MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-306K18
Chromosome	6 (Build37)
Map Location	39,531,364 - 39,531,723
singlet/doublet	singlet
Overlap gene	Adck2
Upstream gene	Luc7l2, Klrg2, LOC665180, Hipk2, Tbxas1, 1700025N23Rik, Parp12, 4930599N23Rik, A630082K20Rik, Slc37a3, Rab19, Mkrn1, ENSMUSG00000068601, Dennd2a
Downstream gene	Ndufb2, Braf, Fth-ps2, Mrps33, LOC665247, LOC665254, EG434008, Agk, E330009J07Rik, BC052883, Ssbp1, Tas2r137, Tas2r108, 1700016G05Rik, LOC669661, Olfr461, Olfr460, Clec5a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Luc7l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192196 MGI:2183260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74253 MGI:1921503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins

name	Hipk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15258 MGI:1314872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbxas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21391 MGI:98497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69986 MGI:1917236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Parp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243771 MGI:2143990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930599N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75379 MGI:1922629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	A630082K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338523 MGI:2443388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc37a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72144 MGI:1919394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19331 MGI:103292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mkrn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54484 MGI:1859353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000068601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621427 MGI:3642504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Dennd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209773 MGI:2444961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68198 MGI:1915448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Braf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109880 MGI:88190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fth-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14321 MGI:104594
definition	gene_synonym : Fth-rs2 note : ferritin heavy chain, pseudogene 2 pseudo : _no_value

name	Mrps33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14548 MGI:1338046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC665254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	EG434008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434008 MGI:3647581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69923 MGI:1917173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330009J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243780 MGI:2444256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052883 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381759 MGI:3027899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tas2r137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas2r108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67690 MGI:1914940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Olfr461 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr460 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Luc7l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373166 GeneID:192196 MGI:2183260
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LUC7-like 2 (S. cerevisiae) transcript_id : NM_138680.1

name	Klrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964697 GeneID:74253 MGI:1921503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily G, member 2 transcript_id : NM_001033171.2

name	LOC665180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255062 GeneID:665180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins product : similar to CD69-like protein transcript_id : XM_975103.2

name	Hipk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754197 GeneID:15258 MGI:1314872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain interacting protein kinase 2 transcript_id : NM_010433.1

name	Tbxas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750132 GeneID:21391 MGI:98497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thromboxane A synthase 1, platelet transcript_id : NM_011539.3

name	1700025N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377273 GeneID:69986 MGI:1917236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025N23 gene transcript_id : XM_978377.1

name	Parp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802986 GeneID:243771 MGI:2143990
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 12 transcript_id : NM_172893.2

name	A630082K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374237 GeneID:338523 MGI:2443388
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630082K20 gene transcript_id : NM_001033430.2

name	Slc37a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71143149 GeneID:72144 MGI:1919394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 37 (glycerol-3-phosphate transporter), member 3 transcript_id : NM_028123.2

name	Rab19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859607 GeneID:19331 MGI:103292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB19, member RAS oncogene family transcript_id : NM_011226.1

name	Mkrn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055273 GeneID:54484 MGI:1859353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : makorin, ring finger protein, 1 transcript_id : NM_018810.1

name	ENSMUSG00000068601 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255064 GeneID:621427 MGI:3642504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, ENSMUSG00000068601 transcript_id : XM_001474075.1

name	Dennd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366403 GeneID:209773 MGI:2444961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 2A transcript_id : NM_172477.2

name	Adck2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803492 GeneID:57869 MGI:1889336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 2 transcript_id : NM_178873.3

name	Ndufb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386282 GeneID:68198 MGI:1915448
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 transcript_id : NM_026612.2

name	Braf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801723 GeneID:109880 MGI:88190
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Braf transforming gene transcript_id : NM_139294.4

name	Mrps33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331152 GeneID:14548 MGI:1338046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S33 transcript_id : NM_001010930.1

name	Mrps33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331151 GeneID:14548 MGI:1338046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S33 transcript_id : NM_010270.2

name	EG434008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801946 GeneID:434008 MGI:3647581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434008 transcript_id : NM_001004182.2

name	Agk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537517 GeneID:69923 MGI:1917173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylglycerol kinase transcript_id : NM_023538.1

name	E330009J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802116 GeneID:243780 MGI:2444256
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330009J07 gene transcript_id : NM_175528.3

name	BC052883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235772 GeneID:381759 MGI:3027899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052883 transcript_id : NM_201370.1

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374436 GeneID:381760 MGI:1920040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_212468.3

name	Ssbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48374437 GeneID:381760 MGI:1920040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-stranded DNA binding protein 1 transcript_id : NM_028358.2

name	Tas2r137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480159 GeneID:574417 MGI:3606604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 137 transcript_id : NM_001025385.1

name	Tas2r108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048427 GeneID:57253 MGI:2681210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 2, member 108 transcript_id : NM_020502.1

name	1700016G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385811 GeneID:67690 MGI:1914940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700016G05 gene transcript_id : NM_026317.1

name	Olfr461 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129540 GeneID:258380 MGI:3030295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 461 transcript_id : NM_146382.1

name	Olfr460 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129534 GeneID:258381 MGI:3030294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 460 transcript_id : NM_146383.1

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370378 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_021364.2

name	Clec5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370375 GeneID:23845 MGI:1345151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 5, member a transcript_id : NM_001038604.1

name	Luc7l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373167 CCDS:CCDS20015.1 GeneID:192196 MGI:2183260
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : probably involved in pre-mRNA-splicing note : CGI-74-like SR-rich product : LUC7-like 2 protein_id : NP_619621.1

name	Klrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964698 CCDS:CCDS20016.1 GeneID:74253 MGI:1921503
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily G, member 2 protein_id : NP_001028343.2

name	LOC665180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255063 GeneID:665180
definition	codon_start : 1 product : similar to CD69-like protein protein_id : XP_980197.2

name	Hipk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754198 CCDS:CCDS20017.1 GeneID:15258 MGI:1314872
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0016605 - PML body [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence TAS] [Evidence ISS] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0046790 - virion binding [Evidence ISS] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0042771 - DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis [Evidence IGI]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IGI] [Evidence IDA] [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0046330 - positive regulation of JNK cascade [Evidence ISS]; GO:0030511 - positive regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007224 - smoothened signaling pathway [Evidence IGI]; GO:0006350 - transcription [Evidence IEA]; GO:0019048 - virus-host interaction [Evidence ISS] codon_start : 1 exception : mismatches in translation function : phosphorylates homeodomain transcription factors product : homeodomain interacting protein kinase 2 protein_id : NP_034563.1

name	Tbxas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750133 CCDS:CCDS20018.1 GeneID:21391 MGI:98497
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0004796 - thromboxane-A synthase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA] codon_start : 1 product : thromboxane A synthase 1, platelet protein_id : NP_035669.3

name	1700025N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377274 GeneID:69986 MGI:1917236
definition	codon_start : 1 product : hypothetical protein LOC69986 protein_id : XP_983471.1

name	Parp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370366 CCDS:CCDS20019.1 GeneID:243771 MGI:2143990
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 1 product : poly (ADP-ribose) polymerase family, member 12 protein_id : NP_766481.1

name	A630082K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701945 GeneID:338523 MGI:2443388
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC338523 protein_id : NP_001028602.1

name	Slc37a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71143150 CCDS:CCDS20020.1 GeneID:72144 MGI:1919394
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 37 (glycerol-3-phosphate transporter), member 3 protein_id : NP_082399.2

name	Rab19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859608 CCDS:CCDS20021.1 GeneID:19331 MGI:103292
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB19, member RAS oncogene family protein_id : NP_035356.1

name	Mkrn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055274 CCDS:CCDS20022.1 GeneID:54484 MGI:1859353
definition	GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : makorin, ring finger protein, 1 protein_id : NP_061280.1

name	ENSMUSG00000068601 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255065 GeneID:621427 MGI:3642504
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474125.1

name	Dennd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369652 CCDS:CCDS20023.1 GeneID:209773 MGI:2444961
definition	codon_start : 1 product : DENN/MADD domain containing 2A protein_id : NP_766065.1

name	Adck2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725855 CCDS:CCDS20024.1 GeneID:57869 MGI:1889336
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 2 protein_id : NP_849204.1

name	Ndufb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386096 CCDS:CCDS20025.1 GeneID:68198 MGI:1915448
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2 protein_id : NP_080888.1

name	Braf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199767 GeneID:109880 MGI:88190
definition	EC_number : 2.7.11.1 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : B-Raf proto-oncogene serine/threonine-protein kinase (p94) product : Braf transforming protein_id : NP_647455.2

name	Mrps33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859564 CCDS:CCDS20026.1 GeneID:14548 MGI:1338046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ganglioside-induced differentiation-associated-protein 3 product : mitochondrial ribosomal protein S33 isoform 1 protein_id : NP_034400.1

name	Mrps33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331153 GeneID:14548 MGI:1338046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ganglioside-induced differentiation-associated-protein 3 product : mitochondrial ribosomal protein S33 isoform 2 protein_id : NP_001010930.1

name	EG434008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921359 GeneID:434008 MGI:3647581
definition	codon_start : 1 product : hypothetical protein LOC434008 protein_id : NP_001004182.1

name	Agk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537518 CCDS:CCDS20027.1 GeneID:69923 MGI:1917173
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0001729 - ceramide kinase activity [Evidence IDA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0001727 - lipid kinase activity [Evidence IDA] GO_process : GO:0046834 - lipid phosphorylation [Evidence IDA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : multiple substrate lipid kinase product : multi-substrate lipid kinase protein_id : NP_076027.1

name	E330009J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425298 CCDS:CCDS20028.1 GeneID:243780 MGI:2444256
definition	codon_start : 1 product : hypothetical protein LOC243780 protein_id : NP_780737.1

name	BC052883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235773 CCDS:CCDS20029.1 GeneID:381759 MGI:3027899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC381759 protein_id : NP_958758.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059026 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : single-stranded DNA binding protein 1 isoform 1 protein_id : NP_997633.1

name	Ssbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058964 CCDS:CCDS20030.1 GeneID:381760 MGI:1920040
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : single-stranded DNA binding protein 1 isoform 2 protein_id : NP_082634.1

name	Tas2r137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480160 CCDS:CCDS20031.1 GeneID:574417 MGI:3606604
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence NAS] GO_process : GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence NAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor mt2r41; taste receptor T2R37 product : taste receptor, type 2, member 137 protein_id : NP_001020556.1

name	Tas2r108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048428 CCDS:CCDS20032.1 GeneID:57253 MGI:2681210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008527 - taste receptor activity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0001580 - detection of chemical stimulus during sensory perception of bitter taste [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0050909 - sensory perception of taste [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : taste receptor T2R8; candidate taste receptor T2R8 product : taste receptor, type 2, member 108 protein_id : NP_065248.1

name	1700016G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385812 CCDS:CCDS20033.1 GeneID:67690 MGI:1914940
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67690 protein_id : NP_080593.1

name	Olfr461 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129541 CCDS:CCDS20034.1 GeneID:258380 MGI:3030295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6973252-6974193; olfactory receptor MOR120-3 product : olfactory receptor 461 protein_id : NP_666494.1

name	Olfr460 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129535 CCDS:CCDS20035.1 GeneID:258381 MGI:3030294
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P3E9-6947292-6946348; olfactory receptor MOR120-2 product : olfactory receptor 460 protein_id : NP_666495.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946692 CCDS:CCDS20037.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 2 protein_id : NP_067339.1

name	Clec5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370376 CCDS:CCDS20036.1 GeneID:23845 MGI:1345151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; type II transmembrane protein MDL-1; myeloid DAP12-associating lectin-1; C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 product : C-type lectin domain family 5, member a isoform 1 protein_id : NP_001033693.1

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 3 pseudo : _no_value

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 2 pseudo : _no_value

name	LOC665247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665247
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:235414
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130992
definition	standard_name : D6Mit91

name	(CDS detail)
type	STS
link
xref	UniSTS:179363
definition	standard_name : AI414054

name	(CDS detail)
type	STS
link
xref	UniSTS:179361
definition	standard_name : AW122724

name	(CDS detail)
type	STS
link
xref	UniSTS:76007
definition	standard_name : GDB:4585413

name	(CDS detail)
type	STS
link
xref	UniSTS:116605
definition	standard_name : D6Mit80

name	(CDS detail)
type	STS
link
xref	UniSTS:123860
definition	standard_name : 29.MMHAP37FRB11.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:125130
definition	standard_name : MHAa30g3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130770
definition	standard_name : D6Mit222

name	(CDS detail)
type	STS
link
xref	UniSTS:116604
definition	standard_name : D6Mit90

name	(CDS detail)
type	STS
link
xref	UniSTS:144551
definition	standard_name : Tbxas1

name	(CDS detail)
type	STS
link
xref	UniSTS:235418
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179362
definition	standard_name : L18868

name	(CDS detail)
type	STS
link
xref	UniSTS:124878
definition	standard_name : L18868

name	(CDS detail)
type	STS
link
xref	UniSTS:162580
definition	standard_name : RH125836

name	(CDS detail)
type	STS
link
xref	UniSTS:142577
definition	standard_name : D6Bwg16e

name	(CDS detail)
type	STS
link
xref	UniSTS:161108
definition	standard_name : RH124286

name	(CDS detail)
type	STS
link
xref	UniSTS:235426
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:185661
definition	standard_name : BB041802

name	(CDS detail)
type	STS
link
xref	UniSTS:179364
definition	standard_name : AU044904

name	(CDS detail)
type	STS
link
xref	UniSTS:130980
definition	standard_name : D6Mit78

name	(CDS detail)
type	STS
link
xref	UniSTS:129448
definition	standard_name : D2Mit529

name	(CDS detail)
type	STS
link
xref	UniSTS:142654
definition	standard_name : D6Wsu1e

name	(CDS detail)
type	STS
link
xref	UniSTS:165012
definition	standard_name : Mkrn1

name	(CDS detail)
type	STS
link
xref	UniSTS:235424
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130717
definition	standard_name : D6Mit173

name	(CDS detail)
type	STS
link
xref	UniSTS:161491
definition	standard_name : RH124669

name	(CDS detail)
type	STS
link
xref	UniSTS:185663
definition	standard_name : BB006057

name	(CDS detail)
type	STS
link
xref	UniSTS:167497
definition	standard_name : AU015031

name	(CDS detail)
type	STS
link
xref	UniSTS:219348
definition	standard_name : RH137260

name	(CDS detail)
type	STS
link
xref	UniSTS:159496
definition	standard_name : AI447469

name	(CDS detail)
type	STS
link
xref	UniSTS:235421
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235419
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235425
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235420
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:141185
definition	standard_name : Braf

name	(CDS detail)
type	STS
link
xref	UniSTS:130698
definition	standard_name : D6Mit153

name	(CDS detail)
type	STS
link
xref	UniSTS:185664
definition	standard_name : C87398

name	(CDS detail)
type	STS
link
xref	UniSTS:235427
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165462
definition	standard_name : AI841153

name	(CDS detail)
type	STS
link
xref	UniSTS:141948
definition	standard_name : D13Sfk14

name	(CDS detail)
type	STS
link
xref	UniSTS:130705
definition	standard_name : D6Mit161.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130704
definition	standard_name : D6Mit161

name	(CDS detail)
type	STS
link
xref	UniSTS:130786
definition	standard_name : D6Mit239

name	(CDS detail)
type	STS
link
xref	UniSTS:130706
definition	standard_name : D6Mit161.2

name	(CDS detail)
type	STS
link
xref	UniSTS:224210
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207943
definition	standard_name : BB283466

name	(CDS detail)
type	STS
link
xref	UniSTS:151126
definition	standard_name : D7S2119E

name	(CDS detail)
type	STS
link
xref	UniSTS:235423
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159493
definition	standard_name : AI465370

name	(CDS detail)
type	STS
link
xref	UniSTS:220154
definition	standard_name : RH138067

name	(CDS detail)
type	STS
link
xref	UniSTS:164322
definition	standard_name : AI841796

name	(CDS detail)
type	STS
link
xref	UniSTS:235428
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207942
definition	standard_name : AU023319

name	(CDS detail)
type	STS
link
xref	UniSTS:494930
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:485084
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492662
definition

name	4930599N23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94377277 GeneID:75379 MGI:1922629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 4930599N23 gene transcript_id : XR_002348.1

name	LOC665254 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255068 GeneID:665254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to Aldolase 1, A pseudo : _no_value transcript_id : XR_031611.1

name	LOC669661 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255057 GeneID:669661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_031169.1

clone name	MSMg01-423P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099A12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-509D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342N22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286E15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-306K18.T7 (MSMg01no306_k18.b1)	MSMg01-306K18.TJ (MSMg01no306_k18.g1)
ACC	AG431266	AG431267
length	754	755
length of high quality (start - end)	359 (389 - 747)	287 (77 - 363)
definition	CHROMAT_FILE: MSMg01no306_k18.b1 PHD_FILE: MSMg01no306_k18.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:47:32 2005	CHROMAT_FILE: MSMg01no306_k18.g1 PHD_FILE: MSMg01no306_k18.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:47:32 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXC GCGGAATTCCCACGGATCTGAAGAGGAAGATTGCACAGCTGGGGATCAAC ATGCTTTTGAAGATGGTGAGCATTGCGCCTGCCTGGGTGCCACAGCTCGG TACATGGCCAGATTGCATAAGGGAAAGTGTCTAGCTCTATCTGGTTCCTG AGGCTCAGTACACAGGTGGAGTGTTTAAGGGAAAGAGCAAAGGTTTCTGC TGGGCACCAGCTGCATGGGCCAGCCAAGCAGAGAGCTGCAGGGTGAGAAC ATCAGCTGAGTGGAGCCCCTCCCCAGATGCTTCTGTGACCCAGCTTGTGC TGAGTCCTTGCTCTGTGATGTGTTTTCTGTGCGCTGTGGAAGAGCGGCAA GCACACTGTTTAGACCACGGTGCTGCATGTTAGATACTGTTTTAGTCATT TTTCCAGCGCTATGGAGTGCCTGCTGTATGCTAAGTGCTGAATTAAGAGT TAGACAGACCTGACGCCAGGGTTCCCTGGGTAAGCTAGTGGGGGAGAAGC ACATGGCATGAAGGGCCAGCGCCAGAAGATTAGCTGGGAGGGGCCTTGTT TGGACCCATGGTGAGACACATGGTGGGACTTATCTAGAGACAAAGCCTGT GCCAAGGGTGTGATGCAGTGGGAGATGTGAAGGTGTATTGTGCAGAGTGT TCCAGGACTCAGGACTTTAATCTGTGGGCAAGGGGCTCATTTGAGTTCTC TTTN	CGATGACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTCACCTGAGGAATACCGAATGGCA GAGAAGCACCTGAAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGC AAATCAAAACAACCCTGAGATTCCACCTCACACCAGTTAGAATGGCTAAG ATTAAAAATTCAGGTGACAGCAGATGCTGGCGAGGATGTGGAGAAAGAGG AACACTCCTCCATTGTTGGTGGGATTGCAAGCTTGTACAACCACTCTGGA AATCAGTCTGGTGGTTCCTCAGAAAATTGGACATAGTACTACCGGAGGAT CCCGCAATACCTCTTTTGTTTTTATCCCCCCCACCATGTCCCAACCGGTA AGAAGGACACATGCTCCACTATGTTCATAGAAAACATTATTTACAATAGC CGGAAGCTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGA AAACGTGGTACATTTACACAATGGAGTACTACTCAGCTATTAAAAAGAAT GAATTTATGAAATTCCAAGGCAAATGGATGGACCTGGAAGGCATCATCCT GAGTGAGGTAACCCAATCACAAAGGAACTCACACAATATGTACTCACTGA TAAGTGGATATTAGCCCAGAAACTTAGGATACCCAGCAGGCTTACCTTGA CTGAGCTAACTTACATCCTCAGATTTTGTTGTGTTCTTCTCTGACTAAAC TAGAG
quality values	Open. Hide. 0 3 6 6 6 6 8 6 13 13 12 15 23 34 34 33 32 30 28 28 37 23 19 9 9 9 21 21 41 28 28 28 28 28 36 37 39 28 28 22 23 23 33 43 29 29 22 24 26 42 41 57 57 47 47 42 42 50 50 50 50 47 42 42 32 32 22 22 28 28 18 15 28 41 48 48 54 50 50 41 50 50 50 50 68 68 68 68 68 68 68 68 47 47 40 47 42 47 53 53 47 47 47 57 57 57 59 59 59 59 53 53 47 41 41 37 50 34 25 21 13 9 9 9 9 9 10 14 19 23 20 34 30 47 39 39 43 48 48 48 57 57 53 53 53 53 57 57 59 57 57 57 57 57 53 53 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 57 57 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 44 44 41 37 43 43 59 59 59 59 57 68 68 68 68 68 68 68 57 59 59 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 41 41 28 18 19 15 15 12 12 11 12 12 27 20 19 12 12 12 13 13 19 19 12 12 12 15 19 30 34 57 57 57 57 57 59 59 59 59 59 59 59 59 57 57 57 57 68 68 68 57 57 57 57 68 54 54 68 68 68 68 68 68 68 59 59 54 37 41 19 19 17 30 29 37 42 32 41 42 44 44 57 57 57 59 59 57 59 59 59 57 57 54 54 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 54 57 57 57 57 68 68 68 68 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 48 48 48 57 57 57 57 57 54 57 57 57 57 48 48 48 59 59 57 57 57 57 43 33 25 30 30 30 30 48 48 48 41 41 41 41 41 41 41 37 37 41 59 47 47 47 47 41 39 36 39 39 41 41 39 34 36 43 43 37 37 37 37 37 41 41 30 20 22 28 28 29 37 42 41 41 48 48 48 43 43 57 57 39 39 39 36 36 39 43 39 39 39 43 43 59 57 57 48 48 48 57 39 39 35 37 37 43 39 39 34 32 23 23 32 30 31 37 30 30 24 37 30 37 37 37 37 31 31 41 41 41 41 41 47 41 48 37 37 33 32 36 23 23 22 22 22 31 28 28 19 19 23 29 25 29 19 18 18 32 28 36 37 37 37 37 36 37 37 32 26 21 15 15 22 18 22 34 29 29 32 37 37 37 41 41 41 43 19 15 8 8 8 15 15 17 9 8 3 0	Open. Hide. 8 8 8 13 14 9 11 9 11 18 21 34 37 37 32 30 30 44 39 39 47 47 47 47 48 48 50 50 57 50 53 48 48 43 43 43 43 43 33 32 32 32 37 42 48 39 39 42 48 42 42 42 42 47 47 54 54 54 54 54 57 48 48 41 41 43 50 57 57 57 50 50 50 50 50 50 50 50 50 50 50 57 57 57 57 41 50 47 47 48 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 57 50 50 47 46 46 40 32 20 20 22 43 43 57 59 59 57 57 57 57 57 57 57 57 57 57 57 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 68 68 68 68 68 59 59 59 62 62 62 57 57 57 57 57 59 57 57 57 57 57 57 59 57 57 57 57 57 57 59 59 57 57 57 57 57 68 57 59 52 52 52 57 57 57 59 59 59 57 57 57 57 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 57 57 57 57 57 57 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 68 59 59 59 59 57 57 57 68 68 68 57 59 59 57 57 57 57 57 57 57 68 68 57 57 57 57 57 48 57 57 47 47 54 59 59 59 59 59 59 59 47 42 30 32 26 37 39 42 36 43 43 47 59 59 68 68 59 59 59 59 59 59 57 50 53 50 53 53 50 50 50 50 59 59 59 59 59 59 59 32 34 21 25 12 12 8 8 8 8 8 8 19 11 10 10 10 10 10 14 21 21 12 12 12 12 11 11 11 15 24 31 41 59 59 48 59 48 48 57 57 48 48 48 59 57 57 57 57 57 57 59 57 57 59 53 53 53 57 57 53 59 59 59 50 41 41 30 26 14 9 9 8 10 8 8 10 10 9 11 24 21 24 26 32 34 43 36 34 24 22 15 15 14 23 23 28 30 30 39 59 59 68 68 57 57 54 54 48 48 48 48 59 59 59 59 57 57 57 57 57 48 57 68 68 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 59 59 57 57 57 59 59 59 47 47 54 59 57 57 57 57 57 57 54 57 57 59 59 59 59 59 59 59 57 57 57 57 50 54 54 54 57 57 59 59 68 68 68 68 57 57 57 57 57 57 57 57 57 48 48 48 57 57 57 59 57 47 47 47 41 41 39 59 47 47 41 43 41 41 41 44 59 44 47 42 42 40 48 48 48 48 50 48 57 48 48 57 59 48 48 59 59 59 59 57 48 48 48 59 59 57 48 48 57 57 57 57 54 54 54 54 54 57 57 57 57 59 57 57 48 44 37 35 35 37 44 57 57 57 57 59 59 48 48 48 48 48 48 48 48 48 48 48 48 48 57 43 43 43 43 43 48 48 43 40 30 30 30 43 37 39 39 43 43 57 59 59 57 48 34 34 31 31 40 47 47 41 47 47 43 41 37 41 39 39 39 39 37 37 43 39 39 39 40 37 37 35 32 36 37 39 39 47 57 43 43 37 37 35 39 37 33 28 25 25 17 24 24 34 31 19 16 16 12 12 16 30 30 28 32 39 35 35 39 47 47 30 30 30 20 20 21 19 21 14 15 15 14

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no306_k18.b1 MSMg01no306_k18.b1 CHROMAT_FILE:
MSMg01no306_k18.b1 PHD_FILE: MSMg01no306_k18.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:47:32 2005
         (359 letters)



>mm_chr6_39531164_39531923
          Length = 760

 Score =  665 bits (344), Expect = 0.0
 Identities = 356/360 (98%), Gaps = 1/360 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   gaagagcggcaagcacactgtttagaccacggtgctgcatgttagatactgttttagtca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 gaagagcggcaagcacactgtttagaccacggtgctgcatgttagatactgttttagtca 260

                                                                       
Query: 61  tttttccagcgctatggagtgcctgctgtatgctaagtgctgaattaagagttagacaga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tttttccagcgctatggagtgcctgctgtatgctaagtgctgaattaagagttagacaga 320

                                                                       
Query: 121 cctgacgccagggttccctgggtaagctagtgggggagaagcacatggcatgaagggcca 180
           ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 321 cctgacgccagggttccctgggtaagctactggggaagaagcacatggcatgaagggcca 380

                                                                       
Query: 181 gcgccagaagattagctgggaggggccttgtttggacccatggtgagacacatggtggga 240
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 381 gcgccagaagattagctgggaggggccttgtttggacccattgtgagacacatggtggga 440

                                                                       
Query: 241 cttatctagagacaa-agcctgtgccaagggtgtgatgcagtgggagatgtgaaggtgta 299
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 cttatctagagacaacagcctgtgccaagggtgtgatgcagtgggagatgtgaaggtgta 500

                                                                       
Query: 300 ttgtgcagagtgttccaggactcaggactttaatctgtgggcaaggggctcatttgagtt 359
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 ttgtgcagagtgttccaggactcaggactttaatctgtgggcaaggggctcatttgagtt 560


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 17
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 359
Length of database: 760
Length adjustment: 9
Effective length of query: 350
Effective length of database: 751
Effective search space:   262850
Effective search space used:   262850
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information