MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-344O18
Chromosome	6 (Build37)
Map Location	86,130,710 - 86,131,129
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Emx1, Sfxn5, Rab11fip5, Noto, Smyd5, 1700040I03Rik, Cct7, Fbxo41, Egr4, Alms1, LOC100043497, EG665134, LOC100043493, Cml3, LOC623273, Cml5, Cml4, LOC100043504, LOC100043508, Cml2, LOC665177, 1700019G17Rik, Cml1, Tprkb, EG434057, LOC665213, Dusp11, Figla, Add2
Downstream gene	Tgfa, LOC665233, LOC100043094, LOC100043527, 2010309E21Rik, Snrpg, Pcyox1, Tia1, C87436, 2310040G24Rik, Pcbp1, Asprv1, Mxd1, 2610209M04Rik, Gmcl1, Anxa4, 2610306M01Rik, Aak1, LOC100043555, Nfu1, Gfpt1, D6Ertd527e, Antxr1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Emx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94282 MGI:2137681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11fip5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52055 MGI:1098586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Noto (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384452 MGI:3053002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232187 MGI:108048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700040I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12468 MGI:107184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alms1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236266 MGI:1934606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 11 ESTs, 16 Proteins

name	EG665134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein

name	LOC100043493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein

name	Cml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93674 MGI:2136449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC623273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	Cml5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69049 MGI:1916299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68396 MGI:1915646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100043508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins

name	Cml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700019G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75541 MGI:1922791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66116 MGI:1913366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tprkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69786 MGI:1917036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins

name	LOC665213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dusp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72102 MGI:1919352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Figla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26910 MGI:1349421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Add2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11519 MGI:87919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins pseudo : _no_value

name	LOC100043094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins

name	2010309E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66488 MGI:1913738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66881 MGI:1914131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21841 MGI:107914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C87436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232196 MGI:2141787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040G24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs

name	Pcbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23983 MGI:1345635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asprv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67855 MGI:1915105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17119 MGI:96908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610209M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23885 MGI:1345156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11746 MGI:88030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610306M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs

name	Aak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269774 MGI:1098687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins

name	Nfu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Ertd527e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs

name	Antxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69538 MGI:1916788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832022 GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : empty spiracles homolog 1 (Drosophila) transcript_id : NM_010131.1

name	Sfxn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802372 GeneID:94282 MGI:2137681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 5 transcript_id : NM_178639.3

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743142 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_177466.4

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743141 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_001003955.2

name	Noto (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372169 GeneID:384452 MGI:3053002
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : notochord homolog (Xenopus laevis) transcript_id : NM_001007472.1

name	Smyd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450314 GeneID:232187 MGI:108048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 5 transcript_id : NM_144918.1

name	1700040I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606406 GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700040I03 gene transcript_id : NM_028505.1

name	Cct7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802764 GeneID:12468 MGI:107184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 7 (eta) transcript_id : NM_007638.3

name	Fbxo41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625733 GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 41 transcript_id : NM_001001160.2

name	Egr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130510 GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 4 transcript_id : NM_020596.2

name	Alms1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644592 GeneID:236266 MGI:1934606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Alstrom syndrome 1 homolog (human) transcript_id : NM_145223.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255302 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 2 transcript_id : XM_001480038.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255300 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 1 transcript_id : XM_001480031.1

name	EG665134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255224 GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : predicted gene, EG665134 transcript_id : XM_974788.2

name	LOC100043493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255296 GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : similar to mKIAA0328 protein transcript_id : XM_001480026.1

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365388 GeneID:93674 MGI:2136449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_001037842.2

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716390 GeneID:93674 MGI:2136449
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_053097.1

name	LOC623273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255225 GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : similar to Almstrom syndrome 1 protein transcript_id : XM_887722.3

name	Cml5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956197 GeneID:69049 MGI:1916299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 5 transcript_id : NM_023493.1

name	Cml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980866 GeneID:68396 MGI:1915646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 4 transcript_id : NM_023455.2

name	LOC100043504 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255308 GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100043504 transcript_id : XM_001480063.1

name	LOC100043508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255312 GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins product : similar to Sid3177p transcript_id : XM_001480069.1

name	Cml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865962 GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 2 transcript_id : NM_053096.3

name	1700019G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254166 GeneID:75541 MGI:1922791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019G17 gene transcript_id : NM_029331.2

name	Cml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963542 GeneID:66116 MGI:1913366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 1 transcript_id : NM_023160.1

name	Tprkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341154 GeneID:69786 MGI:1917036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tp53rk binding protein transcript_id : NM_176842.2

name	EG434057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377979 GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins product : predicted gene, EG434057 transcript_id : XM_485799.3

name	Dusp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519172 GeneID:72102 MGI:1919352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) transcript_id : NM_028099.2

name	Figla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753875 GeneID:26910 MGI:1349421
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folliculogenesis specific basic helix-loop-helix transcript_id : NM_012013.1

name	Add2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349159 GeneID:11519 MGI:87919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adducin 2 (beta) transcript_id : NM_013458.3

name	Tgfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130077 GeneID:21802 MGI:98724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor alpha transcript_id : NM_031199.2

name	LOC100043094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255227 GeneID:100043094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043094 transcript_id : XM_001479475.1

name	LOC100043527 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255323 GeneID:100043527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 500 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_001480106.1

name	2010309E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981258 GeneID:66488 MGI:1913738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010309E21 gene transcript_id : NM_025591.2

name	Snrpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378958 GeneID:68011 MGI:1915261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide G transcript_id : NM_026506.2

name	Pcyox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981175 GeneID:66881 MGI:1914131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenylcysteine oxidase 1 transcript_id : NM_025823.3

name	Tia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750236 GeneID:21841 MGI:107914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytotoxic granule-associated RNA binding protein 1 transcript_id : NM_011585.3

name	C87436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384996 GeneID:232196 MGI:2141787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C87436 transcript_id : NM_146170.3

name	2310040G24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255327 GeneID:381792 MGI:1916897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs product : RIKEN cDNA 2310040G24 gene transcript_id : XM_001480154.1

name	Pcbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271536 GeneID:23983 MGI:1345635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 1 transcript_id : NM_011865.3

name	Asprv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502129 GeneID:67855 MGI:1915105
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartic peptidase, retroviral-like 1 transcript_id : NM_026414.2

name	Mxd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370244 GeneID:17119 MGI:96908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX dimerization protein 1 transcript_id : NM_010751.2

name	2610209M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802219 GeneID:66618 MGI:1913868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610209M04 gene transcript_id : NM_025665.2

name	Gmcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981389 GeneID:23885 MGI:1345156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-less homolog 1 (Drosophila) transcript_id : NM_011818.2

name	Anxa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304888 GeneID:11746 MGI:88030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A4 transcript_id : NM_013471.1

name	2610306M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255229 GeneID:67170 MGI:1914420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 25 ESTs product : RIKEN cDNA 2610306M01 gene transcript_id : XM_001479511.1

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046263 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_001040106.2

name	Aak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046243 GeneID:269774 MGI:1098687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AP2 associated kinase 1 transcript_id : NM_177762.6

name	LOC100043555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255329 GeneID:100043555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 162 ESTs, 2 Proteins product : similar to Aak1 protein transcript_id : XM_001480194.1

name	Nfu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130523 GeneID:56748 MGI:1913290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) transcript_id : NM_020045.2

name	Gfpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980779 GeneID:14583 MGI:95698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 1 transcript_id : NM_013528.2

name	D6Ertd527e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377982 GeneID:52372 MGI:1261919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 181 ESTs product : DNA segment, Chr 6, ERATO Doi 527, expressed transcript_id : XM_489144.3

name	Antxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971258 GeneID:69538 MGI:1916788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anthrax toxin receptor 1 transcript_id : NM_054041.2

name	Emx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832023 CCDS:CCDS20290.1 GeneID:13796 MGI:95387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : empty spiracles homolog 1 protein_id : NP_034261.1

name	Sfxn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519995 CCDS:CCDS20291.1 GeneID:94282 MGI:2137681
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 5 protein_id : NP_848754.1

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55743143 CCDS:CCDS20292.1 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : RAB11 family interacting protein 5 (class I) isoform 2 protein_id : NP_803417.3

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421788 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : RAB11 family interacting protein 5 (class I) isoform 1 protein_id : NP_001003955.1

name	Noto (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372170 CCDS:CCDS20293.1 GeneID:384452 MGI:3053002
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030903 - notochord development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Not homeodomain protein; floating head homolog product : notochord protein_id : NP_001007473.1

name	Smyd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450315 GeneID:232187 MGI:108048
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : retinoic acid responsive gene 1; retinoic acid induced 15 product : SET and MYND domain containing 5 protein_id : NP_659167.1

name	1700040I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606407 GeneID:73327 MGI:1920577
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73327 protein_id : NP_082781.1

name	Cct7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982472 CCDS:CCDS20295.1 GeneID:12468 MGI:107184
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chaperonin containing t-complex subunit eta product : chaperonin subunit 7 (eta) protein_id : NP_031664.2

name	Fbxo41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564092 CCDS:CCDS20296.1 GeneID:330369 MGI:1261912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 41 protein_id : NP_001001160.1

name	Egr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181102 CCDS:CCDS20297.1 GeneID:13656 MGI:99252
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : early growth response 4 protein_id : NP_065621.1

name	Alms1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644593 CCDS:CCDS20298.1 GeneID:236266 MGI:1934606
definition	GO_component : GO:0005813 - centrosome [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001678 - cell glucose homeostasis [Evidence ISS]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0045598 - regulation of fat cell differentiation [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : mismatches in translation product : Alstrom syndrome 1 protein_id : NP_660258.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255301 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480081.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255303 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480088.1

name	EG665134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377971 GeneID:665134 MGI:3646394
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_979882.1

name	LOC100043493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255297 GeneID:100043493
definition	codon_start : 1 product : similar to mKIAA0328 protein protein_id : XP_001480076.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745106 CCDS:CCDS20299.1 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : camello-like 3 isoform 1 protein_id : NP_001032931.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716391 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2 product : camello-like 3 isoform 2 protein_id : NP_444327.1

name	LOC623273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255226 GeneID:623273
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_892815.2

name	Cml5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956198 CCDS:CCDS20300.1 GeneID:69049 MGI:1916299
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation product : camello-like 5 protein_id : NP_075982.1

name	Cml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963681 CCDS:CCDS20301.1 GeneID:68396 MGI:1915646
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005715 - late recombination nodule [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 4 protein_id : NP_075944.1

name	LOC100043504 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255309 GeneID:100043504
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480113.1

name	LOC100043508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255313 GeneID:100043508
definition	codon_start : 1 product : similar to Sid3177p protein_id : XP_001480119.1

name	Cml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542409 CCDS:CCDS20302.1 GeneID:93673 MGI:2136446
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : camello-like 2 protein_id : NP_444326.2

name	1700019G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254167 GeneID:75541 MGI:1922791
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75541 protein_id : NP_083607.2

name	Cml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963543 CCDS:CCDS20304.1 GeneID:66116 MGI:1913366
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 1 protein_id : NP_075649.1

name	Tprkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849893 CCDS:CCDS20305.1 GeneID:69786 MGI:1917036
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Prpk (p53-related protein kinase)-binding protein protein_id : NP_789812.1

name	EG434057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029409 GeneID:434057 MGI:3644831
definition	codon_start : 1 product : similar to Camello-like 1 protein_id : XP_485799.3

name	Dusp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519173 CCDS:CCDS20306.1 GeneID:72102 MGI:1919352
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) protein_id : NP_082375.2

name	Figla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753876 CCDS:CCDS20307.1 GeneID:26910 MGI:1349421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : involved in coordinate expression of the zona pellucida genes note : FIG alpha product : factor in the germline alpha protein_id : NP_036143.1

name	Add2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560504 CCDS:CCDS20308.1 GeneID:11519 MGI:87919
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IDA] GO_process : GO:0030097 - hemopoiesis [Evidence IMP] codon_start : 1 note : snoRNA MBII-396 product : adducin 2 (beta) protein_id : NP_038486.2

name	Tgfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654266 GeneID:21802 MGI:98724
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001948 - glycoprotein binding [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : waved 1; transforming growth factor-alpha product : transforming growth factor alpha protein_id : NP_112476.1

name	LOC100043094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255228 GeneID:100043094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479525.1

name	LOC100043527 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255324 GeneID:100043527
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_001480156.1

name	2010309E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385042 CCDS:CCDS20309.1 GeneID:66488 MGI:1913738
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : hypothetical protein LOC66488 protein_id : NP_079867.1

name	Snrpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385994 GeneID:68011 MGI:1915261
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0030532 - small nuclear ribonucleoprotein complex [Evidence ISS]; GO:0005681 - spliceosome complex [Evidence ISS] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0008380 - RNA splicing [Evidence ISS]; GO:0000245 - spliceosome assembly [Evidence ISS] codon_start : 1 product : small nuclear ribonucleoprotein polypeptide G protein_id : NP_080782.1

name	Pcyox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385294 CCDS:CCDS20311.1 GeneID:66881 MGI:1914131
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0001735 - prenylcysteine oxidase activity [Evidence IMP] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030328 - prenylcysteine catabolism [Evidence IMP] codon_start : 1 note : prenylcysteine lyase product : prenylcysteine oxidase 1 protein_id : NP_080099.1

name	Tia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755783 CCDS:CCDS20312.1 GeneID:21841 MGI:107914
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0017091 - AU-specific RNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042036 - negative regulation of cytokine biosynthesis [Evidence IMP]; GO:0016478 - negative regulation of translation [Evidence IMP] codon_start : 1 note : cytotoxic granule-associated RNA-binding protein 1 product : cytotoxic granule-associated RNA binding protein 1 protein_id : NP_035715.1

name	C87436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30911109 CCDS:CCDS20313.1 GeneID:232196 MGI:2141787
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC232196 protein_id : NP_666282.2

name	2310040G24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255328 GeneID:381792 MGI:1916897
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480204.1

name	Pcbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754994 CCDS:CCDS20314.1 GeneID:23983 MGI:1345635
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008494 - translation activator activity [Evidence TAS] GO_process : GO:0006397 - mRNA processing [Evidence TAS] codon_start : 1 note : poly(rC)-binding protein 1; hnRNP E1 product : poly(rC) binding protein 1 protein_id : NP_035995.1

name	Asprv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502130 GeneID:67855 MGI:1915105
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : TPA-induced aspartic proteinase-like; skin-specific retroviral-like aspartic protease product : skin aspartic protease protein_id : NP_080690.2

name	Mxd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754604 GeneID:17119 MGI:96908
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Max dimerization protein protein_id : NP_034881.1

name	2610209M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228990 CCDS:CCDS20315.1 GeneID:66618 MGI:1913868
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : putative nucleic acid binding protein RY-1 protein_id : NP_079941.1

name	Gmcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981390 CCDS:CCDS20316.1 GeneID:23885 MGI:1345156
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence TAS] codon_start : 1 exception : mismatches in translation product : germ cell-less protein_id : NP_035948.2

name	Anxa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304889 GeneID:11746 MGI:88030
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] GO_process : GO:0001822 - kidney development [Evidence ISS] codon_start : 1 exception : mismatches in translation note : annexin IV product : annexin A4 protein_id : NP_038499.1

name	2610306M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255230 GeneID:67170 MGI:1914420
definition	codon_start : 1 product : hypothetical protein LOC67170 protein_id : XP_001479561.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91992157 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : AP2 associated kinase 1 isoform 1 protein_id : NP_001035195.1

name	Aak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73695877 CCDS:CCDS20317.1 GeneID:269774 MGI:1098687
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : AP2 associated kinase 1 isoform 2 protein_id : NP_808430.2

name	LOC100043555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255330 GeneID:100043555
definition	codon_start : 1 product : similar to Aak1 protein protein_id : XP_001480244.1

name	Nfu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910264 GeneID:56748 MGI:1913290
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : HIRA-interacting protein 5 product : histone cell cycle regulation defective interacting protein 5 protein_id : NP_064429.1

name	Gfpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305085 GeneID:14583 MGI:95698
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutamine:fructose-6-phosphate amidotransferase 1 product : glutamine fructose-6-phosphate transaminase 1 protein_id : NP_038556.1

name	D6Ertd527e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029415 GeneID:52372 MGI:1261919
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489144.2

name	Antxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189436 CCDS:CCDS20318.1 GeneID:69538 MGI:1916788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : tumor endothelial marker 8 product : anthrax toxin receptor 1 protein_id : NP_473382.1

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 1 pseudo : _no_value

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 2 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 1 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:226151
definition	standard_name : Emx1

name	(CDS detail)
type	STS
link
xref	UniSTS:222856
definition	standard_name : RH140790

name	(CDS detail)
type	STS
link
xref	UniSTS:130944
definition	standard_name : D6Mit391

name	(CDS detail)
type	STS
link
xref	UniSTS:130961
definition	standard_name : D6Mit6

name	(CDS detail)
type	STS
link
xref	UniSTS:118840
definition	standard_name : D4Rat47

name	(CDS detail)
type	STS
link
xref	UniSTS:16102
definition	standard_name : RH70059

name	(CDS detail)
type	STS
link
xref	UniSTS:162737
definition	standard_name : RH126025

name	(CDS detail)
type	STS
link
xref	UniSTS:159526
definition	standard_name : C75969

name	(CDS detail)
type	STS
link
xref	UniSTS:167495
definition	standard_name : AU022460

name	(CDS detail)
type	STS
link
xref	UniSTS:179407
definition	standard_name : AW536703

name	(CDS detail)
type	STS
link
xref	UniSTS:207986
definition	standard_name : RH127111

name	(CDS detail)
type	STS
link
xref	UniSTS:235479
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162345
definition	standard_name : RH125529

name	(CDS detail)
type	STS
link
xref	UniSTS:235482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161545
definition	standard_name : RH124723

name	(CDS detail)
type	STS
link
xref	UniSTS:119814
definition	standard_name : RH94566

name	(CDS detail)
type	STS
link
xref	UniSTS:235483
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:211133
definition	standard_name : RH127823

name	(CDS detail)
type	STS
link
xref	UniSTS:207987
definition	standard_name : AI173933

name	(CDS detail)
type	STS
link
xref	UniSTS:159527
definition	standard_name : AI266962

name	(CDS detail)
type	STS
link
xref	UniSTS:217253
definition	standard_name : RH133971

name	(CDS detail)
type	STS
link
xref	UniSTS:159528
definition	standard_name : AI481497

name	(CDS detail)
type	STS
link
xref	UniSTS:235481
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:225860
definition	standard_name : G65193

name	(CDS detail)
type	STS
link
xref	UniSTS:460101
definition	standard_name : stSG633446

name	(CDS detail)
type	STS
link
xref	UniSTS:144608
definition	standard_name : Tgfa

name	(CDS detail)
type	STS
link
xref	UniSTS:159533
definition	standard_name : AI448340

name	(CDS detail)
type	STS
link
xref	UniSTS:210059
definition	standard_name : RH136064

name	(CDS detail)
type	STS
link
xref	UniSTS:221980
definition	standard_name : RH139896

name	(CDS detail)
type	STS
link
xref	UniSTS:159535
definition	standard_name : C87436

name	(CDS detail)
type	STS
link
xref	UniSTS:162100
definition	standard_name : RH125278

name	(CDS detail)
type	STS
link
xref	UniSTS:266025
definition	standard_name : PCBP1

name	(CDS detail)
type	STS
link
xref	UniSTS:22959
definition	standard_name : A006T05

name	(CDS detail)
type	STS
link
xref	UniSTS:491475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165474
definition	standard_name : AA986851

name	(CDS detail)
type	STS
link
xref	UniSTS:165476
definition	standard_name : AW122478

name	(CDS detail)
type	STS
link
xref	UniSTS:125870
definition	standard_name : X83106

name	(CDS detail)
type	STS
link
xref	UniSTS:207989
definition	standard_name : AU022368

name	(CDS detail)
type	STS
link
xref	UniSTS:159529
definition	standard_name : AI449063

name	(CDS detail)
type	STS
link
xref	UniSTS:212122
definition	standard_name : RH128814

name	(CDS detail)
type	STS
link
xref	UniSTS:164687
definition	standard_name : Gcl

name	(CDS detail)
type	STS
link
xref	UniSTS:235484
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207990
definition	standard_name : BB540852

name	(CDS detail)
type	STS
link
xref	UniSTS:159539
definition	standard_name : AI265406

name	(CDS detail)
type	STS
link
xref	UniSTS:179409
definition	standard_name : AW106930

name	(CDS detail)
type	STS
link
xref	UniSTS:130837
definition	standard_name : D6Mit29

name	(CDS detail)
type	STS
link
xref	UniSTS:130877
definition	standard_name : D6Mit323

name	(CDS detail)
type	STS
link
xref	UniSTS:215646
definition	standard_name : RH132363

name	(CDS detail)
type	STS
link
xref	UniSTS:179408
definition	standard_name : AU067724

name	(CDS detail)
type	STS
link
xref	UniSTS:164330
definition	standard_name : AU067726

name	(CDS detail)
type	STS
link
xref	UniSTS:207988
definition	standard_name : RH126710

name	(CDS detail)
type	STS
link
xref	UniSTS:167472
definition	standard_name : RH126656

name	(CDS detail)
type	STS
link
xref	UniSTS:162071
definition	standard_name : RH125249

name	(CDS detail)
type	STS
link
xref	UniSTS:165475
definition	standard_name : AI324119

name	(CDS detail)
type	STS
link
xref	UniSTS:159538
definition	standard_name : AI449986

name	(CDS detail)
type	STS
link
xref	UniSTS:167494
definition	standard_name : D6Ertd527e

name	(CDS detail)
type	STS
link
xref	UniSTS:159534
definition	standard_name : AU043841

name	(CDS detail)
type	STS
link
xref	UniSTS:235487
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235488
definition

name	LOC665233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255319 GeneID:665233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 17 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034541.1

clone name	MSMg01-383M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-478M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-318N07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-207D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063P07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447A22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-485N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-344O18.T7 (MSMg01no344_o18.b1)	MSMg01-344O18.TJ (MSMg01no344_o18.g1)
ACC	AG457868	AG457869
length	812	763
length of high quality (start - end)	271 (42 - 312)	397 (70 - 466)
definition	CHROMAT_FILE: MSMg01no344_o18.b1 PHD_FILE: MSMg01no344_o18.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:35:15 2005	CHROMAT_FILE: MSMg01no344_o18.g1 PHD_FILE: MSMg01no344_o18.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:35:16 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATT CTCTTGGGTCGCGAACACTGGCCAAGTCCTCTCTCCAGTGTTTCCTCACA CTAGGGATCCATCCCCTGAGCCTCCCCTCTCCTCTGACTATGCTGTCAAC TTGACACAACCTAGACTCATCAGAAACTAGAGTCTCAATTGAGAAAGTGT GCACCAGATTGGCCTGTGGTCTTGTCTGTGACTATTTGGCCCAGCCCACT GTGGGTATCACCATTCCCTAGGCGGTGTGTGTGTGTGTGTGTGTGTGTGT GTGTGTGTGTGTGTTTTTTTTCTTCTCTACCTTCTTTCCTCTTTCTTTTT TTTTTATTATTATATTTCACTACATTCCATAGTTATATCTTTTTATTTTA CTCTTGCTTCTAGCCCCCCCCACTCTCTTGACTCTAGGCTACTTTTCTTC TCTTTCCTCTTATTATTTTTTCCTACGTTCTACCTAATTTATTATTGTAT TCTTCCTCTCCTCATTCTAGTCTTTACTATTTTTATTTATCTCCTTTACA CTCTTTCAATTCTTTATTTTAAATTCTCTTATTCTTTTATACTCAACTTT AATTTCTCACAATATCATCACCTCTTCTATATAAACAATTGCGGATCATT GAAAATAGTTTCTATTCCTTTTTTTCCAACATCTCTCTTCTCATCTATTT TTAAGTGAATCATTTATTCATATTACACATCCCAACCATCTATATATAAA GTTATCAGCTCTTTCTATTATAATCCTTTAATATATGATATTTCCCATAC CTACAACTTTCT	AATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXAGAACGTGCAAGAACATGCCCAGTGTTGCCA TCCCTGGTGAGCACACACTGAACCTTCCAGAGGATTCTCCCCATTCCTCA TCCCTTAGTCACCAGTGCTGCCCAGCCCTCCTCTTCCCTTTTCCCCTTAT CATGTTTACAGGAAAACCATCCGGTCCACTCTCTCACTCCACCTCCTCCC CTCCCTCCTCCCCACTTCTCTCACTGCTCCTCCTCCTCCTTCTCTCACCC CTCCTCCAAGTTTTCATAGTAAGCTGTGGATGAAACCAGATTTCTTTTCA CAATAAGAATATAAAACACACAGAAAGCTTGGGGCAGTCCCTCACGTTCT GGGGGACCTGGGCTCAATTCCCAGACACACATTAAATCCCAGCACCGGGG GTAGGGGGTGGGGTGTTTTACCTTTCCTTTTTCCTTCTATGAGCTTTTCC CTTTTTTACCTTTACTATGTTTTTCCTATTTTTCTATCTTAGCTTTCTTT TTTCTTTTCCCTCCCTATACTTTTATTTTTTTTCTTATTTTTCTTCCTCT CTTAGCCATTTGCTTTTATTCCACATCTCGGTTATTCTTGTTAATTCATC TTATATCTTTACTGCTCTTCATAAATCCCCTCCTCCTTTTTTTTNTATTT CCGATTTCATCGTGTATTCTGTTCTCCCTCTTTTCCGTATATTGTTCCCA ATCTCACCCGCTN
quality values	Open. Hide. 6 6 6 13 21 37 32 17 18 13 14 12 17 9 9 9 22 22 50 50 59 31 28 26 22 17 19 8 6 6 6 6 6 9 23 16 19 19 22 17 17 21 26 41 41 35 35 31 31 31 31 59 59 34 27 15 9 6 6 8 8 8 8 16 19 37 37 33 30 37 30 30 36 47 53 53 59 57 57 57 57 57 57 53 50 47 48 42 42 48 59 59 68 59 54 54 48 42 42 47 47 50 68 68 51 50 43 50 50 50 50 50 48 57 57 57 48 50 48 50 50 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 50 57 57 68 57 57 57 57 57 57 57 50 54 54 59 57 57 68 57 57 57 57 57 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 59 59 59 59 57 57 57 52 52 52 57 57 54 54 54 54 54 57 57 59 57 57 57 57 57 57 52 59 59 52 57 52 52 52 57 57 57 59 59 57 59 50 50 43 43 57 57 68 68 68 68 68 68 68 68 68 57 57 59 59 57 54 57 57 57 57 48 57 59 57 57 57 57 57 68 68 68 68 68 59 59 57 57 57 59 43 43 43 43 43 43 43 43 59 59 59 48 48 48 59 48 48 48 48 46 46 46 48 43 43 43 43 43 43 43 43 39 39 30 30 30 30 19 16 11 11 10 10 10 10 10 10 19 18 21 15 11 12 12 10 12 12 10 10 10 10 15 19 12 12 11 11 11 8 8 6 6 8 8 10 13 11 11 11 13 13 12 11 10 10 9 11 8 8 6 6 8 8 6 6 8 8 8 9 8 8 8 8 8 10 8 8 8 6 6 8 8 10 9 9 9 9 9 9 9 9 9 9 9 10 10 9 10 8 9 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 9 10 15 13 18 18 11 9 9 8 8 8 8 8 9 9 9 9 9 9 9 9 9 10 10 10 13 12 10 10 8 8 8 8 9 15 8 8 8 8 8 8 8 8 8 8 8 9 9 8 10 8 8 8 8 10 12 13 13 10 10 10 10 12 9 14 14 16 10 10 10 12 15 11 12 10 11 11 10 9 10 10 11 11 10 8 8 8 8 8 8 10 8 8 6 6 8 8 11 15 15 10 8 8 8 8 8 8 8 11 11 10 10 10 14 15 12 8 8 8 13 8 10 8 8 8 10 10 8 8 8 9 9 10 10 11 11 15 15 10 11 11 11 8 8 8 8 10 10 11 10 8 8 8 8 10 8 8 8 8 8 8 10 11 10 8 8 8 8 10 8 8 8 8 6 6 8 8 8 8 8 8 8 8 11 12 12 12 11 8 8 8 8 8 8 8 6 6 8 8 10 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 9 9 11 11 10 11 12 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 10 11 11 10 10 11 11 11 19 13 13 9 9 9 8 8 8 8 8 6 8 8 8 8 8 8 10 10 8 10 10 15 8 10 10 23 21 18 8 8 8 8 8 8 10 11 15 11 10 10 10 11 9 8 8 8 8 8 8 9 12 8 8 6 8 8 8 8 8 10 10 10 10 10 10 13 13 12 12 12 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 10 22 11 10 9 9 10 10 11 7 7 6 8 8 10 12 14 22 12 11 8 8 8 8 10 12 9 11 10 13 8 10 10 10 9 9 12 11 11 11 9 9 8 8 8 6 10 6 6 6	Open. Hide. 6 6 6 8 14 15 11 11 10 17 15 26 22 28 39 39 37 37 39 39 39 43 43 27 23 9 9 6 6 6 6 6 6 6 6 8 9 9 9 9 22 22 28 33 33 33 33 33 50 42 41 33 27 12 9 9 9 9 9 9 11 12 12 10 10 19 16 18 14 18 20 31 34 57 48 50 50 50 50 50 50 57 57 50 50 48 48 48 50 57 57 43 43 43 57 57 54 54 50 50 50 50 59 57 59 48 57 57 46 44 40 43 43 37 37 42 48 35 38 42 47 48 50 68 68 50 50 50 50 50 51 50 50 47 47 47 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 59 59 52 52 52 57 57 57 59 59 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 59 68 57 57 57 57 57 59 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 57 57 57 57 57 57 57 57 57 32 32 11 11 11 21 18 18 18 39 44 57 57 52 52 52 57 57 68 59 59 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 57 57 44 44 31 28 28 43 43 57 57 59 52 52 52 52 57 52 57 37 52 52 57 57 57 59 57 52 57 48 57 59 57 57 54 50 50 48 57 57 57 50 54 54 57 59 57 57 57 48 48 57 44 43 43 43 43 44 34 22 17 17 17 24 32 44 47 42 37 37 39 42 42 46 43 43 43 43 37 37 42 37 28 23 23 31 34 37 39 39 37 43 43 43 43 43 43 43 43 43 43 43 43 39 39 35 30 26 28 23 18 12 12 11 12 12 10 9 9 9 9 12 10 9 9 9 10 10 21 12 12 8 8 8 8 8 8 8 6 6 6 8 8 8 8 8 8 10 10 8 11 8 8 8 10 8 10 12 12 10 8 8 6 6 8 8 8 6 6 8 6 8 8 8 8 8 10 10 12 10 9 9 11 11 10 10 8 8 8 8 8 9 10 8 8 10 8 8 8 13 17 10 10 11 13 15 20 19 19 22 21 15 10 8 8 7 6 6 6 8 8 8 8 9 9 10 10 10 16 12 12 6 6 6 6 8 8 8 11 8 10 8 8 8 8 8 9 7 12 8 9 11 11 11 11 11 12 18 12 12 10 10 10 10 8 8 6 6 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 10 11 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 13 13 13 8 8 8 10 10 15 14 8 8 8 8 8 8 10 12 15 12 12 8 14 14 15 11 11 8 8 8 8 10 18 23 17 11 10 3 0 3 6 8 8 6 7 8 8 9 9 11 17 13 9 9 9 10 8 8 9 8 8 10 10 12 11 8 10 8 8 8 8 8 8 6 6 13 15 11 11 10 12 10 10 10 10 10 10 9 9 10 10 11 11 10 10 10 10 8 8 8 9 9 10 13 12 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no344_o18.g1 MSMg01no344_o18.g1 CHROMAT_FILE:
MSMg01no344_o18.g1 PHD_FILE: MSMg01no344_o18.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:35:16 2005
         (397 letters)



>mm_chr6_86130510_86131306
          Length = 797

 Score =  685 bits (354), Expect = 0.0
 Identities = 391/420 (93%), Gaps = 26/420 (6%)
 Strand = Plus / Plus

                                                                       
Query: 1   agaacgtgcaagaacatgcccagtgttgccatccctggtgagcacacactgaaccttcca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agaacgtgcaagaacatgcccagtgttgccatccctggtgagcacacactgaaccttcca 260

                                                                       
Query: 61  gaggattctccccattcctcatcccttagtcaccagtgctgcccagccctcctcttccct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gaggattctccccattcctcatcccttagtcaccagtgctgcccagccctcctcttccct 320

                                                                       
Query: 121 tttccccttatcatgtttacaggaaaaccatccggtccactctctcactccacctcctcc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tttccccttatcatgtttacaggaaaaccatccggtccactctctcactccacctcctcc 380

                                                                       
Query: 181 cctccctcctccccacttctctcactgctcctcctcctccttctctcacccctcctccaa 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 cctccctcctccccacttctctcactgctcctcctcctccttctctcacccctcctccaa 440

                                                                       
Query: 241 gttttcatagtaagctgtggatgaaaccagatttcttttcacaataagaatataaaacac 300
           ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 gttttcaaagtaagctgtgaatgaaaccagatttcttttcacaataagaatataaaacac 500

                                                                       
Query: 301 acagaaagcttggggcag--------------------------tccctcacgttctggg 334
           ||||||||||||||||||                          ||||||||||||||||
Sbjct: 501 acagaaagcttggggcaggaaagaagttaaattggtaaaatgcttccctcacgttctggg 560

                                                                       
Query: 335 ggacctgggctcaattcccagacacacattaaatcccagcaccgggggtagggggtgggg 394
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ggacctgggttcaattcccagacacacattaaatcccagcaccgggggtagggggtgggg 620


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 18
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 397
Length of database: 797
Length adjustment: 9
Effective length of query: 388
Effective length of database: 788
Effective search space:   305744
Effective search space used:   305744
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information