MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-111P20
Chromosome	6 (Build37)
Map Location	89,945,968 - 89,946,330
singlet/doublet	singlet
Overlap gene	none
Upstream gene	4933427D06Rik, Gm1965, LOC100043153, LOC100043159, EG624483, EG624491, LOC665547, EG624537, Gm839, 4930512J16Rik, Plxna1, Chchd6, Txnrd3, V1r-ps1, V1rb7, V1rb9, V1r-ps2, V1r-ps3, V1ra6, V1ra5, V1rb4, V1r-ps4, V1ra2, V1rb8
Downstream gene	V1ra4, V1ra3, V1rb2, V1rb1, V1ra1, LOC625050, V1ra7, V1ra8, V1rb3, LOC100043191, V1r-ps5, V1ra9, BC048671, Chst13, Uroc1, Zxdc, Ccdc37, Klf15, Aldh1l1, Slc41a3, Iqsec1, LOC100043646, EG665685
Link	Open Mouse BAC browser

Click to get alignment info.

name	4933427D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG624483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG624491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC665547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG624537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Gm839 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330379 MGI:2685685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930512J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Plxna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18844 MGI:107685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66098 MGI:1913348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnrd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113869 MGI:2148531
definition	note : vomeronasal 1 receptor, pseudogene 1 pseudo : _no_value

name	V1rb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113870 MGI:2148532
definition	note : vomeronasal 1 receptor, pseudogene 2 pseudo : _no_value

name	V1r-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113871 MGI:2148533
definition	note : vomeronasal 1 receptor, pseudogene 3 pseudo : _no_value

name	V1ra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	V1r-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113872 MGI:2148534
definition	gene_synonym : V1RB3 note : vomeronasal 1 receptor, pseudogene 4 pseudo : _no_value

name	V1ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113846 MGI:2148509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins pseudo : _no_value

name	V1ra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113853 MGI:2148516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1r-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113873 MGI:2148535
definition	note : vomeronasal 1 receptor, pseudogene 5 pseudo : _no_value

name	V1ra9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins

name	Uroc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243537 MGI:2385332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zxdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ccdc37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	Klf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107747 MGI:1340024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71699 MGI:1918949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Iqsec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins

name	LOC100043646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins

name	EG665685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins pseudo : _no_value

name	4933427D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378057 GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D06 gene transcript_id : NM_175017.3

name	Gm1965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801784 GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1965, (NCBI) transcript_id : NM_001033491.2

name	LOC100043159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255239 GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043159 transcript_id : XM_001479648.1

name	EG624483 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255241 GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG624483 transcript_id : XM_889034.3

name	EG624491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255243 GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624491 transcript_id : XM_889044.3

name	EG624537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255245 GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624537 transcript_id : XM_889083.3

name	Gm839 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235726 GeneID:330379 MGI:2685685
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 839, (NCBI) transcript_id : NM_201356.1

name	4930512J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255354 GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930512J16 gene transcript_id : XM_001480366.1

name	Plxna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679388 GeneID:18844 MGI:107685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin A1 transcript_id : NM_008881.1

name	Chchd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754145 GeneID:66098 MGI:1913348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 6 transcript_id : NM_025351.2

name	Txnrd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735448 GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 3 transcript_id : NM_153162.3

name	V1rb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716538 GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B7 transcript_id : NM_053228.1

name	V1rb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716542 GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B9 transcript_id : NM_053230.1

name	V1ra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716528 GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A6 transcript_id : NM_053221.1

name	V1ra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716526 GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A5 transcript_id : NM_053220.1

name	V1rb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553591 GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs product : vomeronasal 1 receptor, B4 transcript_id : NM_053227.2

name	V1ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665735 GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A2 transcript_id : NM_011684.2

name	V1rb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716540 GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B8 transcript_id : NM_053229.1

name	V1ra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716524 GeneID:113846 MGI:2148509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A4 transcript_id : NM_053219.1

name	V1ra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716522 GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A3 transcript_id : NM_053218.1

name	V1rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755950 GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1, receptor B2 transcript_id : NM_011911.1

name	V1rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716532 GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B1 transcript_id : NM_053225.1

name	V1ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949776 GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A1 transcript_id : NM_011683.2

name	V1ra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361225 GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A7 transcript_id : NM_053222.1

name	V1ra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361227 GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A8 transcript_id : NM_053223.1

name	V1rb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716534 GeneID:113853 MGI:2148516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B3 transcript_id : NM_053226.1

name	V1ra9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716530 GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A9 transcript_id : NM_053224.1

name	BC048671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802476 GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048671 transcript_id : NM_177738.2

name	Chst13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377995 GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins product : carbohydrate (chondroitin 4) sulfotransferase 13 transcript_id : XM_978459.1

name	Uroc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450100 GeneID:243537 MGI:2385332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocanase domain containing 1 transcript_id : NM_144940.1

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381340 GeneID:80292 MGI:1933108
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_030260.2

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802546 GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_173002.2

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255366 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : coiled-coil domain containing 37, transcript variant 2 transcript_id : XM_001480392.1

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255364 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : coiled-coil domain containing 37, transcript variant 1 transcript_id : XM_001480389.1

name	Klf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130317 GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 15 transcript_id : NM_023184.3

name	Aldh1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532958 GeneID:107747 MGI:1340024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member L1 transcript_id : NM_027406.1

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734230 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_027868.2

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734224 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_001037493.1

name	Iqsec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255368 GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins product : IQ motif and Sec7 domain 1 transcript_id : XM_001480423.1

name	LOC100043646 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255370 GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480428.1

name	4933427D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424689 CCDS:CCDS20341.1 GeneID:232217 MGI:3026922
definition	codon_start : 1 product : hypothetical protein LOC232217 protein_id : NP_778182.1

name	Gm1965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702029 GeneID:434065 MGI:3584270
definition	codon_start : 1 product : hypothetical protein LOC434065 protein_id : NP_001028663.1

name	LOC100043159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255240 GeneID:100043159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479698.1

name	EG624483 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255242 GeneID:624483 MGI:3645279
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894127.3

name	EG624491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255244 GeneID:624491 MGI:3645511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894137.2

name	EG624537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255246 GeneID:624537 MGI:3645589
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894176.2

name	Gm839 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235727 GeneID:330379 MGI:2685685
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC330379 protein_id : NP_958744.1

name	4930512J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255355 GeneID:75131 MGI:1922381
definition	codon_start : 1 product : hypothetical protein LOC75131 protein_id : XP_001480416.1

name	Plxna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679389 CCDS:CCDS20344.1 GeneID:18844 MGI:107685
definition	GO_component : GO:0005886 - plasma membrane [Evidence IC] GO_function : GO:0017154 - semaphorin receptor activity [Evidence IPI] codon_start : 1 note : plexin 1 product : plexin A1 protein_id : NP_032907.1

name	Chchd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754146 GeneID:66098 MGI:1913348
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : coiled-coil-helix-coiled-coil-helix domain containing 6 protein_id : NP_079627.2

name	Txnrd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735449 GeneID:232223 MGI:2386711
definition	GO_component : GO:0005792 - microsome [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence IDA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : thioredoxin and glutathione reductase product : thioredoxin reductase 3 protein_id : NP_694802.2 transl_except : (pos:89624783..89624785,aa:Sec)

name	V1rb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716539 CCDS:CCDS20346.1 GeneID:113855 MGI:2148518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B7 protein_id : NP_444458.1

name	V1rb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716543 GeneID:113857 MGI:2148520
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A12 product : vomeronasal 1 receptor, B9 protein_id : NP_444460.1

name	V1ra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716529 GeneID:113848 MGI:2148511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RA10; vomeronasal receptor 1 A1; vomeronasal receptor 1 A3 product : vomeronasal 1 receptor, A6 protein_id : NP_444451.1

name	V1ra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716527 GeneID:113847 MGI:2148510
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A2 product : vomeronasal 1 receptor, A5 protein_id : NP_444450.1

name	V1rb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553592 GeneID:113854 MGI:2148517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A10; vomeronasal receptor V1RB11 product : vomeronasal 1 receptor, B4 protein_id : NP_444457.2

name	V1ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665736 GeneID:22297 MGI:1333762
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 2; vomeronasal 1, receptor 2; vomeronasal receptor V1RA11; vomeronasal receptor 1 A9 product : vomeronasal 1 receptor, A2 protein_id : NP_035814.2

name	V1rb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716541 CCDS:CCDS20348.1 GeneID:113856 MGI:2148519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B8 protein_id : NP_444459.1

name	V1ra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716525 CCDS:CCDS20349.1 GeneID:113846 MGI:2148509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor 1 A7 product : vomeronasal 1 receptor, A4 protein_id : NP_444449.1

name	V1ra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716523 CCDS:CCDS20350.1 GeneID:113845 MGI:2148508
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A3 protein_id : NP_444448.1

name	V1rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755951 CCDS:CCDS20351.1 GeneID:24112 MGI:1344384
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 5; vomeronasal organ family 1, receptor B2 product : vomeronasal 1, receptor B2 protein_id : NP_036041.1

name	V1rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716533 CCDS:CCDS20352.1 GeneID:113852 MGI:2148515
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A5 product : vomeronasal 1 receptor, B1 protein_id : NP_444455.1

name	V1ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949777 GeneID:22296 MGI:1333759
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 1; vomeronasal 1, receptor 1; vomeronasal receptor V1RA1 product : vomeronasal 1 receptor, A1 protein_id : NP_035813.2

name	V1ra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361226 CCDS:CCDS20353.1 GeneID:113849 MGI:2148512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A7 protein_id : NP_444452.1

name	V1ra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361228 CCDS:CCDS20354.1 GeneID:113850 MGI:2148513
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A8 protein_id : NP_444453.1

name	V1rb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716535 CCDS:CCDS20355.1 GeneID:113853 MGI:2148516
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, B3 protein_id : NP_444456.1

name	V1ra9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716531 CCDS:CCDS20356.1 GeneID:113851 MGI:2148514
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A9 protein_id : NP_444454.1

name	BC048671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244226 CCDS:CCDS20357.1 GeneID:243535 MGI:2679261
definition	codon_start : 1 product : hypothetical protein LOC243535 protein_id : NP_808406.1

name	Chst13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377996 GeneID:71797 MGI:1919047
definition	codon_start : 1 product : carbohydrate (chondroitin 4) sulfotransferase 13 protein_id : XP_983553.1

name	Uroc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450101 GeneID:243537 MGI:2385332
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016153 - urocanate hydratase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence IEA]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : urocanase domain containing 1 protein_id : NP_659189.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370506 CCDS:CCDS20358.1 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ZXD family zinc finger C isoform 2 protein_id : NP_766590.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385100 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : ZXD family zinc finger C isoform 1 protein_id : NP_084536.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255365 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 1 protein_id : XP_001480439.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255367 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 2 protein_id : XP_001480442.1

name	Klf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963561 CCDS:CCDS20360.1 GeneID:66277 MGI:1929988
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Kruppel-like factor 15 protein_id : NP_075673.1

name	Aldh1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532959 CCDS:CCDS20361.1 GeneID:107747 MGI:1340024
definition	EC_number : 1.5.1.6 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0016155 - formyltetrahydrofolate dehydrogenase activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009258 - 10-formyltetrahydrofolate catabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : formyltetrahydrofolate dehydrogenase product : aldehyde dehydrogenase 1 family, member L1 protein_id : NP_081682.1

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734231 CCDS:CCDS20362.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : solute carrier family 41, member 3 isoform 1 protein_id : NP_082144.2

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734225 CCDS:CCDS20363.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : solute carrier family 41, member 3 isoform 2 protein_id : NP_001032570.1

name	Iqsec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255369 GeneID:232227 MGI:1196356
definition	codon_start : 1 product : IQ motif and Sec7 domain 1 protein_id : XP_001480473.1

name	LOC100043646 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255371 GeneID:100043646
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480478.1

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 2 pseudo : _no_value

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 1 pseudo : _no_value

name	LOC665547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665547
definition	number : 1 pseudo : _no_value

name	LOC100043191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043191
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130797
definition	standard_name : D6Mit248

name	(CDS detail)
type	STS
link
xref	UniSTS:235493
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179412
definition	standard_name : AU023851

name	(CDS detail)
type	STS
link
xref	UniSTS:210429
definition	standard_name : RH136443

name	(CDS detail)
type	STS
link
xref	UniSTS:207993
definition	standard_name : RH127255

name	(CDS detail)
type	STS
link
xref	UniSTS:179413
definition	standard_name : AU018164

name	(CDS detail)
type	STS
link
xref	UniSTS:235489
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179414
definition	standard_name : AU024342

name	(CDS detail)
type	STS
link
xref	UniSTS:125271
definition	standard_name : MHAa67d2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207994
definition	standard_name : AU014819

name	(CDS detail)
type	STS
link
xref	UniSTS:272923
definition	standard_name : PMC313053P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130879
definition	standard_name : D6Mit325

name	(CDS detail)
type	STS
link
xref	UniSTS:159541
definition	standard_name : AI196535

name	(CDS detail)
type	STS
link
xref	UniSTS:495550
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495554
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494016
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493164
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490656
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490617
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490615
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493151
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493936
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490596
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490616
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130773
definition	standard_name : D6Mit227

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494014
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:124619
definition	standard_name : 46.MMHAP25FRH10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495549
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130675
definition	standard_name : D6Mit131

name	(CDS detail)
type	STS
link
xref	UniSTS:159545
definition	standard_name : AI265605

name	(CDS detail)
type	STS
link
xref	UniSTS:207998
definition	standard_name : BE136473

name	(CDS detail)
type	STS
link
xref	UniSTS:235501
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179418
definition	standard_name : AW048498

name	(CDS detail)
type	STS
link
xref	UniSTS:222798
definition	standard_name : RH140732

name	(CDS detail)
type	STS
link
xref	UniSTS:468007
definition	standard_name : Klf15

name	(CDS detail)
type	STS
link
xref	UniSTS:179415
definition	standard_name : AW494632

name	(CDS detail)
type	STS
link
xref	UniSTS:164331
definition	standard_name : AV048136

name	(CDS detail)
type	STS
link
xref	UniSTS:130674
definition	standard_name : D6Mit130

name	(CDS detail)
type	STS
link
xref	UniSTS:130917
definition	standard_name : D6Mit363

name	(CDS detail)
type	STS
link
xref	UniSTS:207995
definition	standard_name : AU022697

name	(CDS detail)
type	STS
link
xref	UniSTS:180580
definition	standard_name : AU024588

name	(CDS detail)
type	STS
link
xref	UniSTS:165477
definition	standard_name : AI480742

name	(CDS detail)
type	STS
link
xref	UniSTS:167478
definition	standard_name : RH127019

name	(CDS detail)
type	STS
link
xref	UniSTS:235495
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235497
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207997
definition	standard_name : RH127108

name	(CDS detail)
type	STS
link
xref	UniSTS:130775
definition	standard_name : D6Mit229

name	(CDS detail)
type	STS
link
xref	UniSTS:162834
definition	standard_name : RH126122

name	LOC625050 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255359 GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins product : similar to vomeronasal receptor V1RA11 pseudo : _no_value transcript_id : XR_034665.1

name	EG665685 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255372 GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins product : predicted gene, EG665685 pseudo : _no_value transcript_id : XR_001769.2

clone name	MSMg01-365J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-111P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-111P20.T7 (MSMg01no111_p20.b1)	MSMg01-111P20.TJ (MSMg01no111_p20.g1)
ACC	AG324519	AG324520
length	1,151	1,194
length of high quality (start - end)	595 (115 - 709)	145 (191 - 335)
definition	CHROMAT_FILE: MSMg01no111_p20.b1 PHD_FILE: MSMg01no111_p20.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:17:00 2005	CHROMAT_FILE: MSMg01no111_p20.g1 PHD_FILE: MSMg01no111_p20.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:17:00 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ATCTATGCGCGCTATAGACTCCATAGGGAGAGGATCCGCGGAATTCATTG TTTTTAAATGCCGTTTAAGAACTCCATTGTGTAAATGTGCCACATTTTCT GTATTCATTTCTCTGTTGAGGGACATCTGGGTTCTTTCTAACTTCTGGCT ATTATAAATAAGGATGCTATGAACATAGTGGAGCAAGTGTCCTTATTACC AGTTGGAGCATCTTCAGGGTATATGCCCAGGAGAGGAATTGCTGGTTCTT CCAGTAGTACTATGTCTAATTTTCTGAGGAACCGCCAGACTGATTTCCAG AATGGTTGAACCAGCTTGCAATCCTACCAACAATAGAGGAGTGTCCCTCT TTCTCCCCATCCTCACCAGCATCTGCTGTCACCTGAATTTTTTATCTTAG CCATTCAGAATGGGGTGAGGTGGAATCTCATAGTTGTTTTGATTTTCATT TCCCTGATGATTAAGGATTTTGAACATTTTTTCAGGTGCTTCTCACCTCT TCAGTATTCCTCAGTTGAGAATTCTTTGTTTAGCTCTGTACCCCATAATG GACACTCTTAATGCACACTCTTATGTACAAGCACATACATATTAACACAC CCAGAAAAAAACTTACCAAATAAAACCAGTCTACAAATGTATCTGGTTAC TTTGTGTGCACATTATAATTTTATAATGTATCTGTATATATTTGGAATAT GTAAATGCTAACAGTTCCTATATGTCATTTTTCTTGAGAACTTTTTACTT TCCCTACTATTCCTTTTGTGTAATACATCTATTCTATTTATTTTTTTATT TTTGTTTTTTATTGGCTATTTTAATCTATTTTCATTTCCAACGTTAATCC CGCTTTCTCGATTCTCCCTCCTTCAAACTCCCTTCAATCCCCTTTCCCCC TGCCTTAAATAGGGTGTTCCTCCCCCCCCTCATTCCATCCCACTCCCTGC CTCCACTGTTTCTAAAATTTTCCCTTACAAATGGGGGCATCAGGGGCCCT CCCCACGGGACCAAAAGGGCCCCCCCCCCTTCCCCCTTGGATGCCCCCAA TTAAAGCCCTCCCCTTCTGGCTTTATAATTTGTCACTCTGCGGAAACTGG TCCCTCTTCCCGGTTCTTTTCCAACAGAAATAGGCTTTATATATTTCCCT T	ACACGCTAGCCGGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXCCTTTAAAGATCGCTAACTTTATCTTTGATGAGTATGAAGC CCCTTACCTTGTCTTTTTTGACAACTTTGGGTTGGAATTCAAGTTTATTT GATATTAGAATGGTTACTCCAGCTTGTTTCTTCAGACCGTTTGCTTGGAA AATTGTTTTCCAGCCTTTCACTCTGATATAGTGTCTGTCTTTTCCCCTGA GATGTGTTTCCTGTAAACAGCTAAATGTTGGGTCCTGTTTGTGTAGCCAG TCTTTTAATCTTGTGTCTATGTCCAGTGATATTAACAGATATTAAGGAAA AGTCATTTTTGCCTCCTGTTATTTTTGTTGTTATATTTGTTATTCTCTTC TGGTGGCTGTTTTCTCTTAGGTTTGTTGAAGTATTTTTTTTTTGCCTCCC CTAGGGTATAGTTTCTGTCCTTGACTTAGAGTTTTCCTGTTATTATCCTT TTGAAGGGTTGGATTTCTGGATTGATATTTGTGTGAATTTGGTTTTGCCA TGAAATACTTTGGTTTCTCCCTTCTTATGTTAATTTGACACTTTTGCTGT TTTATGGAATCATGTTCCTGTCATTTGTGTTTTCTTAACTGTGTATACTT TCTGTCTATACCCTTTCCTCCTTCATATTTTTCTGTTGCAAAAATCTGTA ATTAATTTTAATATGGCCTGCTCTCTATTTTGTTATTTTGTACCTTTTCC CTTTACTGGTTTTTAAATATTCTTGTCTCCCCTTTTTTTGCCATTCCTTT GTCTCTTAATATTTATCGTGTTCTCGATGTAATTTCTTTTTCTTGGTCCT CAGTCTCTTTTTTAAAATCTCCGCATAAGCTTTCTTTTTTTGGTTTCTTG TAATCTTCTTTCTTTTCTTCTACGATTCGGAAAATTTTTTCCCCTTCTTA TATCTTTTATTTTCTATAAATTCTTCCTTGTTTCCATTTTATTCTTTTTC AATATTCTATTCTTTTCTTCCACTTTAATTTCTTATTCTTTTTTTTATAT TTTTCCTCTCTTTCTTCTAATTGTTATTTCCGCGAAATTTTTCCCTCGAC CCTTTTTTTTAAATGTTATGCTACTTCTTCTTTTGTTACTCTTTACTCTT TTATTCCTTTTTTNATATATGTTCTTTATCCTTCTATTTTCTTA
quality values	Open. Hide. 6 6 6 6 7 10 6 8 8 19 15 18 15 10 8 8 8 13 15 8 8 8 8 8 19 19 37 50 50 47 47 48 48 48 42 42 30 24 28 28 28 43 43 37 37 30 30 24 28 47 57 53 36 44 44 33 33 33 22 23 13 10 10 10 11 11 12 12 11 11 12 12 12 12 15 15 15 26 26 35 35 35 36 36 36 57 57 57 48 48 48 42 42 48 57 57 44 44 28 24 12 12 12 12 12 13 19 24 31 31 19 19 10 13 10 13 21 32 54 68 68 68 68 68 57 57 54 46 46 57 57 43 40 33 39 44 42 37 41 35 41 41 44 44 37 35 35 38 43 57 68 68 68 68 68 68 68 57 57 57 54 54 59 59 50 50 47 47 47 50 50 50 50 47 37 37 37 43 57 52 54 52 57 52 52 52 57 57 57 44 43 52 52 52 57 57 57 57 57 43 43 39 57 57 68 57 44 44 33 33 43 43 43 44 35 35 35 44 44 57 57 57 57 57 57 52 52 43 57 43 59 59 59 59 59 59 59 59 59 59 57 57 62 62 62 44 43 34 43 43 43 33 33 23 38 38 62 43 43 43 43 52 62 62 62 45 52 52 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 44 43 35 35 35 44 44 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 52 52 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 44 62 39 39 39 62 62 68 68 62 62 62 62 62 62 62 43 43 43 43 52 44 44 52 52 59 59 47 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 43 43 43 43 43 52 62 62 52 62 62 62 62 62 62 62 62 41 39 39 43 43 62 62 62 62 62 62 62 62 62 62 62 62 39 39 39 43 43 52 52 52 52 52 62 52 52 52 62 62 62 62 62 52 52 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 33 23 9 9 9 23 38 52 43 62 62 62 52 57 52 52 57 57 52 57 57 57 52 52 45 52 52 52 43 57 52 57 52 57 59 59 59 57 52 52 52 52 52 57 57 57 59 59 59 59 57 52 45 43 52 57 52 57 52 57 43 43 35 35 44 44 57 44 43 31 31 35 38 38 35 43 28 28 36 43 52 52 52 52 52 54 54 57 57 43 43 35 37 37 37 44 43 44 43 32 32 28 32 28 28 23 28 28 20 20 32 34 47 48 41 32 31 31 42 42 42 42 44 44 44 48 40 38 24 20 20 20 20 30 37 39 47 43 46 43 47 43 47 47 48 43 43 43 43 43 39 39 43 43 33 36 29 29 25 29 25 33 33 40 42 48 43 43 43 43 43 43 43 43 43 43 43 39 39 37 37 30 22 18 12 14 16 18 18 20 20 22 22 20 18 25 23 15 9 9 10 11 18 36 26 27 19 15 15 12 23 20 33 30 29 29 36 36 36 42 43 43 34 33 33 33 36 33 33 24 24 24 22 21 19 21 11 11 11 22 23 39 28 19 12 11 12 14 14 21 12 12 12 18 19 24 22 23 11 11 11 21 21 22 17 17 30 30 32 32 23 22 20 22 14 14 18 19 19 16 15 10 9 9 14 14 18 18 8 7 7 7 13 14 14 14 17 10 10 9 9 9 17 19 31 24 22 12 12 12 13 18 8 8 8 8 14 10 11 10 9 9 9 9 13 14 10 10 8 10 10 8 10 8 8 8 8 12 10 12 10 15 12 15 12 12 15 12 11 9 9 13 10 11 11 10 10 8 11 8 8 8 15 20 20 23 10 10 9 8 8 8 11 15 13 14 10 8 8 8 8 10 10 11 10 10 8 8 8 8 8 9 9 11 17 19 19 13 10 10 8 8 8 9 9 9 10 10 11 10 11 12 12 12 9 9 9 9 9 12 8 8 8 8 8 8 10 8 8 8 8 11 8 9 10 8 10 8 6 6 6 10 12 7 7 7 6 12 8 9 10 16 12 8 8 8 8 8 6 8 8 10 10 6 6 6 6 8 8 8 8 8 6 6 7 7 6 10 6 6 6 8 9 9 10 10 10 10 13 11 8 8 8 8 8 8 8 10 10 18 31 18 15 8 8 8 10 20 12 15 15 12 10 8 8 8 8 9 16 10 10 11 11 10 6 6 6 7 10 8 10 11 8 8 8 8 8 8 11 12 11 11 11 11 9 10 9 6 8 6 6 8 8 8 8 8 9 7 6 6 6 6 6 6 6 6 6 7 12 10 8 9 8 8 10 10 9 9 11 9 6 6 6 6 8 8 10 6 6 6 7 11 6 14 10 13 6 6 6 6 8 8 8 8 6 8 8 8 8 8 8 8 8 8 8 10 6 6 8 8 8 8 8 8 8 8	Open. Hide. 9 9 9 11 11 12 12 13 13 9 9 9 9 9 8 10 10 12 8 10 10 8 8 8 8 10 10 8 8 8 10 19 22 26 16 16 16 29 28 37 37 28 28 28 23 23 21 26 19 26 26 23 22 19 11 11 13 8 11 10 12 12 16 11 11 8 8 6 6 6 6 8 8 12 14 13 24 22 31 31 36 36 36 48 47 47 47 47 37 32 26 30 27 23 21 20 18 11 9 9 6 6 6 7 8 8 11 9 16 16 10 10 10 25 30 44 43 48 36 26 18 24 24 26 28 48 57 48 43 43 43 37 40 30 35 35 42 27 27 14 14 14 15 30 33 36 37 46 43 47 47 47 47 47 42 42 30 31 31 41 42 44 44 47 47 42 42 36 36 28 22 22 30 32 42 42 47 30 25 11 11 11 18 15 15 11 10 10 9 9 13 23 24 35 32 38 19 27 27 38 38 43 43 52 52 52 52 52 52 52 43 43 35 35 41 50 43 57 52 52 52 52 52 36 27 12 12 12 21 19 36 35 37 37 24 21 15 10 10 20 32 44 44 44 33 33 23 32 32 28 28 29 43 43 57 52 43 57 35 35 43 32 24 24 24 30 32 28 35 32 37 32 32 20 20 21 38 28 32 17 15 15 24 30 37 43 52 52 36 27 12 12 10 14 12 15 15 16 16 19 24 32 32 32 37 43 36 28 28 20 20 18 14 18 18 18 19 30 25 30 22 28 28 23 28 28 32 32 28 28 28 24 26 14 12 12 10 9 10 14 14 14 25 24 23 23 23 36 36 39 33 31 31 25 25 31 39 39 43 43 43 34 34 33 33 29 22 20 19 20 10 15 15 30 23 24 19 19 14 14 11 10 13 13 14 16 13 9 8 8 8 8 15 15 9 11 11 12 12 14 9 10 9 9 8 10 12 14 14 24 17 24 33 36 36 39 40 36 19 18 15 14 14 21 28 34 35 26 25 24 17 17 18 23 16 16 19 20 27 22 17 17 14 12 10 10 10 10 12 12 10 17 16 14 12 8 8 10 13 12 16 10 13 10 15 15 11 12 12 16 17 13 11 11 11 11 12 11 11 11 12 24 23 31 31 17 14 14 14 19 12 13 13 18 26 19 13 13 9 9 9 15 13 13 10 10 10 11 12 12 12 13 18 10 8 8 8 8 8 8 6 6 8 8 10 11 14 15 17 14 11 9 9 11 16 20 20 20 21 16 12 12 12 22 19 15 12 12 12 18 17 11 8 8 8 8 8 8 21 23 22 12 9 9 9 9 15 20 23 23 13 10 10 17 15 9 9 10 14 17 15 14 10 10 10 10 13 8 8 6 6 8 8 15 10 15 10 13 13 8 8 8 13 12 12 8 8 8 8 8 8 8 8 6 6 8 8 6 6 8 8 10 10 13 15 10 8 8 10 12 8 9 9 9 8 12 10 8 6 6 8 6 8 10 8 8 9 13 11 11 10 12 12 16 10 9 8 8 8 12 15 8 10 11 10 19 8 8 8 8 8 10 9 8 8 8 8 8 8 8 8 10 10 12 10 10 10 9 9 9 8 8 8 8 8 11 10 11 15 12 9 9 9 13 14 15 11 11 10 9 9 8 8 6 6 8 8 10 12 11 10 8 8 6 6 8 8 9 8 8 10 10 10 8 8 8 8 8 8 8 8 8 8 8 10 8 13 13 18 21 22 19 10 10 9 9 8 8 8 8 8 9 19 13 10 8 10 8 8 8 8 6 6 8 8 10 10 10 8 8 8 8 8 10 10 11 9 9 9 8 8 10 8 8 8 10 10 10 15 10 10 6 6 8 8 10 11 8 10 10 10 14 18 19 16 8 8 8 10 10 8 8 8 10 8 8 8 8 10 12 8 8 8 11 8 8 8 8 12 13 13 10 12 9 9 9 12 9 9 11 11 9 12 9 11 11 11 16 26 26 17 10 10 10 10 8 8 6 7 8 8 8 8 6 6 8 10 10 9 9 9 9 10 12 13 19 17 10 10 9 9 10 10 10 10 11 11 11 8 8 10 8 8 6 6 8 8 6 6 8 8 8 8 7 7 9 7 11 8 8 8 10 8 8 6 6 8 8 10 12 11 9 9 9 10 10 10 12 12 11 11 9 9 6 8 12 10 11 10 10 10 8 9 8 8 10 10 8 9 8 8 8 8 10 8 8 8 11 11 10 11 11 10 8 8 8 8 11 11 11 10 13 10 8 8 6 6 8 8 11 8 8 6 6 7 13 8 8 8 8 8 8 10 9 9 8 8 8 6 6 8 8 11 8 10 8 8 8 8 8 8 10 10 13 14 11 13 13 8 8 6 6 8 8 6 6 8 8 8 10 8 11 12 10 12 7 9 6 7 8 10 18 17 21 17 18 10 10 10 12 10 12 8 7 6 6 6 8 8 10 10 10 9 11 11 11 11 11 11 17 8 6 6 6 8 8 8 10 11 8 8 8 8 8 6 6 8 8 10 9 10 10 10 10 10 11 11 8 8 8 8 8 8 8 8 8 8 8 8 8 9 13 11 10 8 8 8 14 9 9 12 12 13 8 8 8 8 8 8 8 6 8 8 9 8 8 6 6 8 8 10 8 8 8 8 8 7 7 8 10 12 18 3 0 3 8 8 8 8 9 9 10 12 14 12 13 9 9 6 8 8 8 8 8 6 7 10 7 10 12 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no111_p20.b1 MSMg01no111_p20.b1 CHROMAT_FILE:
MSMg01no111_p20.b1 PHD_FILE: MSMg01no111_p20.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:17:00 2005
         (595 letters)



>mm_chr6_89945336_89946330
          Length = 995

 Score =  644 bits (333), Expect = 0.0
 Identities = 357/365 (97%), Gaps = 4/365 (1%)
 Strand = Plus / Minus

                                                                       
Query: 233 ctctttctccccatcctcaccagcatctgctgtcacctgaattttttatcttagccattc 292
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 995 ctctttctccccatcctcaccagcatctgcggtcacctgaattttttatcttagccattc 936

                                                                       
Query: 293 agaatggggtgaggtggaatctcatagttgttttgattttcatttccctgatgattaagg 352
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 935 agaatggggtgaggtggaatctcatagttgttttgattttcatttccctgatgattaagg 876

                                                                       
Query: 353 attttgaacattttttcaggtgcttctca-cc-tcttcagtattcctcagttgagaattc 410
           ||||||||||||||||||||||||||||| || | ||  ||||||||||| |||||||||
Sbjct: 875 attttgaacattttttcaggtgcttctcagccat-tt-ggtattcctcaggtgagaattc 818

                                                                       
Query: 411 tttgtttagctctgtaccccataatggacactcttaatgcacactcttatgtacaagcac 470
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 817 tttgtttagctctgtaccccataatggacactcttaatgcacactcttatgtacaagcac 758

                                                                       
Query: 471 atacatattaacacacccagaaaaaaacttaccaaataaaaccagtctacaaatgtatct 530
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 757 atacatattaacacacccagaaaaaaacttaccaaataaaaccagtctacaaatgtatct 698

                                                                       
Query: 531 ggttactttgtgtgcacattataattttataatgtatctgtatatatttggaatatgtaa 590
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 697 ggttactttgtgtgcacattataattttataatatatctgtatatatttggaatatgtaa 638

                
Query: 591 atgct 595
           |||||
Sbjct: 637 atgct 633


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 3
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 595
Length of database: 995
Length adjustment: 10
Effective length of query: 585
Effective length of database: 985
Effective search space:   576225
Effective search space used:   576225
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information