MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-130F06
Chromosome	6 (Build37)
Map Location	84,496,366 - 84,496,549
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Stambp, LOC664956, Clec4f, Cd207, Vax2os2, Vax2os1, Vax2, Atp6v1b1, 1700124L16Rik, Ankrd53, Tex261, LOC665004, Nagk, Paip2b, LOC384450, LOC622683, LOC380687, LOC665098, LOC676366, Zfml, Dysf, LOC665114, 4930504D19Rik
Downstream gene	Cyp26b1, Exoc6b, LOC665129, Npm3-ps1, EG545861, EG623016, Spr, LOC665086, LOC665089, Emx1, Sfxn5, Rab11fip5, Noto, Smyd5, 1700040I03Rik, Cct7, Fbxo41, Egr4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stambp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70527 MGI:1917777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 234 ESTs, 4 Proteins pseudo : _no_value

name	Clec4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51811 MGI:1859834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246278 MGI:2180021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2os2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545859 MGI:3583303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2os1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574519 MGI:3583301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24113 MGI:1346018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110935 MGI:103285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700124L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67934 MGI:1915184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ankrd53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75305 MGI:1922555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex261 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21766 MGI:1096575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665004 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Nagk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56174 MGI:1860418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paip2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232164 MGI:2386865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 9 Proteins pseudo : _no_value

name	LOC622683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC380687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380687
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC665098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC676366 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Zfml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18139 MGI:1203484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dysf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins pseudo : _no_value

name	4930504D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cyp26b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 134 ESTs, 10 Proteins

name	LOC665129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 65 ESTs, 22 Proteins pseudo : _no_value

name	Npm3-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108176 MGI:894683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	EG545861 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545861 MGI:3647625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623016 MGI:3643297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Spr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20751 MGI:103078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Emx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94282 MGI:2137681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11fip5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52055 MGI:1098586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Noto (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384452 MGI:3053002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232187 MGI:108048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700040I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12468 MGI:107184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stambp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17941276 GeneID:70527 MGI:1917777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Stam binding protein transcript_id : NM_024239.1

name	Clec4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376709 GeneID:51811 MGI:1859834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member f transcript_id : NM_016751.3

name	Cd207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560763 GeneID:246278 MGI:2180021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD 207 antigen transcript_id : NM_144943.2

name	Vax2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357991 GeneID:24113 MGI:1346018
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ventral anterior homeobox containing gene 2 transcript_id : NM_011912.2

name	Atp6v1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371244 GeneID:110935 MGI:103285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit B1 transcript_id : NM_134157.2

name	1700124L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255221 GeneID:67934 MGI:1915184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 1700124L16 gene transcript_id : XM_001479355.1

name	Ankrd53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74315966 GeneID:75305 MGI:1922555
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 53 transcript_id : NM_029245.1

name	Tex261 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678296 GeneID:21766 MGI:1096575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 261 transcript_id : NM_009357.1

name	Nagk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506738 GeneID:56174 MGI:1860418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglucosamine kinase transcript_id : NM_019542.1

name	Paip2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165389 GeneID:232164 MGI:2386865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A) binding protein interacting protein 2B transcript_id : NM_146169.1

name	LOC676366 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255282 GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC676366 transcript_id : XM_001479937.1

name	Zfml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803255 GeneID:18139 MGI:1203484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin-like transcript_id : NM_008717.2

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026930 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_001077694.1

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174790 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_021469.2

name	4930504D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255285 GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504D19 gene transcript_id : XM_001479954.1

name	Cyp26b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341987 GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 26, subfamily b, polypeptide 1 transcript_id : NM_175475.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377959 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 132 ESTs, 8 Proteins product : exocyst complex component 6B, transcript variant 2 transcript_id : XM_889280.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377957 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 129 ESTs, 2 Proteins product : exocyst complex component 6B, transcript variant 1 transcript_id : XM_355790.4

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377961 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 7 Proteins product : exocyst complex component 6B, transcript variant 9 transcript_id : XM_978347.1

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255289 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 6 Proteins product : exocyst complex component 6B transcript_id : XM_001479977.1

name	EG545861 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778970 GeneID:545861 MGI:3647625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545861 transcript_id : NM_001034902.2

name	Spr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755625 GeneID:20751 MGI:103078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sepiapterin reductase transcript_id : NM_011467.1

name	Emx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832022 GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : empty spiracles homolog 1 (Drosophila) transcript_id : NM_010131.1

name	Sfxn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802372 GeneID:94282 MGI:2137681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 5 transcript_id : NM_178639.3

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743142 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_177466.4

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743141 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_001003955.2

name	Noto (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372169 GeneID:384452 MGI:3053002
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : notochord homolog (Xenopus laevis) transcript_id : NM_001007472.1

name	Smyd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450314 GeneID:232187 MGI:108048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 5 transcript_id : NM_144918.1

name	1700040I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606406 GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700040I03 gene transcript_id : NM_028505.1

name	Cct7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802764 GeneID:12468 MGI:107184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 7 (eta) transcript_id : NM_007638.3

name	Fbxo41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625733 GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 41 transcript_id : NM_001001160.2

name	Egr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130510 GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 4 transcript_id : NM_020596.2

name	Stambp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17941277 CCDS:CCDS20280.1 GeneID:70527 MGI:1917777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : associated molecule with the SH3 domain of STAM product : Stam binding protein protein_id : NP_077201.1

name	Clec4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560464 CCDS:CCDS20281.1 GeneID:51811 MGI:1859834
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 note : kupffer cell receptor; Kupffer cell c-type lectin receptor; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 13 product : C-type lectin, superfamily member 13 protein_id : NP_058031.2

name	Cd207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560764 GeneID:246278 MGI:2180021
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IDA] codon_start : 1 function : induction of Birbeck granules note : Langerhans cell specific c-type lectin product : CD207 antigen, langerin protein_id : NP_659192.2

name	Vax2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755957 CCDS:CCDS20282.1 GeneID:24113 MGI:1346018
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0031490 - chromatin DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ventral anterior homeobox containing gene 2 protein_id : NP_036042.1

name	Atp6v1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527064 CCDS:CCDS20283.1 GeneID:110935 MGI:103285
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IMP] [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0015988 - energy coupled proton transport, against electrochemical gradient [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence ISS] [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta 56/58 kDa, isoform 1; lysosomal 56/58kDa; ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 product : ATPase, H+ transporting, V1 subunit B, isoform 1 protein_id : NP_598918.1

name	1700124L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255222 GeneID:67934 MGI:1915184
definition	codon_start : 1 product : hypothetical protein LOC67934 protein_id : XP_001479405.1

name	Ankrd53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315967 CCDS:CCDS20284.1 GeneID:75305 MGI:1922555
definition	codon_start : 1 exception : mismatches in translation product : ankyrin repeat domain 53 protein_id : NP_083521.1

name	Tex261 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678297 CCDS:CCDS20285.1 GeneID:21766 MGI:1096575
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : testis expressed gene 261 protein_id : NP_033383.1

name	Nagk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506739 CCDS:CCDS20286.1 GeneID:56174 MGI:1860418
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0045127 - N-acetylglucosamine kinase activity [Evidence IDA]; GO:0009384 - N-acylmannosamine kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006044 - N-acetylglucosamine metabolism [Evidence IDA] codon_start : 1 function : amino sugar metabolism note : GlcNAc kinase product : N-acetylglucosamine kinase protein_id : NP_062415.1

name	Paip2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40807347 CCDS:CCDS20287.1 GeneID:232164 MGI:2386865
definition	codon_start : 1 product : poly(A) binding protein interacting protein 2B protein_id : NP_666281.2

name	LOC676366 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255283 GeneID:676366
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479987.1

name	Zfml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679098 CCDS:CCDS20288.1 GeneID:18139 MGI:1203484
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear protein 220 product : zinc finger protein 638 protein_id : NP_032743.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026931 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : dysferlin isoform 2 protein_id : NP_001071162.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174791 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : dysferlin isoform 1 protein_id : NP_067444.2

name	4930504D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255286 GeneID:78017 MGI:1925267
definition	codon_start : 1 product : hypothetical protein LOC78017 protein_id : XP_001480004.1

name	Cyp26b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202045 CCDS:CCDS20289.1 GeneID:232174 MGI:2176159
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0009954 - proximal/distal pattern formation [Evidence IMP]; GO:0042573 - retinoic acid metabolism [Evidence IC]; GO:0048384 - retinoic acid receptor signaling pathway [Evidence IDA] codon_start : 1 note : cytochrome P450 26B1; retinoic acid hydroxylase; cytochrome P450, 26, retinoic acid B1 product : cytochrome P450, family 26, subfamily b, polypeptide 1 protein_id : NP_780684.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255288 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 2 protein_id : XP_894373.3

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255287 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 1 protein_id : XP_355790.4

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255290 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 protein_id : XP_001480027.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377962 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 9 protein_id : XP_983441.1

name	EG545861 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778971 GeneID:545861 MGI:3647625
definition	codon_start : 1 product : hypothetical protein LOC545861 protein_id : NP_001030074.2

name	Spr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755626 GeneID:20751 MGI:103078
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004757 - sepiapterin reductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006729 - tetrahydrobiopterin biosynthesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : tetrahydrobiopterin biosynthesis product : sepiapterin reductase protein_id : NP_035597.1

name	Emx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832023 CCDS:CCDS20290.1 GeneID:13796 MGI:95387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : empty spiracles homolog 1 protein_id : NP_034261.1

name	Sfxn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519995 CCDS:CCDS20291.1 GeneID:94282 MGI:2137681
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 5 protein_id : NP_848754.1

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55743143 CCDS:CCDS20292.1 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : RAB11 family interacting protein 5 (class I) isoform 2 protein_id : NP_803417.3

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421788 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : RAB11 family interacting protein 5 (class I) isoform 1 protein_id : NP_001003955.1

name	Noto (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372170 CCDS:CCDS20293.1 GeneID:384452 MGI:3053002
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030903 - notochord development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Not homeodomain protein; floating head homolog product : notochord protein_id : NP_001007473.1

name	Smyd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450315 GeneID:232187 MGI:108048
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : retinoic acid responsive gene 1; retinoic acid induced 15 product : SET and MYND domain containing 5 protein_id : NP_659167.1

name	1700040I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606407 GeneID:73327 MGI:1920577
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73327 protein_id : NP_082781.1

name	Cct7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982472 CCDS:CCDS20295.1 GeneID:12468 MGI:107184
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chaperonin containing t-complex subunit eta product : chaperonin subunit 7 (eta) protein_id : NP_031664.2

name	Fbxo41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564092 CCDS:CCDS20296.1 GeneID:330369 MGI:1261912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 41 protein_id : NP_001001160.1

name	Egr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181102 CCDS:CCDS20297.1 GeneID:13656 MGI:99252
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : early growth response 4 protein_id : NP_065621.1

name	LOC665004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665004
definition	number : 1 pseudo : _no_value

name	LOC622683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622683
definition	number : 2 pseudo : _no_value

name	LOC622683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622683
definition	number : 1 pseudo : _no_value

name	LOC665098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665098
definition	number : 1 pseudo : _no_value

name	LOC665086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665086
definition	number : 2 pseudo : _no_value

name	LOC665086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665086
definition	number : 1 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 1 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 2 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 3 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 4 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:220745
definition	standard_name : RH138658

name	(CDS detail)
type	STS
link
xref	UniSTS:161209
definition	standard_name : RH124387

name	(CDS detail)
type	STS
link
xref	UniSTS:270053
definition	standard_name : PMC100023P1

name	(CDS detail)
type	STS
link
xref	UniSTS:186272
definition	standard_name : M-08868

name	(CDS detail)
type	STS
link
xref	UniSTS:130796
definition	standard_name : D6Mit247

name	(CDS detail)
type	STS
link
xref	UniSTS:179400
definition	standard_name : D18063

name	(CDS detail)
type	STS
link
xref	UniSTS:130971
definition	standard_name : D6Mit69

name	(CDS detail)
type	STS
link
xref	UniSTS:130983
definition	standard_name : D6Mit8.2

name	(CDS detail)
type	STS
link
xref	UniSTS:116325
definition	standard_name : D6Mit8

name	(CDS detail)
type	STS
link
xref	UniSTS:130982
definition	standard_name : D6Mit8.1

name	(CDS detail)
type	STS
link
xref	UniSTS:207983
definition	standard_name : AW742418

name	(CDS detail)
type	STS
link
xref	UniSTS:179405
definition	standard_name : Y17792

name	(CDS detail)
type	STS
link
xref	UniSTS:179404
definition	standard_name : AW208839

name	(CDS detail)
type	STS
link
xref	UniSTS:161668
definition	standard_name : RH124846

name	(CDS detail)
type	STS
link
xref	UniSTS:161057
definition	standard_name : RH124235

name	(CDS detail)
type	STS
link
xref	UniSTS:224529
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159525
definition	standard_name : AI480706

name	(CDS detail)
type	STS
link
xref	UniSTS:234959
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179402
definition	standard_name : AI323587

name	(CDS detail)
type	STS
link
xref	UniSTS:479305
definition	standard_name : Zfml

name	(CDS detail)
type	STS
link
xref	UniSTS:22169
definition	standard_name : RH45151

name	(CDS detail)
type	STS
link
xref	UniSTS:235475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164329
definition	standard_name : AI604795

name	(CDS detail)
type	STS
link
xref	UniSTS:145902
definition	standard_name : AU049455

name	(CDS detail)
type	STS
link
xref	UniSTS:130876
definition	standard_name : D6Mit322

name	(CDS detail)
type	STS
link
xref	UniSTS:130753
definition	standard_name : D6Mit21

name	(CDS detail)
type	STS
link
xref	UniSTS:246808
definition	standard_name : BF398420

name	(CDS detail)
type	STS
link
xref	UniSTS:256999
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:464663
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:115447
definition	standard_name : D4Got92

name	(CDS detail)
type	STS
link
xref	UniSTS:235476
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235478
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161259
definition	standard_name : RH124437

name	(CDS detail)
type	STS
link
xref	UniSTS:207984
definition	standard_name : BB456356

name	(CDS detail)
type	STS
link
xref	UniSTS:207985
definition	standard_name : AI182275

name	(CDS detail)
type	STS
link
xref	UniSTS:235477
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130765
definition	standard_name : D6Mit22

name	(CDS detail)
type	STS
link
xref	UniSTS:161704
definition	standard_name : RH124882

name	(CDS detail)
type	STS
link
xref	UniSTS:144504
definition	standard_name : Spr

name	(CDS detail)
type	STS
link
xref	UniSTS:226151
definition	standard_name : Emx1

name	(CDS detail)
type	STS
link
xref	UniSTS:222856
definition	standard_name : RH140790

name	(CDS detail)
type	STS
link
xref	UniSTS:130944
definition	standard_name : D6Mit391

name	(CDS detail)
type	STS
link
xref	UniSTS:130961
definition	standard_name : D6Mit6

name	(CDS detail)
type	STS
link
xref	UniSTS:118840
definition	standard_name : D4Rat47

name	(CDS detail)
type	STS
link
xref	UniSTS:16102
definition	standard_name : RH70059

name	(CDS detail)
type	STS
link
xref	UniSTS:162737
definition	standard_name : RH126025

name	(CDS detail)
type	STS
link
xref	UniSTS:159526
definition	standard_name : C75969

name	(CDS detail)
type	STS
link
xref	UniSTS:167495
definition	standard_name : AU022460

name	(CDS detail)
type	STS
link
xref	UniSTS:179407
definition	standard_name : AW536703

name	(CDS detail)
type	STS
link
xref	UniSTS:207986
definition	standard_name : RH127111

name	(CDS detail)
type	STS
link
xref	UniSTS:235479
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162345
definition	standard_name : RH125529

name	(CDS detail)
type	STS
link
xref	UniSTS:235482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161545
definition	standard_name : RH124723

name	(CDS detail)
type	STS
link
xref	UniSTS:119814
definition	standard_name : RH94566

name	LOC664956 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255280 GeneID:664956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 234 ESTs, 4 Proteins product : similar to ribosomal protein L5 pseudo : _no_value transcript_id : XR_034418.1

name	Vax2os2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872164 GeneID:545859 MGI:3583303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vax2 opposite strand transcript 2 transcript_id : NR_002871.1

name	Vax2os1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872168 GeneID:574519 MGI:3583301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vax2 opposite strand transcript 1 transcript_id : NR_002873.1

name	LOC384450 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255281 GeneID:384450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 9 Proteins product : similar to ribosomal protein L18 pseudo : _no_value transcript_id : XR_034442.1

name	LOC665114 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255284 GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_034464.1

name	LOC665129 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255291 GeneID:665129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 65 ESTs, 22 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034475.1

name	Npm3-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84794553 GeneID:108176 MGI:894683
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoplasmin 3, pseudogene 1 pseudo : _no_value transcript_id : NR_002702.1

name	EG623016 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255223 GeneID:623016 MGI:3643297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG623016 pseudo : _no_value transcript_id : XR_034185.1

clone name	MSMg01-430P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-368M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-072D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121C04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-138C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-212H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150A02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-063D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-478M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318N07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-268B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C16
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-008G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019H14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-130F06.T7 (MSMg01no130_f06.b1)	MSMg01-130F06.TJ (MSMg01no130_f06.g1)
ACC	AG338110	AG338111
length	738	765
length of high quality (start - end)	187 (123 - 309)	185 (72 - 256)
definition	CHROMAT_FILE: MSMg01no130_f06.b1 PHD_FILE: MSMg01no130_f06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:44:04 2005	CHROMAT_FILE: MSMg01no130_f06.g1 PHD_FILE: MSMg01no130_f06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:44:04 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCGAGAGAATCCGCGGAATTC CACATGTCNTCACACAACACCATCCTCTGTGCTAGGGTAACAGAATTTTA CTTGGGCTCTAGGTATCCCCATAAAGTCCTCACTCTTGTGTGTAAACACT TTATCCACCAAGCCATGTCCTCAGCCCAAACCACTGGTTGGTAATACCCT GTCCCAGAGAGTAACATAATCTAGATGGATCTGCTCTCTGCCACTTGGTC CTGGATTTTACGTTGGCTTTGTGGTCTTGAACAATCCTGTGCATCACTGG CAATGGTCACTGGTATTTGTTCCACACAGGTATCACCATAGAGTTCTGAG CTTATTTTTTTCCCCCCCTCCCCCCCCTCATTATGACGTACTGAAGGCTT TGTAAATTACCACCACCAACAAAAAAATGTACGCTGGGAGAAGCAAGTCT GGCTGTGATACAAGCTGAGGACAGTTCCACCTACTATTCCCCACCCTTGC TCACGCCTGGACTTTCCTCATCCCTTTATTTAGTACCCATGGTAATTTTG CCCTCCCTAAAGTATTGTACCAATTGGATTTTGTAAAGATGGTTTTCTCC AGGTTTCTAGGTTCCAACCTCCTCGCACCTAATACCTTTTTTAGAACCCA CATTTTTATACCCTGTTTTCGCCTTTGTTTAAACACCAACACCCTCCTTT ATTTTCACCCTTTTTACAACTCCCCCCCTCTCTTATTT	TGCXXXXXXXXXXXXXXXXXXXXXXXXXXTTTCTGACTAGGAGGTNGAAC TATAGAAGGTTTCGAAAAATTCAAAGGAGTCCAATTCCACTTTGGTTTTT GTTTGTTTGTTTTAATGTCCTGCTTGACTCCAAATTGTCCACATGGGTAA AGGATTACCTTGAACTTTGACGTCTCTGCTACCAGTTCCCGAGCATTGTG ATTATAGGTGAGCTTGTGGTGACTGGGCTTTCCCTTGTGCCCCAATTCCT GACAAGGTCAGTTTGTTCCCACCCTGGTGAAGGGAGACACTAAGTCATGA GAACCAGACCAATGAAGTGTATTTTTCTTGTCCTCAGATATGAGGCTTTC TCTGCTTCACTCTGCTCCTCCTCCTTCGTCTCCTCCTCCTCCTCCTCTTC CTTCTCCATTTCCCCCCCCACCTCTTCTTCCTCTTCCTCCCCTTCCTCAC CTTCCTCCTCTTCTTCCTCCTCTTTCTTTTCTTCCTCCTTTTTCCCTTCG TTCTCCTCTTTCCCCTCCTCTTCTCCTCTTCTCCTCCTCTTGTTCCTGCT TTTTTAGTTTTTGTCCTTTGTTCTTGCTCCCCCAACACATCTCGGAGATG TTCTCTTTTTCTATCTCATGACACTCCCTTGTCTTTTGTTCACTTTGCCT TTACCCTTTGGGTTTTGCCCTTCCCTTTTTTTATTCTCGTTTCCCTTCCC ACCTTCTTTTCCACCCCCCCTTTTCTCTTCCACCACATTTCGTTTCTCTT ATTCCTTCCCTCGCN
quality values	Open. Hide. 22 22 34 34 39 24 27 9 9 9 15 19 23 21 10 10 10 21 21 43 33 33 33 33 30 23 25 16 14 12 9 9 9 7 8 8 8 8 9 14 17 28 33 29 11 11 19 21 32 33 33 33 30 28 19 17 9 3 0 3 9 8 8 8 8 8 8 11 12 18 18 21 25 30 47 47 59 59 59 59 57 57 57 57 43 43 43 43 43 43 43 43 43 48 48 57 57 57 57 48 48 44 41 43 36 36 43 44 32 27 21 11 10 10 12 17 17 16 11 8 8 8 10 21 32 47 47 42 50 50 53 53 37 37 32 32 32 43 37 48 48 48 48 59 59 43 43 43 48 48 48 43 43 43 43 43 42 43 39 39 35 35 35 44 44 57 57 54 54 54 47 57 43 36 36 32 36 43 43 37 37 37 42 37 44 41 18 18 14 14 14 24 30 42 47 54 57 59 57 59 59 47 43 32 32 27 32 32 35 32 43 36 30 38 16 20 24 38 38 57 44 57 48 48 48 57 50 50 50 50 50 50 68 68 57 59 57 57 59 59 59 68 68 59 44 34 19 12 11 11 21 25 27 47 47 57 57 57 57 57 46 37 37 43 39 39 32 31 31 41 28 32 41 44 43 39 37 40 43 43 39 35 35 35 41 42 28 32 23 23 28 23 23 25 34 34 39 37 28 28 28 28 32 22 18 11 11 11 22 21 26 12 12 9 11 15 12 12 12 12 23 23 41 34 28 18 13 12 12 9 9 9 21 23 37 41 35 24 24 12 12 12 15 25 32 41 43 39 35 35 22 27 15 15 17 28 34 34 14 14 13 15 11 14 10 8 13 8 8 8 10 16 20 16 14 20 23 25 24 26 11 11 11 11 11 15 11 10 10 19 10 10 15 24 14 14 13 19 19 23 17 16 15 12 12 13 15 21 18 18 10 8 8 8 8 8 14 11 11 11 11 18 19 17 11 15 8 8 8 8 8 8 8 8 8 8 10 11 12 10 10 10 10 12 13 13 12 15 19 22 18 18 13 15 12 14 14 12 15 12 13 13 15 12 15 12 18 12 11 11 11 9 9 9 13 19 25 25 16 10 10 10 10 8 8 7 7 8 12 16 15 15 10 10 8 8 10 12 15 13 10 10 8 8 10 9 9 9 11 11 16 20 34 32 28 17 10 10 9 7 7 9 10 10 14 15 12 12 13 20 18 11 11 9 9 9 19 13 13 13 17 15 10 10 10 10 11 11 11 8 10 10 14 12 20 18 22 11 10 10 8 8 8 6 10 6 6 8 8 8 8 8 8 13 11 10 9 9 9 14 18 12 12 10 10 11 10 10 11 10 10 10 10 10 10 11 11 15 11 16 11 8 8 8 9 10 10 10 9 10 8 8 8 8 8 10 10 8 8 8 10 10 10 9 8 8 8 7 7 7 6 6 6 6 8 8 13 13 15 15 13 10 9 8 8 8 8 9 8 10 10 8 11 13 15 12 8 6 6 8 6 15 11 12 12 19 15 8 8 8 8 8 10 12 12 9 12 10 11 8 8 8 8 11 8 8 8 8 8 8 8 13 8 8 8 8 9 9 8 8 6 6 10 10 8 8 8 8 15 19 12 15 15 11 9 9 9 9 10 10 10 10 10 10 9 9 9 9 8 8 8 8 7 7 6 6 8 6	Open. Hide. 10 10 10 9 9 13 10 10 12 20 25 37 36 36 28 32 34 30 19 15 22 22 28 34 35 25 25 9 9 6 7 7 6 6 6 6 8 8 8 8 9 9 11 17 3 0 3 8 8 25 25 42 50 42 25 25 10 9 9 8 9 9 8 8 8 9 10 11 15 21 19 19 18 28 33 47 39 47 47 47 47 44 44 42 42 39 39 36 30 30 32 43 43 48 48 48 48 48 48 48 48 53 48 54 59 57 54 54 54 54 48 54 54 54 48 48 48 25 25 18 18 11 12 12 32 32 44 48 38 42 37 37 37 42 42 44 43 37 37 39 39 39 39 31 28 20 28 41 28 41 42 50 21 19 8 8 8 8 22 38 57 50 50 47 26 38 15 15 27 38 38 52 52 52 52 52 43 41 43 27 27 21 27 27 28 25 27 32 32 24 18 13 13 13 13 24 32 33 24 24 28 32 32 43 43 32 32 20 20 20 24 28 41 34 31 15 15 13 18 13 14 24 32 32 28 21 14 14 14 34 34 54 54 48 47 43 39 39 43 43 47 44 41 30 30 30 32 34 35 31 22 22 18 18 12 15 12 15 15 19 19 32 27 25 14 14 14 26 24 33 32 28 28 19 19 11 16 16 20 31 28 21 21 11 11 15 23 19 8 8 6 6 8 8 19 12 13 11 16 11 11 11 20 21 18 13 13 18 28 28 35 35 35 32 32 25 10 10 9 8 8 8 13 12 14 15 21 30 34 33 25 25 23 27 25 15 15 11 15 12 12 18 12 12 18 14 10 8 8 8 8 8 13 19 21 11 10 10 12 18 19 30 22 18 18 26 32 32 30 30 30 32 29 21 11 11 11 12 13 22 23 28 25 25 25 33 33 27 27 14 14 14 15 23 25 22 19 19 26 26 30 32 32 36 32 22 16 11 11 11 22 24 28 28 24 25 16 16 9 9 9 15 25 37 37 37 28 28 28 28 32 33 26 23 19 24 24 28 28 19 12 12 12 12 12 25 23 11 11 11 19 19 24 22 22 22 30 37 30 24 27 21 20 20 19 23 11 11 11 19 18 19 18 11 9 8 8 7 8 13 19 37 30 25 15 15 10 10 11 15 8 8 8 8 8 11 10 10 9 9 9 13 13 14 13 13 10 12 11 18 17 17 19 19 23 23 28 23 24 30 26 24 16 16 10 10 10 10 10 12 19 19 11 10 9 9 10 8 9 9 9 10 12 12 12 10 10 8 8 11 10 10 10 10 6 6 8 8 12 15 16 12 10 13 11 9 10 11 8 11 8 8 9 9 10 10 10 10 10 10 10 10 10 10 10 12 17 10 10 8 13 10 8 8 8 8 8 8 7 6 6 8 8 10 10 10 21 21 23 17 10 8 8 6 8 10 8 9 6 6 6 6 8 8 10 9 9 11 11 9 9 10 10 10 10 10 9 9 10 10 8 8 8 10 10 11 20 20 19 17 11 10 10 11 12 12 14 10 9 8 8 8 10 10 12 12 11 11 9 8 8 8 9 11 15 14 12 15 23 21 18 11 9 9 10 7 9 10 10 8 10 10 10 10 10 15 10 10 10 17 28 25 16 14 9 8 8 9 9 8 8 8 8 8 8 12 13 10 10 9 9 14 14 19 25 17 19 19 13 11 9 9 9 10 13 10 10 8 12 8 8 8 8 8 8 9 10 14 19 11 11 10 8 8 10 8 8 8 12 9 9 9 11 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no130_f06.b1 MSMg01no130_f06.b1 CHROMAT_FILE:
MSMg01no130_f06.b1 PHD_FILE: MSMg01no130_f06.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:44:04 2005
         (187 letters)



>mm_chr6_84496166_84496752
          Length = 587

 Score =  348 bits (180), Expect = e-100
 Identities = 183/184 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   aaagtcctcactcttgtgtgtaaacactttatccaccaagccatgtcctcagcccaaacc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 384 aaagtcctcactcttgtgtgtaaacactttatccaccaagccatgtcctcagcccaaacc 325

                                                                       
Query: 61  actggttggtaataccctgtcccagagagtaacataatctagatggatctgctctctgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 actggttggtaataccctgtcccagagagtaacataatctagatggatctgctctctgcc 265

                                                                       
Query: 121 acttggtcctggattttacgttggctttgtggtcttgaacaatcctgtgcatcactggca 180
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 264 acttggccctggattttacgttggctttgtggtcttgaacaatcctgtgcatcactggca 205

               
Query: 181 atgg 184
           ||||
Sbjct: 204 atgg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 187
Length of database: 587
Length adjustment: 8
Effective length of query: 179
Effective length of database: 579
Effective search space:   103641
Effective search space used:   103641
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information