MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-195F05
Chromosome	6 (Build37)
Map Location	48,661,037 - 48,661,697
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG384379, Pdia4, LOC100041154, Zfp786, Zfp398, Zfp282, Zfp212, A230106D06Rik, AI894139, LOC623601, Zfp777, Zfp746, LOC665990, Krba1, Zfp467, Sspo, EG666005, Atp6v0e2, Lrrc61, Rarres2, EG330305, Repin1, Zfp775, AI854703, Gimap8, LOC100040560, Gimap9, Gimap4, Gimap6
Downstream gene	Gimap7, LOC100041450, Gimap1, Gimap5, Gimap3, Tmem176b, Tmem176a, EG666105, Abp1, 1600015I10Rik, LOC100040589, Doxl2, Svs1, Gpnmb, LOC666011, Igf2bp3, LOC100040626, Tra2a, Ccdc126, D330028D13Rik, Stk31, LOC384383, LOC666210
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG384379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384379 MGI:3648986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Pdia4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12304 MGI:104864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041154 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 574 ESTs, 5 Proteins

name	Zfp786 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330301 MGI:3026883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272347 MGI:1917856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101095 MGI:2141413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232784 MGI:2682609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230106D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232785 MGI:3040704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 2 Proteins

name	AI894139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101197 MGI:2141515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins pseudo : _no_value

name	Zfp777 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72306 MGI:1919556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp746 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69228 MGI:1916478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 84 ESTs

name	LOC665990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Krba1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77827 MGI:1925077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68910 MGI:1916160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sspo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243369 MGI:2674311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666005 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666005 MGI:3648251
definition	note : predicted gene, EG666005 pseudo : _no_value

name	Atp6v0e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76252 MGI:1923502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243371 MGI:2652848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rarres2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71660 MGI:1918910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330305 MGI:3645688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Repin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58887 MGI:1889817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 6 mRNAs

name	Zfp775 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243372 MGI:2683557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI854703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243373 MGI:2141510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs

name	Gimap8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243374 MGI:2685303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Gimap9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317758 MGI:3511744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gimap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107526 MGI:1349656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gimap6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231931 MGI:1918876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gimap7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231932 MGI:1349657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Gimap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16205 MGI:109368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gimap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317757 MGI:2442232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gimap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83408 MGI:1932723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem176b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65963 MGI:1916348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem176a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66058 MGI:1913308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666105 MGI:3643446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Abp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76507 MGI:1923757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600015I10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69761 MGI:1917011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Doxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243376 MGI:3618290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243377 MGI:2682321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpnmb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93695 MGI:1934765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666011 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins pseudo : _no_value

name	Igf2bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140488 MGI:1890359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040626 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tra2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101214 MGI:1933972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57895 MGI:1889376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D330028D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231946 MGI:2442161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77485 MGI:1924735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC666210 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pdia4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198315 GeneID:12304 MGI:104864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 4 transcript_id : NM_009787.2

name	LOC100041154 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255135 GeneID:100041154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 574 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001475769.1

name	Zfp786 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803345 GeneID:330301 MGI:3026883
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 786 transcript_id : NM_177882.3

name	Zfp398 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353529 GeneID:272347 MGI:1917856
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 398 transcript_id : NM_173034.2

name	Zfp398 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803216 GeneID:272347 MGI:1917856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 398 transcript_id : NM_027477.2

name	Zfp282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158688 GeneID:101095 MGI:2141413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 282 transcript_id : NM_146175.3

name	Zfp212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704157 GeneID:232784 MGI:2682609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Zinc finger protein 212 transcript_id : NM_145576.1

name	AI894139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349487 GeneID:101197 MGI:2141515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI894139 transcript_id : NM_178898.3

name	Zfp777 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487042 GeneID:72306 MGI:1919556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 777 transcript_id : NM_001081382.1

name	Zfp746 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255126 GeneID:69228 MGI:1916478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 84 ESTs product : zinc finger protein 746 transcript_id : XM_904306.3

name	Krba1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048306 GeneID:77827 MGI:1925077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KRAB-A domain containing 1 transcript_id : NM_133922.2

name	Zfp467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181127 GeneID:68910 MGI:1916160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 467 transcript_id : NM_020589.1

name	Sspo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30424660 GeneID:243369 MGI:2674311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SCO-spondin transcript_id : NM_173428.1

name	Atp6v0e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50659089 GeneID:76252 MGI:1923502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit E2 transcript_id : NM_133764.2

name	Lrrc61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343159 GeneID:243371 MGI:2652848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 61 transcript_id : NM_177736.2

name	Rarres2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388214 GeneID:71660 MGI:1918910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid receptor responder (tazarotene induced) 2 transcript_id : NM_027852.2

name	EG330305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343695 GeneID:330305 MGI:3645688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330305 transcript_id : NM_183309.2

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952910 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_001079901.1

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953023 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_001079902.1

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953132 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_001079903.1

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953071 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_001079904.1

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953033 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_175099.3

name	Repin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953067 GeneID:58887 MGI:1889817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication initiator 1 transcript_id : NM_001079905.1

name	Zfp775 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129816 GeneID:243372 MGI:2683557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 775 transcript_id : NM_173429.2

name	Gimap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686117 GeneID:243374 MGI:2685303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 8 transcript_id : NM_001077410.1

name	Gimap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549089 GeneID:243374 MGI:2685303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 8 transcript_id : NM_212486.2

name	Gimap9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863244 GeneID:317758 MGI:3511744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 9 transcript_id : NM_174960.2

name	Gimap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549086 GeneID:107526 MGI:1349656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 4 transcript_id : NM_174990.3

name	Gimap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549087 GeneID:107526 MGI:1349656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 4 transcript_id : NM_175048.2

name	Gimap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863243 GeneID:231931 MGI:1918876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 6 transcript_id : NM_153175.3

name	Gimap7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549088 GeneID:231932 MGI:1349657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 7 transcript_id : NM_146167.3

name	LOC100041450 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255144 GeneID:100041450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100041450 transcript_id : XM_001476443.1

name	Gimap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549084 GeneID:16205 MGI:109368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 1 transcript_id : NM_008376.3

name	Gimap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56549085 GeneID:16205 MGI:109368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 1 transcript_id : NM_175860.2

name	Gimap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111161512 GeneID:317757 MGI:2442232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 5 transcript_id : NM_175035.5

name	Gimap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863241 GeneID:83408 MGI:1932723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, IMAP family member 3 transcript_id : NM_031247.3

name	Tmem176b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372371 GeneID:65963 MGI:1916348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 176B transcript_id : NM_023056.3

name	Tmem176a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353616 GeneID:66058 MGI:1913308
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 176A transcript_id : NM_025326.3

name	EG666105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255146 GeneID:666105 MGI:3643446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG666105 transcript_id : XM_981633.2

name	Abp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095012 GeneID:76507 MGI:1923757
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride binding protein 1 (amine oxidase, copper-containing) transcript_id : NM_029638.1

name	1600015I10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486896 GeneID:69761 MGI:1917011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600015I10 gene transcript_id : NM_001081273.1

name	Doxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725388 GeneID:243376 MGI:3618290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diamine oxidase-like protein 2 transcript_id : NM_001029987.1

name	Svs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379844 GeneID:243377 MGI:2682321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 1 transcript_id : NM_172888.2

name	Gpnmb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371734 GeneID:93695 MGI:1934765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein (transmembrane) nmb transcript_id : NM_053110.3

name	Igf2bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542991 GeneID:140488 MGI:1890359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 mRNA binding protein 3 transcript_id : NM_023670.2

name	LOC100040626 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255128 GeneID:100040626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040626 transcript_id : XM_001475004.1

name	Tra2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111160868 GeneID:101214 MGI:1933972
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformer 2 alpha homolog (Drosophila) transcript_id : NM_198102.2

name	Ccdc126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347233 GeneID:57895 MGI:1889376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 126 transcript_id : NM_175098.3

name	D330028D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375544 GeneID:231946 MGI:2442161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330028D13 gene transcript_id : NM_172727.2

name	Stk31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044415 GeneID:77485 MGI:1924735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine threonine kinase 31 transcript_id : NM_029916.1

name	Pdia4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198316 CCDS:CCDS20097.1 GeneID:12304 MGI:104864
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : endoplasmic reticulum protein 72; calcium binding protein, intestinal product : protein disulfide isomerase associated 4 protein_id : NP_033917.2

name	LOC100041154 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255136 GeneID:100041154
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475819.1

name	Zfp786 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244498 CCDS:CCDS20098.1 GeneID:330301 MGI:3026883
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 786 protein_id : NP_808550.1

name	Zfp398 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819592 CCDS:CCDS20099.1 GeneID:272347 MGI:1917856
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 398 isoform 1 protein_id : NP_081753.1

name	Zfp398 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370556 GeneID:272347 MGI:1917856
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 398 isoform 2 protein_id : NP_766622.1

name	Zfp282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158689 CCDS:CCDS20100.1 GeneID:101095 MGI:2141413
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 282 protein_id : NP_666287.3

name	Zfp212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704158 GeneID:232784 MGI:2682609
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Zinc finger protein C2H2-150 product : Zinc finger protein 212 protein_id : NP_663551.1

name	AI894139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725750 CCDS:CCDS20101.1 GeneID:101197 MGI:2141515
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC101197 protein_id : NP_849229.1

name	Zfp777 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487043 GeneID:72306 MGI:1919556
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein product : zinc finger protein 777 protein_id : NP_001074851.1

name	Zfp746 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255127 GeneID:69228 MGI:1916478
definition	codon_start : 1 product : zinc finger protein 746 protein_id : XP_909399.3

name	Krba1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048307 CCDS:CCDS20102.1 GeneID:77827 MGI:1925077
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : KRAB-A domain containing 1 protein_id : NP_598683.2

name	Zfp467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181128 GeneID:68910 MGI:1916160
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : zinc finger protein EZI protein_id : NP_065614.1

name	Sspo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424661 GeneID:243369 MGI:2674311
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0030414 - protease inhibitor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : subcommissural organ spondin protein_id : NP_775604.1

name	Atp6v0e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526978 CCDS:CCDS20103.1 GeneID:76252 MGI:1923502
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal, V0 subunit E product : ATPase, H+ transporting, V0 subunit protein_id : NP_598525.1

name	Lrrc61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244222 GeneID:243371 MGI:2652848
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat containing 61 protein_id : NP_808404.1

name	Rarres2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313658 CCDS:CCDS20105.1 GeneID:71660 MGI:1918910
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : chemerin product : retinoic acid receptor responder (tazarotene induced) 2 protein_id : NP_082128.1

name	EG330305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34303989 GeneID:330305 MGI:3645688
definition	codon_start : 1 product : hypothetical protein LOC330305 protein_id : NP_899132.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952911 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_001073370.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953024 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_001073371.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953133 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_001073372.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953072 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_001073373.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953068 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_001073374.1

name	Repin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953034 GeneID:58887 MGI:1889817
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 464 (RIP60) product : replication initiator 1 protein_id : NP_780308.2

name	Zfp775 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734126 CCDS:CCDS20107.1 GeneID:243372 MGI:2683557
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 775 protein_id : NP_775605.1

name	Gimap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116686118 GeneID:243374 MGI:2685303
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : immune-associated nucleotide-binding protein 9; immunity-associated protein 8 product : GTPase, IMAP family member 8 protein_id : NP_001070878.1

name	Gimap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059011 CCDS:CCDS20108.1 GeneID:243374 MGI:2685303
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : immune-associated nucleotide-binding protein 9; immunity-associated protein 8 product : GTPase, IMAP family member 8 protein_id : NP_997651.1

name	Gimap9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28144914 CCDS:CCDS20109.1 GeneID:317758 MGI:3511744
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : immune associated nucleotide family member product : GTPase, IMAP family member 9 protein_id : NP_777620.1

name	Gimap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28416440 CCDS:CCDS20110.1 GeneID:107526 MGI:1349656
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; immune associated nucleotide 1 product : GTPase, IMAP family member 4 isoform a protein_id : NP_778155.2

name	Gimap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28416442 GeneID:107526 MGI:1349656
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; immune associated nucleotide 1 product : GTPase, IMAP family member 4 isoform b protein_id : NP_778213.1

name	Gimap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346632 CCDS:CCDS20111.1 GeneID:231931 MGI:1918876
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : immune-associated nucleotide 6; immune associated nucleotide 6 product : GTPase, IMAP family member 6 protein_id : NP_694815.1

name	Gimap7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122705 CCDS:CCDS20112.1 GeneID:231932 MGI:1349657
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : immune associated nucleotide 3 product : GTPase, IMAP family member 7 protein_id : NP_666279.1

name	LOC100041450 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255145 GeneID:100041450
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476493.1

name	Gimap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28559037 CCDS:CCDS20113.1 GeneID:16205 MGI:109368
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : immune associated nucleotide family member; immunity-associated protein, 38 kDa product : GTPase, IMAP family member 1 protein_id : NP_032402.2

name	Gimap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28559035 CCDS:CCDS20113.1 GeneID:16205 MGI:109368
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : immune associated nucleotide family member; immunity-associated protein, 38 kDa product : GTPase, IMAP family member 1 protein_id : NP_787056.1

name	Gimap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923913 CCDS:CCDS20114.1 GeneID:317757 MGI:2442232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : GTPase, IMAP family member 5 protein_id : NP_778200.1

name	Gimap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28144918 CCDS:CCDS20115.1 GeneID:83408 MGI:1932723
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : immune associated nucleotide 4 product : GTPase, IMAP family member 3 protein_id : NP_112537.2

name	Tmem176b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746434 CCDS:CCDS20116.1 GeneID:65963 MGI:1916348
definition	codon_start : 1 product : LR8 protein protein_id : NP_075543.1

name	Tmem176a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560270 GeneID:66058 MGI:1913308
definition	codon_start : 1 exception : mismatches in translation note : kidney expressed gene 2 product : hepatocellular carcinoma-associated antigen 112 protein_id : NP_079602.3

name	EG666105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377362 GeneID:666105 MGI:3643446
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986727.1

name	Abp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095013 GeneID:76507 MGI:1923757
definition	GO_function : GO:0008131 - amine oxidase activity [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015898 - amiloride transport [Evidence ISS]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : amiloride binding protein 1 (amine oxidase, copper-containing) protein_id : NP_083914.1

name	1600015I10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486897 GeneID:69761 MGI:1917011
definition	codon_start : 1 product : hypothetical protein LOC69761 protein_id : NP_001074742.1

name	Doxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725389 CCDS:CCDS20120.1 GeneID:243376 MGI:3618290
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA] codon_start : 1 product : diamine oxidase-like protein 2 protein_id : NP_001025158.1

name	Svs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370356 CCDS:CCDS20121.1 GeneID:243377 MGI:2682321
definition	GO_function : GO:0005507 - copper ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : seminal vesicle secretion 1; SVS I product : seminal vesicle-secreted protein I protein_id : NP_766476.1

name	Gpnmb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542907 CCDS:CCDS20122.1 GeneID:93695 MGI:1934765
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0005178 - integrin binding [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 exception : mismatches in translation note : iris pigment dispersion; Osteoactivin product : glycoprotein (transmembrane) nmb protein_id : NP_444340.2

name	Igf2bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542992 GeneID:140488 MGI:1890359
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : insulin-like growth factor 2, binding protein 3 protein_id : NP_076159.2

name	LOC100040626 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255129 GeneID:100040626
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475054.1

name	Tra2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111160869 GeneID:101214 MGI:1933972
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : nuclear transformer-2 alpha; Tra2alpha product : transformer-2 alpha protein_id : NP_932770.2

name	Ccdc126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424699 CCDS:CCDS20125.1 GeneID:57895 MGI:1889376
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : coiled-coil domain containing 126 protein_id : NP_780307.1

name	D330028D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370060 CCDS:CCDS20126.1 GeneID:231946 MGI:2442161
definition	codon_start : 1 product : hypothetical protein LOC231946 protein_id : NP_766315.1

name	Stk31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044416 GeneID:77485 MGI:1924735
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine threonine kinase 31 protein_id : NP_084192.1

name	EG384379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384379
definition	number : 2 pseudo : _no_value

name	EG384379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384379
definition	number : 1 pseudo : _no_value

name	LOC665990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665990
definition	number : 1 pseudo : _no_value

name	LOC100040560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040560
definition	number : 4 pseudo : _no_value

name	LOC100040560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040560
definition	number : 3 pseudo : _no_value

name	LOC100040560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040560
definition	number : 2 pseudo : _no_value

name	LOC100040560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040560
definition	number : 1 pseudo : _no_value

name	LOC100040589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040589
definition	number : 2 pseudo : _no_value

name	LOC100040589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040589
definition	number : 1 pseudo : _no_value

name	LOC384383 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384383
definition	number : 1 pseudo : _no_value

name	LOC666210 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666210
definition	number : 1 pseudo : _no_value

name	LOC666210 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666210
definition	number : 2 pseudo : _no_value

name	LOC666210 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666210
definition	number : 3 pseudo : _no_value

name	LOC666210 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666210
definition	number : 4 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130868
definition	standard_name : D6Mit315

name	(CDS detail)
type	STS
link
xref	UniSTS:159497
definition	standard_name : AI987846

name	(CDS detail)
type	STS
link
xref	UniSTS:207947
definition	standard_name : BE335567

name	(CDS detail)
type	STS
link
xref	UniSTS:235433
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235432
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224892
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159498
definition	standard_name : AI449432

name	(CDS detail)
type	STS
link
xref	UniSTS:207948
definition	standard_name : RH127077

name	(CDS detail)
type	STS
link
xref	UniSTS:250442
definition	standard_name : AI178375

name	(CDS detail)
type	STS
link
xref	UniSTS:123800
definition	standard_name : 27.MMHAP70FRA12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179369
definition	standard_name : AI894139

name	(CDS detail)
type	STS
link
xref	UniSTS:261126
definition	standard_name : AA859256

name	(CDS detail)
type	STS
link
xref	UniSTS:210166
definition	standard_name : RH136171

name	(CDS detail)
type	STS
link
xref	UniSTS:124090
definition	standard_name : 34.MMHAP44FLD4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130949
definition	standard_name : D6Mit43

name	(CDS detail)
type	STS
link
xref	UniSTS:225171
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159501
definition	standard_name : AI448780

name	(CDS detail)
type	STS
link
xref	UniSTS:185666
definition	standard_name : AI853106

name	(CDS detail)
type	STS
link
xref	UniSTS:179368
definition	standard_name : AI426952

name	(CDS detail)
type	STS
link
xref	UniSTS:179370
definition	standard_name : AV017623

name	(CDS detail)
type	STS
link
xref	UniSTS:235439
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235436
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207952
definition	standard_name : AW822046

name	(CDS detail)
type	STS
link
xref	UniSTS:165464
definition	standard_name : AI448302

name	(CDS detail)
type	STS
link
xref	UniSTS:235441
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490589
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165465
definition	standard_name : AI425994

name	(CDS detail)
type	STS
link
xref	UniSTS:235440
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207949
definition	standard_name : BB283937

name	(CDS detail)
type	STS
link
xref	UniSTS:207950
definition	standard_name : AI182503

name	(CDS detail)
type	STS
link
xref	UniSTS:165463
definition	standard_name : AI854703

name	(CDS detail)
type	STS
link
xref	UniSTS:130867
definition	standard_name : D6Mit314

name	(CDS detail)
type	STS
link
xref	UniSTS:185665
definition	standard_name : BB145400

name	(CDS detail)
type	STS
link
xref	UniSTS:207951
definition	standard_name : BB276914

name	(CDS detail)
type	STS
link
xref	UniSTS:210423
definition	standard_name : RH136437

name	(CDS detail)
type	STS
link
xref	UniSTS:130976
definition	standard_name : D6Mit74

name	(CDS detail)
type	STS
link
xref	UniSTS:130821
definition	standard_name : D6Mit274

name	(CDS detail)
type	STS
link
xref	UniSTS:159502
definition	standard_name : AI449249

name	(CDS detail)
type	STS
link
xref	UniSTS:271715
definition	standard_name : PMC186618P3

name	(CDS detail)
type	STS
link
xref	UniSTS:185667
definition	standard_name : BB168546

name	(CDS detail)
type	STS
link
xref	UniSTS:271715
definition	standard_name : PMC186618P3

name	(CDS detail)
type	STS
link
xref	UniSTS:216450
definition	standard_name : RH133167

name	(CDS detail)
type	STS
link
xref	UniSTS:159500
definition	standard_name : AU040201

name	(CDS detail)
type	STS
link
xref	UniSTS:124755
definition	standard_name : D17978

name	(CDS detail)
type	STS
link
xref	UniSTS:235437
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235435
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130866
definition	standard_name : D6Mit313

name	(CDS detail)
type	STS
link
xref	UniSTS:159503
definition	standard_name : AI429442

name	(CDS detail)
type	STS
link
xref	UniSTS:234646
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235438
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130685
definition	standard_name : D6Mit142

name	(CDS detail)
type	STS
link
xref	UniSTS:159499
definition	standard_name : AU045931

name	(CDS detail)
type	STS
link
xref	UniSTS:162201
definition	standard_name : RH125379

name	(CDS detail)
type	STS
link
xref	UniSTS:163033
definition	standard_name : RH126325

name	(CDS detail)
type	STS
link
xref	UniSTS:224448
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:245060
definition	standard_name : AI713502

name	(CDS detail)
type	STS
link
xref	UniSTS:479159
definition	standard_name : Tra2a

name	(CDS detail)
type	STS
link
xref	UniSTS:162175
definition	standard_name : RH125353

name	(CDS detail)
type	STS
link
xref	UniSTS:207953
definition	standard_name : BE136002

name	(CDS detail)
type	STS
link
xref	UniSTS:161352
definition	standard_name : RH124530

name	(CDS detail)
type	STS
link
xref	UniSTS:235443
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159505
definition	standard_name : AI465320

name	(CDS detail)
type	STS
link
xref	UniSTS:235442
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:224939
definition

name	A230106D06Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255124 GeneID:232785 MGI:3040704
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 2 Proteins product : RIKEN cDNA A230106D06 gene transcript_id : XR_031849.1

name	LOC623601 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255125 GeneID:623601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 5 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_031857.1

name	AI854703 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255141 GeneID:243373 MGI:2141510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 ESTs product : expressed sequence AI854703 transcript_id : XR_035307.1

name	LOC666011 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255149 GeneID:666011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_032935.1

clone name	MSMg01-542G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502E13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-388P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-297J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-447C02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356B08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-460L23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047K20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-195F05.T7 (MSMg01no195_f05.b1)	MSMg01-195F05.TJ (MSMg01no195_f05.g1)
ACC	AG383896	AG383897
length	731	735
length of high quality (start - end)	502 (46 - 547)	661 (75 - 735)
definition	CHROMAT_FILE: MSMg01no195_f05.b1 PHD_FILE: MSMg01no195_f05.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:14:31 2005	CHROMAT_FILE: MSMg01no195_f05.g1 PHD_FILE: MSMg01no195_f05.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:14:31 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAATTGACTCGGATATGTTGGTAATATTAATTTTCATATTAAGGA ATATTAAGGAAAAGTGATTGTTACTTCCTGTTAATTTTTTTTGTTAGAGG TGGAATTATGTTTGTGTGGGTTTGTTGAAAGATTACTTTCTTGCTTTTTC TAGGGTGTAGTTTCACTCCTTGTGTTGGTGTTTTCCATCTATTATCCTTT GTAGGGCTGGATTTGTGGAAAGATATTGTATAAATTTGATTTTGTCATTG AATATCTTGTTTTCTCCGTCTATGGTGATTGAGAGTTTTGCTGGGTATAG TAGCCTGGGCTGGCATTGTATTCTCTTAGTGTCTGTATGGCATCTGCCCA GGATCTTCTAGCTTTCATAGTCTCTGTTGAAAAGTCTGGTGTAATTCTGA TAGATCTGCCTTTATATGTTACCTGACCCTTTTCCCTTACTGCTTTTAAA ATTATTTCTTTATTTAGTGCATTTGGTGTTTTGATTATTATGTGATGGGA GGAATTTCTTCGCTTGTCCCGCCTATTGGAAGCTCTAAAGGCTTCTTCGA TGTTCATGCGCATCTTTTTCTTCACGCCACACCCTCTTCCACCCACCTCT TCTGGATATTCCCCTGGCCAACCCATCGCGAATATCCCCCTCTCTTCTAC ACCACCATCCCTATCCTTTGCCTTCCCCCCG	ATGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXTCTGTTCAGTAGCACTAGCTCCTCAG TTCCTGGTAAAATACAAACAAACTCTGGAATAAAAGCACTGGCTTCAGTC CCTTGAAGGTCTCCAAATTTCCATTCAAAACCAGGGAACTTCCTCCAGAA AAGTTAAATCATCCAAAGTGAGACTGGGAAGTAAAGGTTGGAAAGAGCTC TACACCCGAACATCACATTTTTATCTCACATCCGTCAGGTTGGGCCCAGC TCTGCTGCAGTAACAAGTACTGAGTTCTCAGGAGCTAAATGCCAGCTGAT GTCTGGCCCGATCTGCCACAGATCTGAGAGACTCAAAGCCATCTTACAGA AAACAGTAGATATCAGAACTAAAAACAGATGCTTCATTCTGATTATGAAT GTGAAAAGCAACAGAATTTATATAGGTGATGAACATGATAACAGAGTACT ATGTAAGTCCTAAAAAACACCCATGTTGAGACAATGTGCTGACTAACACT GGGAAACTGGCACAAGGGTGTCCAGCATATGCCCACAGAGCCCTACACAT GGTCCAAGACAAGGCAGAACTTACTTAAAGTGTGAGGTTTATTTATTTAC TTACTTATTGCAGATTAGTGTTTGCCTGTATGTGTACAGGTGCCCTATGT GTATGACTTTGCTGTAGTGGTGAGAAAAGTGCACN
quality values	Open. Hide. 6 6 6 6 6 7 14 34 59 47 33 32 32 28 28 28 30 30 30 33 33 37 37 48 39 25 22 19 13 13 9 13 14 13 12 12 12 12 12 12 19 19 21 21 21 28 32 47 39 38 38 36 36 33 30 28 21 22 22 21 20 19 9 9 9 9 9 19 23 30 31 37 39 44 44 53 53 53 57 53 53 53 53 53 53 53 48 47 42 42 42 48 48 57 68 57 57 57 50 50 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 48 46 48 54 54 46 47 47 59 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 57 57 57 57 57 50 50 50 50 50 50 50 50 50 50 50 57 57 57 57 57 59 59 59 59 59 54 59 59 68 68 68 68 68 68 57 57 57 59 59 59 52 52 52 59 57 57 57 59 59 59 52 43 43 59 44 68 68 68 68 68 59 59 44 44 43 43 52 52 57 57 52 43 44 59 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 52 52 52 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 47 62 52 52 43 43 31 31 43 44 39 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 52 62 62 62 62 68 62 62 44 43 31 43 43 62 62 62 62 62 62 62 47 59 39 43 35 43 44 44 43 52 52 52 38 44 44 62 44 44 43 43 43 62 62 68 62 59 68 59 59 39 43 43 57 57 57 57 52 52 52 52 57 44 57 52 43 43 57 57 52 57 57 57 57 57 57 57 57 44 44 43 43 57 57 57 57 57 57 57 57 57 52 52 52 57 59 59 43 43 43 52 59 59 52 52 52 57 50 57 57 52 52 52 52 54 57 57 57 57 59 52 52 52 44 44 54 54 54 59 59 59 59 59 59 59 59 59 59 57 57 54 54 57 57 57 57 57 54 54 54 59 59 57 57 57 57 57 57 47 42 41 43 43 57 57 57 48 48 48 43 46 29 30 15 24 14 14 23 28 37 41 32 28 20 20 34 34 20 31 32 43 43 57 48 50 43 48 34 34 23 23 23 28 28 21 20 20 28 28 24 24 19 19 24 24 21 11 10 6 7 8 8 11 21 18 16 13 10 10 10 15 21 20 18 12 12 11 8 8 8 8 8 8 10 8 8 8 13 14 18 13 17 10 8 8 6 6 10 10 12 11 11 12 11 10 10 11 11 9 9 9 11 11 11 11 25 11 11 9 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 15 11 12 12 12 12 11 10 10 9 9 9 9 11 11 12 11 9 9 12 12 10 11 10 10 10 13 10 8 8 8 8 6 6 6 10 8 10 11 10 10 10 8 8 7 6 8 8 9 10 14 12 9 12 9 11 11 13 13 10 10 8 8 9 9 10 10 13 9 9 10 14 23 15 15 12 8 8 8 8 8 8 8 8 8 8 17 12 19 12 8 8 6 6	Open. Hide. 19 21 15 10 10 10 10 23 23 35 28 32 32 31 31 35 37 37 39 39 37 37 43 40 39 39 34 30 23 18 11 11 11 9 11 15 10 14 24 24 28 29 48 48 48 57 44 44 39 39 42 42 47 43 43 53 57 43 40 21 19 16 16 20 24 30 42 41 42 42 42 42 41 42 43 43 43 44 48 41 42 37 42 42 57 36 36 37 40 44 57 42 42 42 42 44 42 39 37 48 48 42 42 43 42 44 44 57 68 68 68 57 57 48 47 47 57 50 54 50 57 50 50 37 43 43 59 57 57 68 68 68 68 57 57 57 57 52 52 52 57 52 43 43 43 43 37 50 37 42 43 43 52 57 50 68 68 57 57 37 37 52 57 52 52 59 59 59 59 52 52 52 57 57 57 39 39 57 57 57 52 52 52 57 57 57 57 45 39 52 52 52 52 52 43 43 43 44 57 68 57 57 57 57 57 57 44 62 52 52 52 52 52 52 52 62 62 68 68 68 62 62 52 52 43 44 59 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 39 43 43 62 43 52 52 62 52 52 62 62 62 62 62 62 52 62 62 62 62 68 68 62 62 52 52 52 52 52 62 62 62 62 62 45 52 52 52 62 62 68 68 62 62 62 39 39 43 43 43 43 35 43 43 52 43 52 62 44 52 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 43 43 43 43 35 59 59 62 52 52 62 62 62 62 62 52 52 52 45 52 52 52 62 62 62 62 52 52 43 59 47 35 35 43 43 62 52 52 52 62 52 45 43 43 43 62 62 52 52 43 44 44 68 62 62 43 62 43 43 39 62 59 43 39 39 43 39 43 43 44 43 52 52 62 62 62 62 62 62 62 62 62 68 68 68 44 44 43 43 31 44 44 43 43 62 62 62 62 62 62 62 62 62 62 62 52 62 62 52 52 43 62 43 43 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 52 52 52 62 62 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 52 62 62 62 62 39 62 62 62 62 68 68 68 62 62 45 45 52 52 62 62 68 62 62 62 62 62 62 57 57 57 59 59 68 57 57 57 57 52 57 57 57 57 59 59 52 57 57 57 57 57 57 57 57 57 52 57 57 59 57 57 57 57 57 57 57 57 57 57 43 52 52 59 59 68 68 59 59 43 43 43 50 57 57 57 59 59 59 57 52 52 52 52 52 52 59 59 50 35 35 50 50 52 52 52 48 48 50 44 44 32 32 43 43 57 57 54 54 54 57 59 48 48 48 57 57 46 46 47 57 47 48 44 59 59 59 59 44 44 43 43 37 44 44 48 48 44 59 57 57 54 54 54 68 68 68 68 68 68 68 68 68 57 54 54 54 54 57 57 32 32 20 28 28 28 34 47 46 47 43 43 39 48 43 43 43 44 48 57 48 48 48 48 46 41 41 41 41 43 39 32 31 39 39 39 39 35 35 35 39 35 32 32 37 37 37 39 59 48 47 47 40 39 37 37 35 31 31 30 34 25 28 28 41 41 39 35 35 22 23 11 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no195_f05.g1 MSMg01no195_f05.g1 CHROMAT_FILE:
MSMg01no195_f05.g1 PHD_FILE: MSMg01no195_f05.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:14:31 2005
         (661 letters)



>mm_chr6_48660837_48661898
          Length = 1062

 Score = 1201 bits (621), Expect = 0.0
 Identities = 651/661 (98%), Gaps = 1/661 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tctgttcagtagcactagctcctcagttcctggtaaaatacaaacaaactctggaataaa 60
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 861 tctgttcagaagcactagctcctcagttcctggtaaaatacaaacaaactctggaataaa 802

                                                                       
Query: 61  agcactggcttcagtcccttgaaggtctccaaatttccattcaaaaccagggaacttcct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 801 agcactggcttcagtcccttgaaggtctccaaatttccattcaaaaccagggaacttcct 742

                                                                       
Query: 121 ccagaaaagttaaatcatccaaagtgagactgggaagtaaaggttggaaagagctctaca 180
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 ccagagaagttaaatcatccaaagtgagactgggaagtaaaggttggaaagagctctaca 682

                                                                       
Query: 181 cccgaacatcacatttttatctcacatccgtcaggttgggcccagctctgctgcagtaac 240
           ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 681 cccgaacatcacatttttatctcgcatccgtcaggctgggcccagctctgctgcagtaac 622

                                                                       
Query: 241 aagtactgagttctcaggagctaaatgccagctgatgtctggcccgatctgccacagatc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 aagtactgagttctcaggagctaaatgccagctgatgtctggcccgatctgccacagatc 562

                                                                       
Query: 301 tgagagactcaaagccatcttacagaaaacagtagatatcagaactaaaaacagatgctt 360
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 561 tgagagactcaaagccatctgacagaaaacagtagatatcagaactaaaaacagatgctt 502

                                                                       
Query: 361 cattctgattatgaatgtgaaaagcaacagaatttatataggtgatgaacatgataacag 420
           ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 cattctgattatgaaagggaaaagcaacagaatttatataggtgatgaacatgataacag 442

                                                                       
Query: 421 agtactatgtaagtcctaaaaaacacccatgttgagacaatgtgctgactaacactggga 480
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 441 agtactatgtaagtcctaaaaaccacccatgttgagacaatgtgctgactaacactggga 382

                                                                       
Query: 481 aactggcacaagggtgtccagcatatgcccacagagccctacacatggtccaagacaagg 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 aactggcacaagggtgtccagcatatgcccacagagccctacacatggtccaagacaagg 322

                                                                       
Query: 541 cagaacttacttaaagtgtgaggtttatttatttacttacttattgcagattagtgtttg 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 cagaacttacttaaagtgtgaggtttatttatttacttacttattgcagattagtgtttg 262

                                                                       
Query: 601 cctgtatgtgtacaggtgccctatgtgtatgact-ttgctgtagtggtgagaaaagtgca 659
           |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 261 cctgcatgtgtacaggtgccctatgtgtatgactgttgctgtagtggtgagaaaagtgca 202

            
Query: 660 c 660
           |
Sbjct: 201 c 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 28
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 661
Length of database: 1062
Length adjustment: 10
Effective length of query: 651
Effective length of database: 1052
Effective search space:   684852
Effective search space used:   684852
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information