTGATTAAAACTGTAATATTATTATGAATTATGACTGAGATTCCATG AGAATCATGCATTAAAATATGGATAATTGCAAAATAGAGCACAATAAAAT TATACAGTATGATATATTCACATCTAATTTTTTGAATATCTTCTATGATT TTCCCCCAGCTGACCACAGTGTTTATACATTTGTACAAATGTGATTGATC TTCTATGCTCATTACTACTGTTTTAGTTAAGTATAAAATGAGCCAATTTA AAGCAATAGGGTTGTATTTTAAAAGTACCAGTCTCAGGTGCACTACAGAA ACACAAAGTGTGTATTCTGTGTAGATATGACTCTAAGTACATTCATTGTC CAAAATATTCTCTCTATATAAGAAATACTTGGAGGGTATATAGAAATGTA GGATATAGCTAATATGACAATCAAAAAATAAACATCTTACTCAAGAATTA TTAGG	TCAATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXAAGAAATTAGACACCAACAAGCCA AATACTCAAGTAAAAAGAGGAGTACTCAGTTATACAGAGAATTCTCAACA GAGAAATCTCTAATGACCAAGAAACACTTAAAGATATGTTCAACATCCTT ACAGATCATGGAAATGCAAATCAAAACATTTCTGAAATTCCATCTTACAT ATTTCAGAATGGCTAAGATCAAAATCACAGGAGATAGCATACACTGCTGA GGATATGCATCAAGGGGAACACTCCTCCATTGATGATGGGAGAGGAAACT GGTATAACCACGTTGGAGATCAATTTGTTTCTTACAAACAATTGAGAAGG GTTCTACCCCAAGATCTAAACATATTATTTCTGGGAATAAACCCATAAGA TGCTCCATTCTATACAAGGACACTTGCTCAGTTTATGTTCATAGAAGTTT TATTCTTAATAGCTATTAACTAGAAACAACCTAAATGTCCTTTTATATAA GATTAGATAAAGAAAATGTAGTTCATTTACAGAGCAGAATACCACTTGGC TATCAAATCAAGGATATCATGAAATTGACATGCAGATATATGCAACTAGA AATATCATTATGAGTGATATAACCTAAACAGAGAAAGACAAACATGGCAT ACTCTTAATT
quality values	Open. Hide. 8 8 8 8 8 8 15 26 33 33 29 27 25 22 15 21 12 3 0 3 13 19 23 41 27 28 26 22 18 19 13 9 11 12 9 11 11 11 11 13 13 21 19 21 25 26 32 34 36 36 33 36 34 34 34 34 34 37 42 40 18 17 9 11 11 11 11 16 21 26 36 36 41 42 42 42 48 48 48 48 48 48 48 47 47 47 47 50 48 42 41 41 41 41 36 57 57 57 44 42 46 47 47 57 42 68 68 48 48 36 37 47 47 48 50 57 57 54 54 54 57 57 50 42 41 41 50 50 68 68 68 68 50 50 50 50 41 50 57 57 57 50 68 68 57 57 57 52 52 52 52 57 57 51 50 50 37 43 50 50 52 52 41 41 47 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 43 43 35 35 42 42 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 57 57 44 44 52 45 45 44 44 62 62 62 62 62 62 62 62 62 52 52 52 44 47 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 43 52 43 62 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 43 44 43 62 44 44 43 52 45 62 44 62 62 62 44 44 43 52 52 62 62 68 68 62 62 62 62 62 62 62 44 44 35 35 35 43 44 62 62 62 62 52 52 62 52 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 39 62 62 62 62 62 62 62 68 68 68 62 68 68 62 62 62 62 62 52 52 52 62 52 52 62 62 62 62 62 62 62 62 68 68 62 62 68 62 62 62 62 62 62 62 43 43 39 35 31 35 43 43 62 62 62 62 52 52 52 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 57 57 57 57 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 57 59 57 52 52 57 57 57 57 52 52 52 52 57 57 57 57 57 57 57 57 57 57 52 52 52 52 52 52 52 52 52 52 52 57 57 57 59 59 59 59 57 54 52 57 52 52 52 57 52 52 43 50 43 50 44 43 33 33 32 43 43 50 50 48 48 50 57 57 57 48 48 44 57 41 30 30 21 21 24 32 24 32 29 33 41 28 28 41 41 44 57 37 44 42 47 57 47 41 31 36 36 30 41 41 48 44 42 43 37 42 37 37 42 39 35 35 37 39 43 43 39 42 42 48 47 40 43 43 35 32 30 30 30 28 34 29 37 30 30 30 43 37 46 41 41 39 39 29 29 32 30 24 20 18 18 25 32 43 43 43 37 37 37 37 37 37 35 31 31 35 37 41 41 33 33 28 28 33 37 39 39 15 15 6 6 6 15 15 18 23 22 19 32 37 37 37 37 46 46 34 34 23 31 34 39 37 27 30 16 16 15 19 12 16 24 34 34 34 23 23 11 11	Open. Hide. 6 6 7 7 8 8 8 8 8 7 7 9 7 10 10 21 20 32 37 37 41 41 37 37 37 37 37 41 32 24 22 9 9 9 11 9 11 11 8 9 10 10 14 10 18 11 15 27 32 31 31 35 31 28 28 33 33 30 21 19 10 9 9 11 10 10 13 13 13 19 19 33 33 30 31 28 28 28 35 36 36 50 37 37 37 37 30 29 34 42 42 37 42 36 36 40 40 36 36 42 48 48 57 48 48 47 43 43 48 48 68 68 68 68 50 50 50 48 48 42 38 36 26 22 30 27 26 26 38 41 57 57 57 47 47 47 50 50 46 50 48 42 41 42 47 48 47 50 50 50 57 57 59 51 42 42 41 50 50 54 54 57 57 57 57 50 50 52 57 57 57 57 57 57 57 57 57 57 57 57 68 50 50 50 46 46 48 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 52 52 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 68 68 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 44 43 43 43 39 39 43 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 68 68 68 68 68 62 68 62 62 52 62 62 62 62 62 62 62 52 44 44 31 31 31 35 35 35 43 57 57 57 57 59 68 59 59 57 57 57 57 57 52 52 52 57 57 52 52 52 57 57 57 52 43 43 43 43 57 59 44 57 52 57 52 57 52 57 52 57 57 57 57 52 52 52 57 57 57 57 57 52 52 52 57 57 57 57 57 57 57 59 52 52 52 52 52 52 54 52 52 44 57 43 44 43 59 59 57 57 57 57 57 50 44 44 43 44 44 44 43 43 44 57 47 54 48 48 44 46 37 57 44 57 57 57 57 57 57 43 43 43 43 43 43 43 43 43 46 46 54 57 47 47 54 54 46 46 46 42 42 39 39 35 37 37 37 35 39 39 48 46 40 40 25 25 23 32 28 35 36 43 43 48 48 48 48 48 48 46 46 41 37 37 30 24 19 24 28 32 39 37 37 32 33 32 26 25 30 28 34 28 28 23 25 22 27 25 30 25 25 32 28 35 37 39 39 40 40 43 43 43 39 39 37 43 43 43 43 39 31 26 19 15 15 24 29 35 35 32 37 28 30 30 37 37 32 32 28 31 28 28 28 28 34 34 15 15 8 8 8 15 22 36 37 37 33 33 33 33 33 33 31 33 28 28 28 33 37 37 31 28 28 19 19 25 34 25 24 20 28 23 23 20 19 18 23 23 22 30 32 39 36 40 39 34 34 25 20

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no057_b07.b1 MSMg01no057_b07.b1 CHROMAT_FILE:
MSMg01no057_b07.b1 PHD_FILE: MSMg01no057_b07.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 16:58:54 2005
         (661 letters)



>mm_chr6_57959111_57960172
          Length = 1062

 Score = 1228 bits (635), Expect = 0.0
 Identities = 653/659 (99%), Gaps = 1/659 (0%)
 Strand = Plus / Minus

                                                                       
Query: 4   ggaattcacaaagggttctaattggatgagaactaaactggactcatctagactcattta 63
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 862 ggaattcacaaagggttttaattggatgagaactaaactggactcatctagactcattta 803

                                                                       
Query: 64  gaaccatgttgctaatacaattaattggttctggaagttacactaatggtcttccactgt 123
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 802 gaaccatgttgctaatacaattaattggttctggaagttacactaatggtcttccactgt 743

                                                                       
Query: 124 atctatgtttgtcattcgagattctgagaatgtaagatttcatgagaaaagaaacattaa 183
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 742 atctatgtttgtcattcaagattctgagaatgtaagatttcatgagaaaagaaacattaa 683

                                                                       
Query: 184 aaaggatgaattgagatagacccttgctgattaaaactgtaatattattatgaattatga 243
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 682 aaagaatgaattgagatagacccttgctgattaaaactgtaatattattatgaattatga 623

                                                                       
Query: 244 ctgagattccatgagaatcatgcattaaaatatggataattgcaaaatagagcacaataa 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 622 ctgagattccatgagaatcatgcattaaaatatggataattgcaaaatagagcacaataa 563

                                                                       
Query: 304 aattatacagtatgatatattcacatctaattttttgaatatcttctatgattttccccc 363
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 562 aattatacagtatgatatattcacatctaattttttgaatatcttctatgattttccccc 503

                                                                       
Query: 364 agctgaccacagtgtttatacatttgtacaaatgtgattgatcttctatgctcattacta 423
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 502 agctgaccacagtgtttatacatttgtacaaatgtgattgatcttctatgctcattacta 443

                                                                       
Query: 424 ctgttttagttaagtataaaatgagccaatttaaagcaatagggttgtattttaaaagta 483
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 442 ctgttttagttaagtataaaatgagccagtttaaagcaatagggttgtattttaaaagta 383

                                                                       
Query: 484 ccagtctcaggtgcactacagaaacacaaagtgtgtattctgtgtagatatgactctaag 543
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 382 ccagtctcaggtgcactacagaaacacaaagtgtgtattctgtgtagatatgactctaag 323

                                                                       
Query: 544 tacattcattgtccaaaatattctctctatataagaaatacttggagggtatatagaaat 603
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 322 tacattcattgtccaaaatattctctctatataagaaatacttggagggtatatagaaat 263

                                                                      
Query: 604 gtaggatatagctaatatg-acaatcaaaaaataaacatcttactcaagaattattagg 661
           ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||
Sbjct: 262 gtaggatatagctaatatgaaaaatcaaaaaataaacatcttactcaagaattattagg 204


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 33
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 661
Length of database: 1062
Length adjustment: 10
Effective length of query: 651
Effective length of database: 1052
Effective search space:   684852
Effective search space used:   684852
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information