MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-079A05
Chromosome	6 (Build37)
Map Location	131,367,795 - 131,368,439
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG625473, LOC640779, LOC667793, EG667798, EG625558, LOC625566, EG636947, LOC625628, EG625648, LOC667830, EG434094, Klra2, LOC434095, 2010012C16Rik, Styk1, Csda
Downstream gene	LOC625758, 5430401F13Rik, LOC625781, Tas2r130, Tas2r107, Tas2r106, Tas2r104, Tas2r105, Tas2r114, LOC639802, EG114600, Prb1, LOC631126, LOC100043878, Prpmp5, EG667929
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG625473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625473 MGI:3645685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC640779 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG667798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667798 MGI:3648641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG625558 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625558 MGI:3643376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	LOC625566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636947 MGI:3648824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC625628 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG625648 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625648 MGI:3645795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	LOC667830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG434094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434094 MGI:3643462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Klra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16633 MGI:101906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434095
definition	note : protein tyrosine phosphatase 4a1-like pseudo : _no_value

name	2010012C16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66441 MGI:1913691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Styk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243659 MGI:2141396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC625758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	5430401F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71392 MGI:1918642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC625781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins

name	Tas2r130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387355 MGI:2681278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387342 MGI:2681207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387341 MGI:2681203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387340 MGI:2681185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57252 MGI:2681195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387346 MGI:2681218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG114600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114600 MGI:3647826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381833 MGI:2681872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043878 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Prpmp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381832 MGI:1927478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667929 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667929 MGI:3645847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins

name	EG667798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255345 GeneID:667798 MGI:3648641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG667798 transcript_id : XM_992538.2

name	EG625558 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378143 GeneID:625558 MGI:3643376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : predicted gene, EG625558 transcript_id : XM_890142.2

name	LOC625566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255347 GeneID:625566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to novel KRAB box domain containing protein transcript_id : XM_001480523.1

name	EG636947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255349 GeneID:636947 MGI:3648824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG636947 transcript_id : XM_912516.3

name	EG434094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255352 GeneID:434094 MGI:3643462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG434094 transcript_id : XM_485832.5

name	Klra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803076 GeneID:16633 MGI:101906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 2 transcript_id : NM_008462.4

name	2010012C16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384147 GeneID:66441 MGI:1913691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010012C16 gene transcript_id : NM_025564.2

name	Styk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129934 GeneID:243659 MGI:2141396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine/tyrosine kinase 1 transcript_id : NM_172891.2

name	Csda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059498 GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold shock domain protein A transcript_id : NM_011733.2

name	Csda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059494 GeneID:56449 MGI:2137670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold shock domain protein A transcript_id : NM_139117.2

name	LOC625758 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94378154 GeneID:625758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : similar to M199.5 transcript_id : XM_132900.5

name	5430401F13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378155 GeneID:71392 MGI:1918642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 5430401F13 gene transcript_id : XM_355820.3

name	LOC625781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255356 GeneID:625781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : similar to HMG-L6 transcript_id : XM_890347.2

name	Tas2r130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255296 GeneID:387355 MGI:2681278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 130 transcript_id : NM_199156.1

name	Tas2r107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255292 GeneID:387342 MGI:2681207
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 107 transcript_id : NM_199154.1

name	Tas2r106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309586 GeneID:387341 MGI:2681203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 106 transcript_id : NM_207016.1

name	Tas2r104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46275827 GeneID:387340 MGI:2681185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 104 transcript_id : NM_207011.1

name	Tas2r105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048425 GeneID:57252 MGI:2681195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 105 transcript_id : NM_020501.1

name	Tas2r114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309590 GeneID:387346 MGI:2681218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 114 transcript_id : NM_207019.1

name	EG114600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716578 GeneID:114600 MGI:3647826
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG114600 transcript_id : NM_053251.1

name	Prb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348571 GeneID:381833 MGI:2681872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich protein BstNI subfamily 1 transcript_id : NM_198669.1

name	LOC631126 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255121 GeneID:631126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC631126 transcript_id : XM_001471698.1

name	LOC100043878 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255443 GeneID:100043878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043878 transcript_id : XM_001481153.1

name	Prpmp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089301 GeneID:381832 MGI:1927478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich protein MP5 transcript_id : NM_001024705.2

name	EG667929 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255445 GeneID:667929 MGI:3645847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins product : predicted gene, EG667929 transcript_id : XM_993286.2

name	EG667798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255346 GeneID:667798 MGI:3648641
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_997632.2

name	EG625558 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029991 GeneID:625558 MGI:3643376
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_895235.1

name	LOC625566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255348 GeneID:625566
definition	codon_start : 1 product : similar to novel KRAB box domain containing protein protein_id : XP_001480573.1

name	EG636947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255350 GeneID:636947 MGI:3648824
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_917609.3

name	EG434094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255353 GeneID:434094 MGI:3643462
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_485832.5

name	Klra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538840 CCDS:CCDS20603.1 GeneID:16633 MGI:101906
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : killer cell lectin-like receptor subfamily A member 30 product : killer cell lectin-like receptor, subfamily A, member 2 protein_id : NP_032488.3

name	2010012C16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385002 GeneID:66441 MGI:1913691
definition	codon_start : 1 product : mago-nashi homolog protein_id : NP_079840.1

name	Styk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370362 CCDS:CCDS20604.1 GeneID:243659 MGI:2141396
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : NOK kinase protein_id : NP_766479.1

name	Csda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806532 CCDS:CCDS20605.1 GeneID:56449 MGI:2137670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y box protein 3; DNA-binding protein A product : cold shock domain protein A short isoform protein_id : NP_035863.1

name	Csda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059495 CCDS:CCDS20606.1 GeneID:56449 MGI:2137670
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Y box protein 3; DNA-binding protein A product : cold shock domain protein A long isoform protein_id : NP_620817.2

name	LOC625758 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38085318 GeneID:625758
definition	codon_start : 1 product : hypothetical protein protein_id : XP_132900.2

name	5430401F13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085320 GeneID:71392 MGI:1918642
definition	codon_start : 1 product : hypothetical protein LOC71392 protein_id : XP_355820.1

name	LOC625781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255357 GeneID:625781
definition	codon_start : 1 product : similar to HMG-L6 protein_id : XP_895440.2

name	Tas2r130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255297 CCDS:CCDS20608.1 GeneID:387355 MGI:2681278
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS] codon_start : 1 product : taste receptor, type 2, member 130 protein_id : NP_954607.1

name	Tas2r107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255293 CCDS:CCDS20609.1 GeneID:387342 MGI:2681207
definition	GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence TAS] codon_start : 1 product : taste receptor, type 2, member 107 protein_id : NP_954605.1

name	Tas2r106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309587 CCDS:CCDS20610.1 GeneID:387341 MGI:2681203
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 106 protein_id : NP_996899.1

name	Tas2r104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46275828 CCDS:CCDS20611.1 GeneID:387340 MGI:2681185
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 104 protein_id : NP_996894.1

name	Tas2r105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048426 CCDS:CCDS20612.1 GeneID:57252 MGI:2681195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050913 - sensory perception of bitter taste [Evidence IMP]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : taste receptor T2R5; candidate taste receptor T2R5 product : taste receptor, type 2, member 105 protein_id : NP_065247.1

name	Tas2r114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309591 CCDS:CCDS20613.1 GeneID:387346 MGI:2681218
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : taste receptor, type 2, member 114 protein_id : NP_996902.1

name	EG114600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716579 GeneID:114600 MGI:3647826
definition	codon_start : 1 exception : unclassified translation discrepancy note : proline-rich protein product : proline rich protein MP4 protein_id : NP_444481.1

name	Prb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348572 CCDS:CCDS20614.1 GeneID:381833 MGI:2681872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : proline-rich proteoglycan 2 protein_id : NP_941071.1

name	LOC631126 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255122 GeneID:631126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471748.1

name	LOC100043878 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255444 GeneID:100043878
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481203.1

name	Prpmp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089302 GeneID:381832 MGI:1927478
definition	codon_start : 1 note : proline-rich protein PRP MP5 product : proline-rich protein MP5 protein_id : NP_001019876.2

name	EG667929 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255446 GeneID:667929 MGI:3645847
definition	codon_start : 1 product : similar to proline-rich salivary protein protein_id : XP_998380.2

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 6 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 5 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 4 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 3 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 2 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 1 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 5 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 4 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 3 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 2 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 1 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 1 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 2 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 3 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 6 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 5 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 4 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 3 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 2 pseudo : _no_value

name	LOC625628 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625628
definition	number : 1 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 1 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 2 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 3 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 4 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 5 pseudo : _no_value

name	LOC667830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667830
definition	number : 6 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 3 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 2 pseudo : _no_value

name	LOC639802 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639802
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:143708
definition	standard_name : Klra1

name	(CDS detail)
type	STS
link
xref	UniSTS:132208
definition	standard_name : G54856

name	(CDS detail)
type	STS
link
xref	UniSTS:166312
definition	standard_name : G54773

name	(CDS detail)
type	STS
link
xref	UniSTS:166311
definition	standard_name : G54763

name	(CDS detail)
type	STS
link
xref	UniSTS:142655
definition	standard_name : D6Wum15

name	(CDS detail)
type	STS
link
xref	UniSTS:166305
definition	standard_name : G54757

name	(CDS detail)
type	STS
link
xref	UniSTS:208040
definition	standard_name : C86350

name	(CDS detail)
type	STS
link
xref	UniSTS:166315
definition	standard_name : G54767

name	(CDS detail)
type	STS
link
xref	UniSTS:186751
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142655
definition	standard_name : D6Wum15

name	(CDS detail)
type	STS
link
xref	UniSTS:166304
definition	standard_name : G54761

name	(CDS detail)
type	STS
link
xref	UniSTS:208040
definition	standard_name : C86350

name	(CDS detail)
type	STS
link
xref	UniSTS:166305
definition	standard_name : G54757

name	(CDS detail)
type	STS
link
xref	UniSTS:208041
definition	standard_name : C86243

name	(CDS detail)
type	STS
link
xref	UniSTS:186752
definition	standard_name : Klra2

name	(CDS detail)
type	STS
link
xref	UniSTS:179476
definition	standard_name : U10304

name	(CDS detail)
type	STS
link
xref	UniSTS:179506
definition	standard_name : AI326477

name	(CDS detail)
type	STS
link
xref	UniSTS:224837
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:208058
definition	standard_name : BB273866

name	(CDS detail)
type	STS
link
xref	UniSTS:219028
definition	standard_name : RH136939

name	(CDS detail)
type	STS
link
xref	UniSTS:139208
definition	standard_name : G61989

name	(CDS detail)
type	STS
link
xref	UniSTS:166299
definition	standard_name : G54762

name	(CDS detail)
type	STS
link
xref	UniSTS:186734
definition	standard_name : 282h8Sp6

name	(CDS detail)
type	STS
link
xref	UniSTS:166303
definition	standard_name : G54764

name	(CDS detail)
type	STS
link
xref	UniSTS:166313
definition	standard_name : G54769

name	(CDS detail)
type	STS
link
xref	UniSTS:166303
definition	standard_name : G54764

name	(CDS detail)
type	STS
link
xref	UniSTS:492766
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:166314
definition	standard_name : G54768

name	(CDS detail)
type	STS
link
xref	UniSTS:495726
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493160
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490632
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492769
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494184
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487868
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493147
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491963
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:166309
definition	standard_name : G54766

name	(CDS detail)
type	STS
link
xref	UniSTS:142657
definition	standard_name : D6Wum18

name	(CDS detail)
type	STS
link
xref	UniSTS:166308
definition	standard_name : G54765

name	(CDS detail)
type	STS
link
xref	UniSTS:142656
definition	standard_name : D6Wum16

name	(CDS detail)
type	STS
link
xref	UniSTS:186733
definition	standard_name : 242D11L2

name	(CDS detail)
type	STS
link
xref	UniSTS:130764
definition	standard_name : D6Mit219

name	EG625648 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255351 GeneID:625648 MGI:3645795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG625648 pseudo : _no_value transcript_id : XR_034740.1

clone name	MSMg01-507K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301D07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420J05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421J03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-531G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-345L15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066K12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-103P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103I17
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-157B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-079A05.T7 (MSMg01no079_a05.b1)	MSMg01-079A05.TJ (MSMg01no079_a05.g1)
ACC	AG300208	AG300209
length	700	703
length of high quality (start - end)	648 (46 - 693)	629 (75 - 703)
definition	CHROMAT_FILE: MSMg01no079_a05.b1 PHD_FILE: MSMg01no079_a05.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:27:31 2005	CHROMAT_FILE: MSMg01no079_a05.g1 PHD_FILE: MSMg01no079_a05.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:27:31 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TTCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCACAGAGGCGCAAGTTTTGAAATAGCTAGGCACATCCACAGTCAAA AACGGAGAAAACAAATACATCCATACCTCCAGCTCAGCTCCCTTTCTCTG CTTCTATTCAGTCCAGGAACCAACCCTAGAGAGTGCTGCAACTAACTTTT AGACTTGGTCTTCCCACATCAATTAATATAACCATGACATTTCCCTAAGG ATTGACCACACGGGCACACCTGATCTAGATTATCCTTCACTTTCCCAACC AGCTGACTCTAGGCTGTGCCCAGGTAACAGTTAAAATAAGCCATTACAGC ATGTTTAAAAAATTATAATAACTTCAGGTGCTTTTCTGATATTTTATTTC AACCTTCTATATCAAAGAAGCGTTTTTATCTTTGTATACTTTAAAACACC TCATACTTACTTTAAATGCTATTTTTTTCTCTTTTAACTCAGTTTGGATG AAATTCTGTTGTTTCTCTTTTAAGATAAGAGCCAGTATGGGGTGGCACCA TTATTTCATGGTGCCAAGGGTTGAACCCAGAGACAAATACCTGTTAGGTA AGTGTTCTGTTGTGAAGCCACACTCCCAGCTCCTCATGGGTGGTTTAAGC TACAAGGGACAGATCTGAGTGACCCTGATATAAAACCCAAAGTGGGCATT	CCTGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXTCACCTGAGGAATACTGAATGGCAGA GAAGCACCTGAAAAAATGTTCATCAACCTTAATCATCAGGGAAATGCAAA TCAAAACAACCCTGAGATTCCACCTCACATCAGTCAGAATGGCTAAGATC AAAAATTTTGGTGACAGCAGATGCTGGTGTGGATGTGGAGAAAGAGGAAC ACTCCTCCATTGTTGATGGGATTGCAGGCTTGTACAACCACTCTGGAAAT CAGTCTGGAGGTTCCTCAGGAAATTGGACATAGTACTACCGGAGGATCCA GCAATACCTCTCCTGGGCATATATCCAGAAGATGCCCCAACTGGTAAGAA GGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCAGAA GCTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATG TGGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATT TATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGAGTG AGGCAACACATTCACAAAGGAACTCACACAATATGTACTCACTGTTAAGT GGATATTAGCCCAAAACCTAGGATACCCAAGATATAAGATACAATTTCCT AAA
quality values	Open. Hide. 6 6 7 6 6 6 9 15 23 23 18 15 11 13 10 9 17 10 10 10 21 21 41 48 48 26 22 17 12 12 8 13 13 10 11 17 23 28 36 37 31 31 31 26 28 35 37 57 57 50 47 53 31 33 33 28 28 25 23 19 11 6 6 6 8 21 30 41 47 37 39 33 33 36 36 36 36 36 36 36 42 50 50 50 50 57 47 48 42 42 42 40 40 40 42 40 40 42 42 50 57 57 57 57 57 57 68 68 57 54 48 50 50 50 50 51 50 46 46 46 50 46 50 50 51 68 68 50 50 50 50 50 51 51 51 50 50 50 68 68 68 68 68 68 68 57 57 54 57 54 57 57 68 68 68 68 68 51 50 50 50 50 50 50 50 50 50 57 57 57 57 57 57 54 57 57 59 57 57 57 57 50 38 38 38 50 57 57 57 57 59 57 57 57 57 57 57 57 57 68 68 68 44 44 43 57 43 57 43 52 57 57 57 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 57 57 57 57 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 68 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 68 62 62 52 52 62 62 62 62 62 62 62 62 62 52 52 52 62 62 52 52 62 62 62 62 68 68 62 62 62 62 62 62 62 68 68 68 68 68 62 62 52 62 62 62 62 68 68 68 62 62 62 62 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 57 52 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 59 59 59 59 57 57 57 59 59 68 59 59 57 57 57 57 59 52 59 59 59 59 68 68 59 59 54 54 54 57 57 68 57 57 57 54 54 57 57 59 59 59 59 59 57 57 57 57 57 43 44 46 59 59 59 68 68 68 68 59 59 50 48 48 48 48 57 57 68 68 68 57 57 57 48 47 57 47 57 47 57 57 57 57 54 57 57 57 48 46 46 44 44 43 43 48 59 59 59 48 48 48 57 46 57 57 57 57 57 59 59 48 48 43 43 43 48 48 43 43 39 47 43 47 59 59 41 41 43 43 57 48 48 48 48 48 50 46 41 39 36 32 31 29 29 36 41 41 47 47 46 46 48 46 59 46 43 48 50 48 43 43 46 46 48 48 48 48 48 48 57 48 48 48 48 48 48 43 43 43 43 43 43 43 46 47 48 57 57 48 48 48 48 48 46 46 47 43 59 36 35 31 34 39 41 39 39 39 39 40 37 37 39 39 37 37 40 39 41 37 30 23 22 30 32 29 31 37 37 39 37 34 39 39 34 34 25 22 22 22 23 29 32 37 37 39 39 39 39 37 32 22 25 25 28 30 28 31 32 37 33 30 33 33 39 39 39 39 38 25 25 30 28 30 30 14 9 9 9 9 11 17 9 9	Open. Hide. 6 6 6 8 8 8 8 9 19 19 22 10 10 14 13 14 21 23 29 30 37 29 31 33 33 33 33 30 32 21 23 12 12 12 12 19 19 18 11 11 10 21 21 36 36 36 36 36 36 36 50 37 37 50 50 50 47 44 27 25 20 25 23 28 36 26 42 42 42 42 42 48 50 50 50 47 47 47 47 57 57 57 57 50 50 50 48 46 46 50 48 48 41 41 38 42 42 48 50 50 57 57 57 57 57 57 44 57 57 57 57 57 57 57 48 50 50 50 50 50 50 50 50 50 36 36 30 42 43 50 50 50 41 50 50 50 50 37 50 50 57 50 50 50 50 50 50 50 50 50 50 50 47 57 57 57 52 57 57 52 52 57 43 44 43 57 57 57 57 57 52 52 45 57 57 52 52 57 57 57 57 57 57 52 57 52 39 39 35 35 32 57 57 57 57 57 57 57 57 57 57 57 57 68 68 57 62 62 62 52 62 52 52 62 62 62 62 62 62 62 39 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 43 39 62 43 62 62 62 62 62 52 62 62 43 43 39 47 59 62 62 68 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 52 62 62 68 62 62 62 62 62 52 62 62 62 62 62 62 62 62 52 62 62 62 44 47 39 47 43 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 44 62 62 62 52 52 45 43 43 43 43 62 62 62 62 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 57 59 68 59 44 35 43 44 57 57 68 68 68 68 68 68 57 57 57 57 52 57 52 59 59 52 52 52 52 57 59 59 59 52 54 52 52 52 43 43 35 50 50 44 44 52 52 52 43 43 38 31 43 43 47 57 57 59 57 57 57 57 57 57 57 57 57 43 43 59 59 57 57 57 57 57 57 54 57 57 48 44 44 43 44 37 44 36 37 37 39 44 57 57 57 57 48 48 47 57 57 57 46 40 36 28 44 44 59 59 59 59 57 57 57 57 57 54 50 50 50 50 50 59 57 57 57 57 57 57 57 57 43 43 43 43 37 37 34 34 25 30 30 37 37 39 31 31 39 39 37 37 37 37 39 29 27 24 17 19 19 34 34 41 39 39 43 37 43 43 39 41 39 48 28 28 13 13 13 28 28 37 39 39 43 39 37 37 28 28 34 34 39 39 43 41 41 36 43 37 36 36 39 39 40 43 43 43 47 59 47 46 34 32 32 20 20 24 32 37 40 41 47 47 37 37 20 22 17 26 26 26 28 20 23 18 18 18 18 20 24 19 29 29 34 28 30 30 30 30 37 34 34 25 24 24 31 25 32 33 29 32 17 25 11 18 18 18 17 22 23 25 30 25 25 32 37 32 29

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no079_a05.b1 MSMg01no079_a05.b1 CHROMAT_FILE:
MSMg01no079_a05.b1 PHD_FILE: MSMg01no079_a05.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:27:31 2005
         (648 letters)



>mm_chr6_131367592_131368639
          Length = 1048

 Score = 1139 bits (589), Expect = 0.0
 Identities = 631/645 (97%)
 Strand = Plus / Plus

                                                                       
Query: 4   ggaattcacagaggcgcaagttttgaaatagctaggcacatccacagtcaaaaacggaga 63
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 204 ggaattcacagaggtgcaagttttgaaatagctaggcacatccacagtcaaaaacggaga 263

                                                                       
Query: 64  aaacaaatacatccatacctccagctcagctccctttctctgcttctattcagtccagga 123
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 264 aaacaaatacatccatacctccagctcaactccctttctctgcttctattcagtccagga 323

                                                                       
Query: 124 accaaccctagagagtgctgcaactaacttttagacttggtcttcccacatcaattaata 183
           |||||||||| |||||| || ||||||||||||||||||||||||||||||||||||| |
Sbjct: 324 accaaccctacagagtggtgtaactaacttttagacttggtcttcccacatcaattaaca 383

                                                                       
Query: 184 taaccatgacatttccctaaggattgaccacacgggcacacctgatctagattatccttc 243
           || |||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||
Sbjct: 384 tatccatgacaattccctaaggattgaccacacaggcacacctgttctagattatccttc 443

                                                                       
Query: 244 actttcccaaccagctgactctaggctgtgcccaggtaacagttaaaataagccattaca 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 444 actttcccaaccagctgactctaggctgtgcccaggtaacagttaaaataagccattaca 503

                                                                       
Query: 304 gcatgtttaaaaaattataataacttcaggtgcttttctgatattttatttcaaccttct 363
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 504 gcatgtataaaaaattataataacttcaggtgcttttctgatattttatttcaaccttct 563

                                                                       
Query: 364 atatcaaagaagcgtttttatctttgtatactttaaaacacctcatacttactttaaatg 423
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 564 gtatcaaagaagcgtttttatctttgtatactttaaaacacctcatacttactttaaatg 623

                                                                       
Query: 424 ctatttttttctcttttaactcagtttggatgaaattctgttgtttctcttttaagataa 483
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 624 ccatttttttctcttttaactcagtttggatgaaattctgttgtttctcttttaagataa 683

                                                                       
Query: 484 gagccagtatggggtggcaccattatttcatggtgccaagggttgaacccagagacaaat 543
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 684 gagccagtatggggtggcaccattatttcatggtgccaagggttgaacccagagacaaat 743

                                                                       
Query: 544 acctgttaggtaagtgttctgttgtgaagccacactcccagctcctcatgggtggtttaa 603
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 744 acctgttaggtaagtgttctgttgtggagccacactcccagctcctcatgggtggtttaa 803

                                                        
Query: 604 gctacaagggacagatctgagtgaccctgatataaaacccaaagt 648
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 804 gctacaagggacagatctgagtgaccctgatataaaacccaaagt 848


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 28
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 648
Length of database: 1048
Length adjustment: 10
Effective length of query: 638
Effective length of database: 1038
Effective search space:   662244
Effective search space used:   662244
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information