MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-447A11
Chromosome	6 (Build37)
Map Location	52,101,945 - 52,102,344
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG625167, Nfe2l3, Hnrpa2b1, Cbx3, Snx10, LOC100041820, Skap2, LOC666391
Downstream gene	Hoxa1, Hoxa2, Hoxa3, Hoxa4, Hoxa5, Hoxa6, Hoxa7, Hoxa9, Hoxa10, Hoxa11, Hoxa13, Evx1, EG666487, 1700094M24Rik, EG545841, Hibadh, Tax1bp1, Jazf1, LOC666259
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG625167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625167 MGI:3643041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Nfe2l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18025 MGI:1339958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpa2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53379 MGI:104819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cbx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12417 MGI:108515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71982 MGI:1919232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Skap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54353 MGI:1889206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666391 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Hoxa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15394 MGI:96170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15399 MGI:96174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15400 MGI:96175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15401 MGI:96176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15402 MGI:96177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15403 MGI:96178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15404 MGI:96179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15405 MGI:96180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15395 MGI:96171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15396 MGI:96172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxa13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15398 MGI:96173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14028 MGI:95461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666487 MGI:3646863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 523 ESTs, 4 Proteins

name	1700094M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74304 MGI:1921554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG545841 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545841 MGI:3647376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Hibadh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58875 MGI:1889802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tax1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52440 MGI:1289308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jazf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231986 MGI:2141450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666259 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins pseudo : _no_value

name	EG625167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377375 GeneID:625167 MGI:3643041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG625167 transcript_id : XM_898623.2

name	Nfe2l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754833 GeneID:18025 MGI:1339958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor, erythroid derived 2, like 3 transcript_id : NM_010903.1

name	Hnrpa2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109134361 GeneID:53379 MGI:104819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein A2/B1 transcript_id : NM_016806.2

name	Hnrpa2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109134360 GeneID:53379 MGI:104819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein A2/B1 transcript_id : NM_182650.3

name	Cbx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108860694 GeneID:12417 MGI:108515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 3 (Drosophila HP1 gamma) transcript_id : NM_007624.3

name	Snx10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369538 GeneID:71982 MGI:1919232
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 10 transcript_id : NM_028035.3

name	LOC100041820 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255168 GeneID:100041820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041820 transcript_id : XM_001477302.1

name	Skap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980887 GeneID:54353 MGI:1889206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src family associated phosphoprotein 2 transcript_id : NM_018773.2

name	Hoxa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922691 GeneID:15394 MGI:96170
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A1 transcript_id : NM_010449.3

name	Hoxa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754229 GeneID:15399 MGI:96174
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A2 transcript_id : NM_010451.1

name	Hoxa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66955872 GeneID:15400 MGI:96175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A3 transcript_id : NM_010452.2

name	Hoxa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381148 GeneID:15401 MGI:96176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A4 transcript_id : NM_008265.3

name	Hoxa5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130009 GeneID:15402 MGI:96177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A5 transcript_id : NM_010453.5

name	Hoxa6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544942 GeneID:15403 MGI:96178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A6 transcript_id : NM_010454.1

name	Hoxa7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130010 GeneID:15404 MGI:96179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A7 transcript_id : NM_010455.2

name	Hoxa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130021 GeneID:15405 MGI:96180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A9 transcript_id : NM_010456.2

name	Hoxa10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680242 GeneID:15395 MGI:96171
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A10 transcript_id : NM_008263.1

name	Hoxa11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129999 GeneID:15396 MGI:96172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A11 transcript_id : NM_010450.2

name	Hoxa13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680244 GeneID:15398 MGI:96173
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box A13 transcript_id : NM_008264.1

name	Evx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354819 GeneID:14028 MGI:95461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : even skipped homeotic gene 1 homolog transcript_id : NM_007966.2

name	EG666487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255176 GeneID:666487 MGI:3646863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 523 ESTs, 4 Proteins product : predicted gene, EG666487 transcript_id : XM_984165.2

name	1700094M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255131 GeneID:74304 MGI:1921554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700094M24 gene transcript_id : XM_001475795.1

name	EG545841 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377378 GeneID:545841 MGI:3647376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG545841 transcript_id : XM_622390.3

name	Hibadh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704139 GeneID:58875 MGI:1889802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-hydroxyisobutyrate dehydrogenase transcript_id : NM_145567.1

name	Tax1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384504 GeneID:52440 MGI:1289308
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tax1 (human T-cell leukemia virus type I) binding protein 1 transcript_id : NM_025816.2

name	Jazf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349394 GeneID:231986 MGI:2141450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : JAZF zinc finger 1 transcript_id : NM_173406.2

name	EG625167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901034 GeneID:625167 MGI:3643041
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903716.1

name	Nfe2l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754834 CCDS:CCDS20134.1 GeneID:18025 MGI:1339958
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear factor, erythroid derived 2, like 3 protein_id : NP_035033.1

name	Hnrpa2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32880197 GeneID:53379 MGI:104819
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; hnRNP A2/B1; heterogenous nuclear ribonucleoprotein A2/B1 product : heterogeneous nuclear ribonucleoprotein A2/B1 isoform 2 protein_id : NP_872591.1

name	Hnrpa2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109134362 GeneID:53379 MGI:104819
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hnRNP A2/B1; heterogenous nuclear ribonucleoprotein A2/B1 product : heterogeneous nuclear ribonucleoprotein A2/B1 isoform 1 protein_id : NP_058086.2

name	Cbx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:108860695 CCDS:CCDS20135.1 GeneID:12417 MGI:108515
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005701 - polytene chromosome chromocenter [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : heterochromatin protein 1 gamma product : chromobox homolog 3 protein_id : NP_031650.3

name	Snx10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560088 CCDS:CCDS20136.1 GeneID:71982 MGI:1919232
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sorting nexin 10 protein_id : NP_082311.2

name	LOC100041820 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255169 GeneID:100041820
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477352.1

name	Skap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055324 CCDS:CCDS20137.1 GeneID:54353 MGI:1889206
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IMP] codon_start : 1 note : Src-associated adaptor protein product : SKAP55 homologue protein_id : NP_061243.1

name	Hoxa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000011 CCDS:CCDS20138.1 GeneID:15394 MGI:96170
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : early retinoic acid product : homeobox A1 protein_id : NP_034579.2

name	Hoxa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754230 CCDS:CCDS20139.1 GeneID:15399 MGI:96174
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001709 - cell fate determination [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0048703 - embryonic viscerocranium morphogenesis [Evidence IMP]; GO:0042474 - middle ear morphogenesis [Evidence IMP]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : homeobox protein product : homeobox A2 protein_id : NP_034581.1

name	Hoxa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46275824 CCDS:CCDS20140.1 GeneID:15400 MGI:96175
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001974 - blood vessel remodeling [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA] [Evidence IMP]; GO:0007389 - pattern specification [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox A3 protein_id : NP_034582.1

name	Hoxa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46275810 CCDS:CCDS20142.1 GeneID:15401 MGI:96176
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox A4 protein_id : NP_032291.1

name	Hoxa5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754232 CCDS:CCDS20143.1 GeneID:15402 MGI:96177
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box A5 protein_id : NP_034583.1

name	Hoxa6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544943 CCDS:CCDS20144.1 GeneID:15403 MGI:96178
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox A6 protein_id : NP_034584.1

name	Hoxa7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754234 CCDS:CCDS20145.1 GeneID:15404 MGI:96179
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox A7 protein_id : NP_034585.1

name	Hoxa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149641 CCDS:CCDS20146.1 GeneID:15405 MGI:96180
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox protein A9 protein_id : NP_034586.1

name	Hoxa10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680243 CCDS:CCDS20147.1 GeneID:15395 MGI:96171
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeobox A10 protein_id : NP_032289.1

name	Hoxa11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754226 CCDS:CCDS20148.1 GeneID:15396 MGI:96172
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IDA]; GO:0001759 - induction of an organ [Evidence IGI]; GO:0001656 - metanephros development [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox A11 protein_id : NP_034580.1

name	Hoxa13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680245 GeneID:15398 MGI:96173
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : hypodactyly product : homeobox A13 protein_id : NP_032290.1

name	Evx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679711 CCDS:CCDS20149.1 GeneID:14028 MGI:95461
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : even skipped homeotic gene 1 homolog protein_id : NP_031992.1

name	EG666487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377377 GeneID:666487 MGI:3646863
definition	codon_start : 1 product : similar to ribosomal protein L38 protein_id : XP_989259.1

name	1700094M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255132 GeneID:74304 MGI:1921554
definition	codon_start : 1 product : hypothetical protein LOC74304 protein_id : XP_001475845.1

name	EG545841 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63542969 GeneID:545841 MGI:3647376
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622390.1

name	Hibadh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704140 CCDS:CCDS20151.1 GeneID:58875 MGI:1889802
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 note : 3-hydroxyisobutyrate dehydrogenase, mitochondrial product : 3-hydroxyisobutyrate dehydrogenase, mitochondrial precursor protein_id : NP_663542.1

name	Tax1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385284 GeneID:52440 MGI:1289308
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRAF6-binding protein homolog product : Tax1 binding protein 1 homolog protein_id : NP_080092.1

name	Jazf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734162 CCDS:CCDS20152.1 GeneID:231986 MGI:2141450
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : expressed sequence AI591476 protein_id : NP_775582.1

name	LOC666391 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666391
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130822
definition	standard_name : D6Mit275

name	(CDS detail)
type	STS
link
xref	UniSTS:110956
definition	standard_name : AU046983

name	(CDS detail)
type	STS
link
xref	UniSTS:163385
definition	standard_name : AB013852

name	(CDS detail)
type	STS
link
xref	UniSTS:207955
definition	standard_name : BB463959

name	(CDS detail)
type	STS
link
xref	UniSTS:498450
definition	standard_name : Snx10

name	(CDS detail)
type	STS
link
xref	UniSTS:7162
definition	standard_name : GDB:1317142

name	(CDS detail)
type	STS
link
xref	UniSTS:159506
definition	standard_name : AA960083

name	(CDS detail)
type	STS
link
xref	UniSTS:160949
definition	standard_name : RH118301

name	(CDS detail)
type	STS
link
xref	UniSTS:123642
definition	standard_name : 24.MMHAP36FLH3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130904
definition	standard_name : MTH2514

name	(CDS detail)
type	STS
link
xref	UniSTS:130905
definition	standard_name : D6Mit353.1

name	(CDS detail)
type	STS
link
xref	UniSTS:424604
definition	standard_name : REN99807

name	(CDS detail)
type	STS
link
xref	UniSTS:425085
definition	standard_name : REN100288

name	(CDS detail)
type	STS
link
xref	UniSTS:449404
definition	standard_name : stSG609304

name	(CDS detail)
type	STS
link
xref	UniSTS:470556
definition	standard_name : Hoxa1

name	(CDS detail)
type	STS
link
xref	UniSTS:163386
definition	standard_name : M22115

name	(CDS detail)
type	STS
link
xref	UniSTS:124934
definition	standard_name : M22115

name	(CDS detail)
type	STS
link
xref	UniSTS:119889
definition	standard_name : RH94642

name	(CDS detail)
type	STS
link
xref	UniSTS:425099
definition	standard_name : REN100302

name	(CDS detail)
type	STS
link
xref	UniSTS:143360
definition	standard_name : Hoxa1

name	(CDS detail)
type	STS
link
xref	UniSTS:130996
definition	standard_name : D6Mit93

name	(CDS detail)
type	STS
link
xref	UniSTS:143366
definition	standard_name : Hoxa2

name	(CDS detail)
type	STS
link
xref	UniSTS:235444
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125007
definition	standard_name : M95599

name	(CDS detail)
type	STS
link
xref	UniSTS:143365
definition	standard_name : Hoxa2

name	(CDS detail)
type	STS
link
xref	UniSTS:281753
definition	standard_name : ECD00644

name	(CDS detail)
type	STS
link
xref	UniSTS:165466
definition	standard_name : AI324701

name	(CDS detail)
type	STS
link
xref	UniSTS:425135
definition	standard_name : REN100338

name	(CDS detail)
type	STS
link
xref	UniSTS:290928
definition	standard_name : ECD09887

name	(CDS detail)
type	STS
link
xref	UniSTS:425136
definition	standard_name : REN100339

name	(CDS detail)
type	STS
link
xref	UniSTS:449414
definition	standard_name : stSG609316

name	(CDS detail)
type	STS
link
xref	UniSTS:425160
definition	standard_name : REN100363

name	(CDS detail)
type	STS
link
xref	UniSTS:425161
definition	standard_name : REN100364

name	(CDS detail)
type	STS
link
xref	UniSTS:425162
definition	standard_name : REN100365

name	(CDS detail)
type	STS
link
xref	UniSTS:273050
definition	standard_name : PMC316811P1

name	(CDS detail)
type	STS
link
xref	UniSTS:467536
definition	standard_name : Hoxa3

name	(CDS detail)
type	STS
link
xref	UniSTS:425172
definition	standard_name : REN100375

name	(CDS detail)
type	STS
link
xref	UniSTS:235446
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:425241
definition	standard_name : REN100444

name	(CDS detail)
type	STS
link
xref	UniSTS:284827
definition	standard_name : ECD03747

name	(CDS detail)
type	STS
link
xref	UniSTS:179372
definition	standard_name : AV206827

name	(CDS detail)
type	STS
link
xref	UniSTS:489066
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:297092
definition	standard_name : ECD16077

name	(CDS detail)
type	STS
link
xref	UniSTS:425304
definition	standard_name : REN100507

name	(CDS detail)
type	STS
link
xref	UniSTS:143368
definition	standard_name : Hoxa5

name	(CDS detail)
type	STS
link
xref	UniSTS:143369
definition	standard_name : Hoxa5

name	(CDS detail)
type	STS
link
xref	UniSTS:425308
definition	standard_name : REN100511

name	(CDS detail)
type	STS
link
xref	UniSTS:449442
definition	standard_name : stSG609349

name	(CDS detail)
type	STS
link
xref	UniSTS:231213
definition	standard_name : MARC_6217-6218:992007117:1

name	(CDS detail)
type	STS
link
xref	UniSTS:57649
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:425309
definition	standard_name : REN100512

name	(CDS detail)
type	STS
link
xref	UniSTS:125907
definition	standard_name : Y00208

name	(CDS detail)
type	STS
link
xref	UniSTS:239193
definition	standard_name : Hoxa5

name	(CDS detail)
type	STS
link
xref	UniSTS:425319
definition	standard_name : REN100522

name	(CDS detail)
type	STS
link
xref	UniSTS:425320
definition	standard_name : REN100523

name	(CDS detail)
type	STS
link
xref	UniSTS:425321
definition	standard_name : REN100524

name	(CDS detail)
type	STS
link
xref	UniSTS:143370
definition	standard_name : Hoxa6

name	(CDS detail)
type	STS
link
xref	UniSTS:467537
definition	standard_name : Hoxa6

name	(CDS detail)
type	STS
link
xref	UniSTS:143371
definition	standard_name : Hoxa7

name	(CDS detail)
type	STS
link
xref	UniSTS:218505
definition	standard_name : RH135228

name	(CDS detail)
type	STS
link
xref	UniSTS:143372
definition	standard_name : Hoxa7

name	(CDS detail)
type	STS
link
xref	UniSTS:425377
definition	standard_name : REN100580

name	(CDS detail)
type	STS
link
xref	UniSTS:449457
definition	standard_name : stSG609368

name	(CDS detail)
type	STS
link
xref	UniSTS:208345
definition	standard_name : AA987181

name	(CDS detail)
type	STS
link
xref	UniSTS:468837
definition	standard_name : Hoxa9

name	(CDS detail)
type	STS
link
xref	UniSTS:143375
definition	standard_name : Hoxa9

name	(CDS detail)
type	STS
link
xref	UniSTS:449458
definition	standard_name : stSG609369

name	(CDS detail)
type	STS
link
xref	UniSTS:271171
definition	standard_name : PMC15172P1

name	(CDS detail)
type	STS
link
xref	UniSTS:71932
definition	standard_name : HOX1

name	(CDS detail)
type	STS
link
xref	UniSTS:274178
definition	standard_name : Hoxa9

name	(CDS detail)
type	STS
link
xref	UniSTS:143376
definition	standard_name : Hoxa9

name	(CDS detail)
type	STS
link
xref	UniSTS:425416
definition	standard_name : REN100619

name	(CDS detail)
type	STS
link
xref	UniSTS:425417
definition	standard_name : REN100620

name	(CDS detail)
type	STS
link
xref	UniSTS:425439
definition	standard_name : REN100642

name	(CDS detail)
type	STS
link
xref	UniSTS:425441
definition	standard_name : REN100644

name	(CDS detail)
type	STS
link
xref	UniSTS:143361
definition	standard_name : Hoxa10

name	(CDS detail)
type	STS
link
xref	UniSTS:281421
definition	standard_name : ECD00308

name	(CDS detail)
type	STS
link
xref	UniSTS:124870
definition	standard_name : L08757

name	(CDS detail)
type	STS
link
xref	UniSTS:250019
definition	standard_name : AA893141

name	(CDS detail)
type	STS
link
xref	UniSTS:281527
definition	standard_name : ECD00416

name	(CDS detail)
type	STS
link
xref	UniSTS:143362
definition	standard_name : Hoxa10

name	(CDS detail)
type	STS
link
xref	UniSTS:282141
definition	standard_name : ECD01033

name	(CDS detail)
type	STS
link
xref	UniSTS:270953
definition	standard_name : PMC140663P1

name	(CDS detail)
type	STS
link
xref	UniSTS:425455
definition	standard_name : REN100658

name	(CDS detail)
type	STS
link
xref	UniSTS:218515
definition	standard_name : RH135238

name	(CDS detail)
type	STS
link
xref	UniSTS:474751
definition	standard_name : Hoxa11

name	(CDS detail)
type	STS
link
xref	UniSTS:179373
definition	standard_name : U20370

name	(CDS detail)
type	STS
link
xref	UniSTS:498386
definition	standard_name : Hoxa11

name	(CDS detail)
type	STS
link
xref	UniSTS:125692
definition	standard_name : U20371

name	(CDS detail)
type	STS
link
xref	UniSTS:271696
definition	standard_name : PMC186320P1

name	(CDS detail)
type	STS
link
xref	UniSTS:425500
definition	standard_name : REN100703

name	(CDS detail)
type	STS
link
xref	UniSTS:425501
definition	standard_name : REN100704

name	(CDS detail)
type	STS
link
xref	UniSTS:425502
definition	standard_name : REN100705

name	(CDS detail)
type	STS
link
xref	UniSTS:286560
definition	standard_name : ECD05496

name	(CDS detail)
type	STS
link
xref	UniSTS:425503
definition	standard_name : REN100706

name	(CDS detail)
type	STS
link
xref	UniSTS:1216
definition	standard_name : RH66791

name	(CDS detail)
type	STS
link
xref	UniSTS:143364
definition	standard_name : Hoxa13

name	(CDS detail)
type	STS
link
xref	UniSTS:265718
definition	standard_name : Hoxa13

name	(CDS detail)
type	STS
link
xref	UniSTS:472856
definition	standard_name : Hoxa13

name	(CDS detail)
type	STS
link
xref	UniSTS:265597
definition	standard_name : Hoxa13

name	(CDS detail)
type	STS
link
xref	UniSTS:294176
definition	standard_name : ECD13145

name	(CDS detail)
type	STS
link
xref	UniSTS:125803
definition	standard_name : X54239

name	(CDS detail)
type	STS
link
xref	UniSTS:425786
definition	standard_name : REN100989

name	(CDS detail)
type	STS
link
xref	UniSTS:131726
definition	standard_name : D9Mit170

name	(CDS detail)
type	STS
link
xref	UniSTS:426158
definition	standard_name : REN101361

name	(CDS detail)
type	STS
link
xref	UniSTS:426223
definition	standard_name : REN101426

name	(CDS detail)
type	STS
link
xref	UniSTS:159507
definition	standard_name : AI265272

name	(CDS detail)
type	STS
link
xref	UniSTS:449654
definition	standard_name : stSG611224

name	(CDS detail)
type	STS
link
xref	UniSTS:64116
definition	standard_name : RH65631

name	(CDS detail)
type	STS
link
xref	UniSTS:2823
definition	standard_name : SGC31789

name	(CDS detail)
type	STS
link
xref	UniSTS:159508
definition	standard_name : AA930106

name	(CDS detail)
type	STS
link
xref	UniSTS:210346
definition	standard_name : RH136356

name	(CDS detail)
type	STS
link
xref	UniSTS:167500
definition	standard_name : D6Ertd772e

name	(CDS detail)
type	STS
link
xref	UniSTS:167486
definition	standard_name : RH127165

name	(CDS detail)
type	STS
link
xref	UniSTS:165467
definition	standard_name : AI591476

name	(CDS detail)
type	STS
link
xref	UniSTS:90661
definition	standard_name : RH92604

name	(CDS detail)
type	STS
link
xref	UniSTS:167471
definition	standard_name : RH126675

name	(CDS detail)
type	STS
link
xref	UniSTS:207957
definition	standard_name : BB268413

name	(CDS detail)
type	STS
link
xref	UniSTS:125144
definition	standard_name : MHAa34e9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207956
definition	standard_name : AU016599

name	LOC666259 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255179 GeneID:666259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins product : similar to dynactin 5 (p25) pseudo : _no_value transcript_id : XR_033356.1

clone name	MSMg01-352H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-138I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346J19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157M09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-447A11.T7 (MSMg01no447_a11.b1)	MSMg01-447A11.TJ (MSMg01no447_a11.g1)
ACC	AG535583	AG535584
length	1,141	767
length of high quality (start - end)	---	401 (76 - 476)
definition	CHROMAT_FILE: MSMg01no447_a11.b1 PHD_FILE: MSMg01no447_a11.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:15:44 2005	CHROMAT_FILE: MSMg01no447_a11.g1 PHD_FILE: MSMg01no447_a11.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:15:44 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	AGTGGAGTTAGGGATTAGGTCTNTCTTCTAGACTCTCTTATACTCTCAAA TATATCTACTATCACATCANACAACGCTTCCTCTCTACTGTCGAGGCGGA GGGTGGCGCGGTGTGGGCTAGGTTATCGAGTTTCTTGTCCGTTANTCTGT CTACTTCTTCTCTTTATGTTTTATTTNACTTGTATATTACGAATCTTCTT TCTATCCGCGATAATACAGCTCGGTGCTGTCGACCNTACGACTAGGATAT TAGAGACTAGAAGGAGACGGGGAAGGGACGAGAGTGACGAGTCATCGGCG TAGAGGAGCGCAGGAGCGCTAGGCGCTAGTTGAAGAGCAGGTTTGAGAAC ACAACTACTAAATAACGACTCCAACAATAAATAGATCATACTATCAATAA TCTGATTATAGTGGCTATGTGGCGAGTTCTTACGTATTCCACCGAATGTA TGACATTCATTATTAAATATCCATAACATCATACTATACGAGACCCCTCA TGATAACTAGGCTTATCAATTATAGTGATACAATATCACGCTAATGGTCG ATCCGGGTCGAGTGTATCGAGAGATAGAGACTACAGAGATAACATGACAA GTTGCCGTTAGCCACAACGCGAGAATACATGAAATAAGAAGTTACGCGGA GGAGTGCTATACACACATTTCAGCAAGGTAACTAGAGTAGGAGCTAATAG TCGAAGCGTCGTTATCGCGCACGCATCGGCTATTACTACCCTACAACGTA CATAATGGTAGTACAGAGCGAGTCGGAGACCACACGCTAATGTATCACAC TTTGGGTTTCGCAATCGACGGACTAATGTTGTGAAGGATCGCACGCAGTA CACACATAGAGCACGTATCACGCAGCGCCGTGTCTCCTCGTGCAACGACC CGATACGCATGAGCAGAACGGATTATTAGTATCGACGTGAGACGTATTCG ACATATTGTCTGACGACTGGTGAAGTTCGAAGTCTGTCTATAATGGATAG GACACAATATAGCTGCCGATGCAGCAGTATAGTCGCACCAGACAAACGNA CATCAATAAGCTGCGCACGAGCACGCCCTCGTAAGAATCTAATTTATTTG ATCGTTACCCGTCTCTTAGATGATTAGAGCGGCCAGACGGN	CGATACXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXCTTGTGCCTGGATGACCAGAGCTGA GCGAGGCCCATCGATCTATTCACTCACTTTAAGGATCAGAAAAAGAGCCC AGGAACTAGATTTGCAGAAGAGCCAGTGACCAGTACCTAATTTCTAAATA GAAACCAGGATAACTTAGAACCCAAGTTCAGCCCACTTCCAAGTTCTAGA ATTCTAATTTTGATCGTCGTTTATCCATTATTTATCTTTTGTTTCATTCT AGTTATTTTCACATTGGAACTACTGAATCTTTGAAACAACCTTTAAATTA AATGTTTTCTATCATTTTGTTGAACTGGTACAGTTTTGGCTTTTTACTCT TGAGGGCATACAGCCTTAAAATGCTCAGAGAGGGCATATAAACACACACA CACACACACACACACACACACACACTCACACACTATTTGTTTTGAAAACC CAGACTTGATAAGAATAATTGAAATAGCAGTTTTCTCCACCCAGAATTGG TCTCCACTAAATGAACCAGGCCTTCAAAATATAATGAACTTCACGAGTAA CACAGCAGGAAGAGATCTGGCCCTGGATCTTCTGGGTGGATTCCGGTTTT GTTGCTTTCTTACTGGCTCTGTCCCCTGTATTGTTCCTGTTCCATATTTC CTAATTTTCCCGTGTGCCATTCTCTCGCTCCTAATACCTATCCTTTTCCT CGATATTCCCGGGTGGG
quality values	Open. Hide. 8 8 8 8 8 10 6 6 6 6 6 6 8 8 8 6 6 6 8 8 11 3 0 3 7 7 13 8 8 8 8 8 8 9 9 10 9 8 6 8 6 6 6 6 8 8 8 8 9 10 10 10 9 8 8 8 10 8 7 7 7 8 8 8 8 7 7 7 3 0 3 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 9 11 10 9 8 8 8 8 9 8 9 8 8 8 8 8 8 8 8 8 8 6 6 8 12 16 16 11 10 9 8 10 10 10 8 8 8 8 8 10 10 10 10 8 8 8 8 6 6 6 9 9 9 3 0 3 7 8 6 6 8 8 6 6 8 10 10 8 19 8 10 8 8 8 12 12 8 9 9 12 8 6 6 6 6 3 0 3 8 8 8 8 8 8 8 8 8 7 6 6 6 8 6 8 8 8 8 10 10 8 8 8 8 8 8 8 11 9 9 8 8 6 6 8 8 10 10 9 9 11 10 10 10 7 8 6 8 8 6 6 6 6 8 8 3 0 3 8 8 8 8 6 6 7 6 8 8 10 10 8 8 6 6 8 8 8 8 8 11 10 10 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 10 6 6 8 8 8 8 8 8 8 8 8 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 6 6 6 6 8 8 8 8 8 6 7 8 8 11 8 11 11 10 10 10 10 10 10 10 10 9 9 10 6 8 6 6 8 8 8 8 8 6 6 6 6 8 8 10 10 8 9 8 8 8 8 8 8 9 8 8 8 8 6 6 8 8 9 9 11 11 12 10 11 10 10 10 10 10 11 11 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 9 10 10 10 13 13 10 8 8 8 8 8 8 8 10 6 6 6 6 8 6 6 6 6 8 10 9 9 9 9 6 8 6 6 8 8 8 6 6 8 6 11 11 10 10 8 6 6 8 8 8 8 10 8 8 8 11 12 16 6 9 7 6 6 6 8 8 8 8 6 6 6 6 10 8 8 9 9 8 6 6 6 7 10 8 8 8 8 8 6 6 6 8 8 10 13 8 10 9 8 10 8 10 7 6 6 6 6 6 10 10 8 8 8 11 8 8 12 12 7 6 8 8 8 8 8 6 8 6 7 8 8 15 8 8 9 9 9 9 9 9 9 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 12 8 8 8 8 8 8 11 11 11 11 10 10 10 10 9 9 9 10 8 8 8 6 8 6 6 8 6 11 11 11 11 11 11 10 10 8 10 7 7 8 6 9 9 12 12 10 9 9 9 8 8 6 6 8 8 8 9 9 9 9 9 9 9 10 8 7 6 8 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 10 10 12 9 9 8 10 8 8 8 8 8 8 6 6 6 6 6 8 8 6 6 8 8 10 6 6 6 6 8 8 8 8 8 8 10 12 10 10 10 8 8 6 6 6 8 10 10 10 12 9 8 7 7 7 8 9 8 6 6 6 6 6 16 12 12 11 10 10 8 8 6 6 6 6 8 8 8 6 6 8 8 8 8 8 8 8 8 10 6 6 6 6 10 10 10 10 9 9 8 8 6 6 6 6 8 6 8 8 10 8 8 8 8 8 8 10 8 8 6 6 8 6 8 8 6 6 6 6 6 6 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 6 8 6 6 6 8 10 13 8 10 8 8 8 8 8 8 8 8 8 8 8 6 8 6 6 8 6 8 8 8 8 6 6 10 8 8 8 8 10 8 8 6 6 8 6 9 11 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 10 10 9 10 10 10 12 10 9 9 9 9 9 9 8 10 10 8 8 8 6 6 6 6 8 8 8 8 8 10 10 8 8 8 8 8 8 8 10 8 10 9 10 8 8 8 10 12 8 8 8 8 6 7 6 6 11 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 8 8 6 6 6 8 8 8 8 8 8 8 10 12 12 7 7 8 8 10 9 8 6 6 8 8 8 8 8 8 6 6 6 6 8 10 9 9 10 9 11 8 8 8 6 8 6 8 7 8 6 6 6 6 6 6 8 6 6 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 8 6 6 6 8 8 7 7 7 10 10 7 8 9 9 8 8 7 7 8 8 11 8 6 6 6 8 6 8 3 0 3 10 11 13 16 13 13 13 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 8 7 7 9 9 8 8 8 6 6 8 6 6 6 8 6 7 7 6 8 9 8 8 8 8 8 8 8 8 8 8 12 8 6 6 6 6 8 13 13 11 8 8 8 10 10 11 13 10 6 6 6 6 6 6 9 11 9 9 9 8 8 6 7 3 0	Open. Hide. 6 6 8 6 9 10 9 9 11 7 7 7 8 10 27 27 41 37 39 39 37 29 29 28 22 22 28 39 39 43 31 23 12 11 15 15 18 19 20 21 21 20 23 39 39 37 37 37 37 37 37 37 37 39 50 42 41 39 39 39 19 20 24 23 27 30 39 39 40 30 31 36 36 38 36 53 53 53 53 57 57 57 57 57 47 47 47 47 47 50 54 50 50 54 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 47 47 51 50 50 50 57 57 68 68 68 50 50 50 50 50 50 57 57 59 59 59 59 59 68 68 68 68 68 68 57 50 50 50 50 57 50 50 50 50 50 50 68 68 68 68 68 68 68 68 57 57 57 57 54 50 50 51 51 50 68 68 68 68 57 57 57 57 57 59 59 59 59 59 68 57 57 57 57 57 57 57 68 68 68 68 57 57 57 57 57 68 68 57 57 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 59 62 62 62 62 62 62 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 62 62 62 68 68 68 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 68 68 59 59 57 57 57 57 57 68 68 59 59 59 59 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 57 57 59 59 57 59 59 59 57 57 59 57 52 54 52 57 52 52 52 57 59 59 59 57 57 57 52 57 43 43 41 50 50 57 50 57 42 42 37 37 37 42 37 43 43 43 43 44 43 39 30 32 17 17 16 19 15 17 32 21 32 32 27 26 16 16 15 24 19 24 19 11 11 11 13 21 28 25 17 17 18 27 24 15 15 21 21 25 36 37 30 30 30 32 37 39 43 39 39 28 28 23 28 32 32 35 35 40 32 37 33 30 25 28 24 28 24 24 22 24 24 23 23 26 34 23 26 15 17 17 27 28 41 37 37 33 32 32 37 37 37 39 32 31 22 22 19 29 33 37 28 28 28 28 20 22 18 18 18 15 19 16 16 16 10 10 12 15 18 13 14 12 15 11 12 14 24 24 25 18 21 11 11 11 23 19 16 11 11 12 16 16 14 12 12 11 11 11 11 21 16 16 19 18 18 28 34 21 14 11 11 10 16 15 15 17 17 22 22 24 21 25 18 15 14 12 13 13 9 8 6 10 10 11 8 8 8 11 16 16 22 17 18 14 14 13 13 10 10 8 10 8 8 8 8 8 8 8 7 6 6 6 8 14 9 8 6 8 8 8 10 12 12 17 17 28 32 29 24 22 21 10 8 8 8 8 10 12 22 15 15 12 13 13 10 8 11 8 8 8 13 10 8 8 6 6 8 8 8 8 11 10 10 17 8 8 8 9 9 11 12 11 12 9 9 9 9 10 8 10 9 10 10 15 10 10 10 8 8 8 9 8 6 6 8 8 8 10 9 9 9 12 11 13 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no447_a11.g1 MSMg01no447_a11.g1 CHROMAT_FILE:
MSMg01no447_a11.g1 PHD_FILE: MSMg01no447_a11.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:15:44 2005
         (401 letters)



>mm_chr6_52101779_52102579
          Length = 801

 Score =  766 bits (396), Expect = 0.0
 Identities = 399/400 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   cttgtgcctggatgaccagagctgagcgaggcccatcgatctattcactcactttaagga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 566 cttgtgcctggatgaccagagctgagcgaggcccatcgatctattcactcactttaagga 507

                                                                       
Query: 61  tcagaaaaagagcccaggaactagatttgcagaagagccagtgaccagtacctaatttct 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 506 tcagaaaaagagcccaggaactagatttgcagaagagccagtgaccagtacctaatttct 447

                                                                       
Query: 121 aaatagaaaccaggataacttagaacccaagttcagcccacttccaagttctagaattct 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 446 aaatagaaaccaggataacttagaacccaagttcagcccacttccaagttctagaattct 387

                                                                       
Query: 181 aattttgatcgtcgtttatccattatttatcttttgtttcattctagttattttcacatt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 386 aattttgatcgtcgtttatccattatttatcttttgtttcattctagttattttcacatt 327

                                                                       
Query: 241 ggaactactgaatctttgaaacaacctttaaattaaatgttttctatcattttgttgaac 300
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 326 ggaactactgaatctttgaaacaacctttaaattaaatgtattctatcattttgttgaac 267

                                                                       
Query: 301 tggtacagttttggctttttactcttgagggcatacagccttaaaatgctcagagagggc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 266 tggtacagttttggctttttactcttgagggcatacagccttaaaatgctcagagagggc 207

                                                   
Query: 361 atataaacacacacacacacacacacacacacacacacac 400
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 206 atataaacacacacacacacacacacacacacacacacac 167


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 47
Number of extensions: 7
Number of successful extensions: 7
Number of sequences better than 10.0: 1
Number of HSP's gapped: 5
Number of HSP's successfully gapped: 1
Length of query: 401
Length of database: 801
Length adjustment: 9
Effective length of query: 392
Effective length of database: 792
Effective search space:   310464
Effective search space used:   310464
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information