MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-454A24
Chromosome	6 (Build37)
Map Location	88,855,795 - 89,069,832
singlet/doublet	doublet
Overlap gene	Gpr175, 4933427D06Rik
Upstream gene	Copg, 8430410A17Rik, LOC665416, H1fx, EG434064, LOC100043131, Rab7, Rpn1, Gata2, Dnajb8, Eefsec, Ruvbl1, Sec61a1, 4933428M03Rik, Mgll, Abtb1, Podxl2, LOC100043146, Mcm2
Downstream gene	Gm1965, LOC100043153, LOC100043159, EG624483, EG624491, LOC665547, EG624537, Gm839, 4930512J16Rik, Plxna1, Chchd6, Txnrd3, V1r-ps1, V1rb7, V1rb9, V1r-ps2, V1r-ps3, V1ra6, V1ra5, V1rb4, V1r-ps4, V1ra2, V1rb8, V1ra4, V1ra3, V1rb2, V1rb1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Copg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	8430410A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232210 MGI:1914053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins pseudo : _no_value

name	H1fx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243529 MGI:2685307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434064 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100043131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rab7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19349 MGI:105068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103963 MGI:98084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gata2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14461 MGI:95662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eefsec (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65967 MGI:2137092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ruvbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56505 MGI:1928760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec61a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53421 MGI:1858417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933428M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74589 MGI:1918481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgll (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23945 MGI:1346042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abtb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80283 MGI:1933148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Podxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319655 MGI:2442488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Mcm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17216 MGI:105380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24100 MGI:1345190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG624483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG624491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC665547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG624537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Gm839 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330379 MGI:2685685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930512J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Plxna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18844 MGI:107685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66098 MGI:1913348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnrd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113869 MGI:2148531
definition	note : vomeronasal 1 receptor, pseudogene 1 pseudo : _no_value

name	V1rb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113870 MGI:2148532
definition	note : vomeronasal 1 receptor, pseudogene 2 pseudo : _no_value

name	V1r-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113871 MGI:2148533
definition	note : vomeronasal 1 receptor, pseudogene 3 pseudo : _no_value

name	V1ra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	V1r-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113872 MGI:2148534
definition	gene_synonym : V1RB3 note : vomeronasal 1 receptor, pseudogene 4 pseudo : _no_value

name	V1ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113846 MGI:2148509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130780 GeneID:54161 MGI:1858696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit gamma transcript_id : NM_017477.2

name	8430410A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343454 GeneID:232210 MGI:1914053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430410A17 gene transcript_id : NM_173737.2

name	H1fx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348565 GeneID:243529 MGI:2685307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member X transcript_id : NM_198622.1

name	EG434064 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255236 GeneID:434064 MGI:3648213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG434064 transcript_id : XM_976858.2

name	LOC100043131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255237 GeneID:100043131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043131 transcript_id : XM_001479559.1

name	Rab7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679598 GeneID:19349 MGI:105068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB7, member RAS oncogene family transcript_id : NM_009005.1

name	Rpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802696 GeneID:103963 MGI:98084
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribophorin I transcript_id : NM_133933.3

name	Gata2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378318 GeneID:14461 MGI:95662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 2 transcript_id : NM_008090.4

name	Dnajb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910415 GeneID:56691 MGI:1922801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 8 transcript_id : NM_019964.1

name	Eefsec (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038122 GeneID:65967 MGI:2137092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic elongation factor, selenocysteine-tRNA-specific transcript_id : NM_023060.3

name	Ruvbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053923 GeneID:56505 MGI:1928760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RuvB-like protein 1 transcript_id : NM_019685.2

name	Sec61a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387803 GeneID:53421 MGI:1858417
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec61 alpha 1 subunit (S. cerevisiae) transcript_id : NM_016906.3

name	4933428M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312803 GeneID:74589 MGI:1918481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933428M03 gene transcript_id : NM_029013.1

name	Mgll (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982751 GeneID:23945 MGI:1346042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoglyceride lipase transcript_id : NM_011844.3

name	Abtb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365947 GeneID:80283 MGI:1933148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and BTB (POZ) domain containing 1 transcript_id : NM_030251.2

name	Podxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542456 GeneID:319655 MGI:2442488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocalyxin-like 2 transcript_id : NM_176973.3

name	Mcm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678825 GeneID:17216 MGI:105380
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 2 mitotin (S. cerevisiae) transcript_id : NM_008564.1

name	Gpr175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326470 GeneID:24100 MGI:1345190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 175 transcript_id : NM_011906.2

name	4933427D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378057 GeneID:232217 MGI:3026922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933427D06 gene transcript_id : NM_175017.3

name	Gm1965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801784 GeneID:434065 MGI:3584270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1965, (NCBI) transcript_id : NM_001033491.2

name	LOC100043159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255239 GeneID:100043159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100043159 transcript_id : XM_001479648.1

name	EG624483 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255241 GeneID:624483 MGI:3645279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG624483 transcript_id : XM_889034.3

name	EG624491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255243 GeneID:624491 MGI:3645511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624491 transcript_id : XM_889044.3

name	EG624537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255245 GeneID:624537 MGI:3645589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG624537 transcript_id : XM_889083.3

name	Gm839 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235726 GeneID:330379 MGI:2685685
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 839, (NCBI) transcript_id : NM_201356.1

name	4930512J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255354 GeneID:75131 MGI:1922381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930512J16 gene transcript_id : XM_001480366.1

name	Plxna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679388 GeneID:18844 MGI:107685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin A1 transcript_id : NM_008881.1

name	Chchd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754145 GeneID:66098 MGI:1913348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 6 transcript_id : NM_025351.2

name	Txnrd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735448 GeneID:232223 MGI:2386711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 3 transcript_id : NM_153162.3

name	V1rb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716538 GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B7 transcript_id : NM_053228.1

name	V1rb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716542 GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B9 transcript_id : NM_053230.1

name	V1ra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716528 GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A6 transcript_id : NM_053221.1

name	V1ra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716526 GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A5 transcript_id : NM_053220.1

name	V1rb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553591 GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs product : vomeronasal 1 receptor, B4 transcript_id : NM_053227.2

name	V1ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665735 GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A2 transcript_id : NM_011684.2

name	V1rb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716540 GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B8 transcript_id : NM_053229.1

name	V1ra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716524 GeneID:113846 MGI:2148509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A4 transcript_id : NM_053219.1

name	V1ra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716522 GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A3 transcript_id : NM_053218.1

name	V1rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755950 GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1, receptor B2 transcript_id : NM_011911.1

name	V1rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716532 GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B1 transcript_id : NM_053225.1

name	Copg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567338 GeneID:54161 MGI:1858696
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; coatomer protein complex, subunit gamma 1 product : coatomer protein complex, subunit gamma isoform 1 protein_id : NP_059505.1

name	8430410A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424571 GeneID:232210 MGI:1914053
definition	codon_start : 1 product : hypothetical protein LOC232210 protein_id : NP_776098.1

name	H1fx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348566 CCDS:CCDS20331.1 GeneID:243529 MGI:2685307
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : H1 histone family, member X protein_id : NP_941024.1

name	EG434064 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377989 GeneID:434064 MGI:3648213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981952.1

name	LOC100043131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255238 GeneID:100043131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479609.1

name	Rab7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679599 GeneID:19349 MGI:105068
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA] [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAB7, member RAS oncogene family protein_id : NP_033031.1

name	Rpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543605 CCDS:CCDS20332.1 GeneID:103963 MGI:98084
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribophorin I protein_id : NP_598694.2

name	Gata2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982351 CCDS:CCDS20333.1 GeneID:14461 MGI:95662
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IEA]; GO:0021983 - pituitary gland development [Evidence IMP]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GATA-binding protein 2 product : GATA binding protein 2 protein_id : NP_032116.3

name	Dnajb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910416 CCDS:CCDS20334.1 GeneID:56691 MGI:1922801
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DnaJ homolog 6 product : DnaJ homolog, subfamily B, member 8 protein_id : NP_064348.1

name	Eefsec (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746442 CCDS:CCDS20335.1 GeneID:65967 MGI:2137092
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0001514 - selenocysteine incorporation [Evidence IMP] [Evidence IDA] codon_start : 1 note : MJ0495-like protein SelB product : eukaryotic elongation factor, selenocysteine-tRNA-specific protein_id : NP_075547.1

name	Ruvbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790083 CCDS:CCDS20336.1 GeneID:56505 MGI:1928760
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Pontin 52 product : RuvB-like protein 1 protein_id : NP_062659.1

name	Sec61a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394252 GeneID:53421 MGI:1858417
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA] GO_process : GO:0009306 - protein secretion [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : transport protein sec61 alpha subunit; SEC61, alpha subunit product : Sec61 alpha subunit homolog protein_id : NP_058602.1

name	4933428M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312804 CCDS:CCDS20337.1 GeneID:74589 MGI:1918481
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74589 protein_id : NP_083289.1

name	Mgll (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754690 CCDS:CCDS20338.1 GeneID:23945 MGI:1346042
definition	GO_function : GO:0047372 - acylglycerol lipase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] citation : [PUBMED 9341166] codon_start : 1 note : monoacylglycerol lipase product : monoglyceride lipase protein_id : NP_035974.1

name	Abtb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384866 CCDS:CCDS20339.1 GeneID:80283 MGI:1933148
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mFLJ00331 protein product : ankyrin repeat and BTB (POZ) domain containing 1 protein_id : NP_084527.1

name	Podxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542457 CCDS:CCDS20340.1 GeneID:319655 MGI:2442488
definition	codon_start : 1 exception : mismatches in translation product : podocalyxin-like 2 protein_id : NP_795947.2

name	Mcm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678826 GeneID:17216 MGI:105380
definition	GO_component : GO:0005664 - nuclear origin of replication recognition complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003688 - DNA replication origin binding [Evidence IDA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence TAS]; GO:0006268 - DNA unwinding during replication [Evidence IDA]; GO:0006334 - nucleosome assembly [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mini chromosome maintenance deficient 2 product : minichromosome maintenance deficient 2 mitotin protein_id : NP_032590.1

name	Gpr175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326471 GeneID:24100 MGI:1345190
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane domain protein regulated in adipocytes 40 kDa product : G protein-coupled receptor 175 protein_id : NP_036036.2

name	4933427D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424689 CCDS:CCDS20341.1 GeneID:232217 MGI:3026922
definition	codon_start : 1 product : hypothetical protein LOC232217 protein_id : NP_778182.1

name	Gm1965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702029 GeneID:434065 MGI:3584270
definition	codon_start : 1 product : hypothetical protein LOC434065 protein_id : NP_001028663.1

name	LOC100043159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255240 GeneID:100043159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479698.1

name	EG624483 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255242 GeneID:624483 MGI:3645279
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894127.3

name	EG624491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255244 GeneID:624491 MGI:3645511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894137.2

name	EG624537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255246 GeneID:624537 MGI:3645589
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894176.2

name	Gm839 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235727 GeneID:330379 MGI:2685685
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC330379 protein_id : NP_958744.1

name	4930512J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255355 GeneID:75131 MGI:1922381
definition	codon_start : 1 product : hypothetical protein LOC75131 protein_id : XP_001480416.1

name	Plxna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679389 CCDS:CCDS20344.1 GeneID:18844 MGI:107685
definition	GO_component : GO:0005886 - plasma membrane [Evidence IC] GO_function : GO:0017154 - semaphorin receptor activity [Evidence IPI] codon_start : 1 note : plexin 1 product : plexin A1 protein_id : NP_032907.1

name	Chchd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754146 GeneID:66098 MGI:1913348
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : coiled-coil-helix-coiled-coil-helix domain containing 6 protein_id : NP_079627.2

name	Txnrd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735449 GeneID:232223 MGI:2386711
definition	GO_component : GO:0005792 - microsome [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence IDA]; GO:0006125 - thioredoxin pathway [Evidence IDA] codon_start : 1 note : thioredoxin and glutathione reductase product : thioredoxin reductase 3 protein_id : NP_694802.2 transl_except : (pos:89624783..89624785,aa:Sec)

name	V1rb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716539 CCDS:CCDS20346.1 GeneID:113855 MGI:2148518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B7 protein_id : NP_444458.1

name	V1rb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716543 GeneID:113857 MGI:2148520
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A12 product : vomeronasal 1 receptor, B9 protein_id : NP_444460.1

name	V1ra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716529 GeneID:113848 MGI:2148511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RA10; vomeronasal receptor 1 A1; vomeronasal receptor 1 A3 product : vomeronasal 1 receptor, A6 protein_id : NP_444451.1

name	V1ra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716527 GeneID:113847 MGI:2148510
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A2 product : vomeronasal 1 receptor, A5 protein_id : NP_444450.1

name	V1rb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553592 GeneID:113854 MGI:2148517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A10; vomeronasal receptor V1RB11 product : vomeronasal 1 receptor, B4 protein_id : NP_444457.2

name	V1ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665736 GeneID:22297 MGI:1333762
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 2; vomeronasal 1, receptor 2; vomeronasal receptor V1RA11; vomeronasal receptor 1 A9 product : vomeronasal 1 receptor, A2 protein_id : NP_035814.2

name	V1rb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716541 CCDS:CCDS20348.1 GeneID:113856 MGI:2148519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B8 protein_id : NP_444459.1

name	V1ra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716525 CCDS:CCDS20349.1 GeneID:113846 MGI:2148509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor 1 A7 product : vomeronasal 1 receptor, A4 protein_id : NP_444449.1

name	V1ra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716523 CCDS:CCDS20350.1 GeneID:113845 MGI:2148508
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A3 protein_id : NP_444448.1

name	V1rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755951 CCDS:CCDS20351.1 GeneID:24112 MGI:1344384
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 5; vomeronasal organ family 1, receptor B2 product : vomeronasal 1, receptor B2 protein_id : NP_036041.1

name	V1rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716533 CCDS:CCDS20352.1 GeneID:113852 MGI:2148515
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A5 product : vomeronasal 1 receptor, B1 protein_id : NP_444455.1

name	LOC100043146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043146
definition	number : 1 pseudo : _no_value

name	LOC100043146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043146
definition	number : 2 pseudo : _no_value

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 2 pseudo : _no_value

name	LOC100043153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043153
definition	number : 1 pseudo : _no_value

name	LOC665547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665547
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:210532
definition	standard_name : RH136550

name	(CDS detail)
type	STS
link
xref	UniSTS:142652
definition	standard_name : RH125682

name	(CDS detail)
type	STS
link
xref	UniSTS:167498
definition	standard_name : D6Ertd71e

name	(CDS detail)
type	STS
link
xref	UniSTS:207991
definition	standard_name : AW546958

name	(CDS detail)
type	STS
link
xref	UniSTS:124773
definition	standard_name : D18356

name	(CDS detail)
type	STS
link
xref	UniSTS:207992
definition	standard_name : RH127177

name	(CDS detail)
type	STS
link
xref	UniSTS:254130
definition	standard_name : SRCR23H

name	(CDS detail)
type	STS
link
xref	UniSTS:144311
definition	standard_name : Rab7-ps1

name	(CDS detail)
type	STS
link
xref	UniSTS:270460
definition	standard_name : PMC124275P2

name	(CDS detail)
type	STS
link
xref	UniSTS:225345
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:167477
definition	standard_name : RH126941

name	(CDS detail)
type	STS
link
xref	UniSTS:144310
definition	standard_name : Rab7

name	(CDS detail)
type	STS
link
xref	UniSTS:210244
definition	standard_name : RH136250

name	(CDS detail)
type	STS
link
xref	UniSTS:142648
definition	standard_name : D6Wsu137e

name	(CDS detail)
type	STS
link
xref	UniSTS:130946
definition	standard_name : D6Mit40

name	(CDS detail)
type	STS
link
xref	UniSTS:273134
definition	standard_name : PMC327172P1

name	(CDS detail)
type	STS
link
xref	UniSTS:468005
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:270438
definition	standard_name : PMC123124P2

name	(CDS detail)
type	STS
link
xref	UniSTS:273367
definition	standard_name : PMC58532P1

name	(CDS detail)
type	STS
link
xref	UniSTS:464674
definition	standard_name : Gata2

name	(CDS detail)
type	STS
link
xref	UniSTS:159531
definition	standard_name : AB000096

name	(CDS detail)
type	STS
link
xref	UniSTS:159537
definition	standard_name : AI326313

name	(CDS detail)
type	STS
link
xref	UniSTS:123383
definition	standard_name : 18.MMHAP4FLF3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:123735
definition	standard_name : 26.MMHAP36FLA5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130772
definition	standard_name : D6Mit226

name	(CDS detail)
type	STS
link
xref	UniSTS:162635
definition	standard_name : RH125916

name	(CDS detail)
type	STS
link
xref	UniSTS:161530
definition	standard_name : RH124708

name	(CDS detail)
type	STS
link
xref	UniSTS:130810
definition	standard_name : D6Mit261.1

name	(CDS detail)
type	STS
link
xref	UniSTS:116324
definition	standard_name : D6Mit261

name	(CDS detail)
type	STS
link
xref	UniSTS:130732
definition	standard_name : D6Mit190

name	(CDS detail)
type	STS
link
xref	UniSTS:233942
definition	standard_name : Mgll

name	(CDS detail)
type	STS
link
xref	UniSTS:211734
definition	standard_name : RH128426

name	(CDS detail)
type	STS
link
xref	UniSTS:161784
definition	standard_name : RH124962

name	(CDS detail)
type	STS
link
xref	UniSTS:164332
definition	standard_name : AI847549

name	(CDS detail)
type	STS
link
xref	UniSTS:130918
definition	standard_name : D6Mit364

name	(CDS detail)
type	STS
link
xref	UniSTS:159540
definition	standard_name : AA959861

name	(CDS detail)
type	STS
link
xref	UniSTS:213930
definition	standard_name : RH130646

name	(CDS detail)
type	STS
link
xref	UniSTS:130812
definition	standard_name : D6Mit263

name	(CDS detail)
type	STS
link
xref	UniSTS:130797
definition	standard_name : D6Mit248

name	(CDS detail)
type	STS
link
xref	UniSTS:235493
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179412
definition	standard_name : AU023851

name	(CDS detail)
type	STS
link
xref	UniSTS:210429
definition	standard_name : RH136443

name	(CDS detail)
type	STS
link
xref	UniSTS:207993
definition	standard_name : RH127255

name	(CDS detail)
type	STS
link
xref	UniSTS:179413
definition	standard_name : AU018164

name	(CDS detail)
type	STS
link
xref	UniSTS:235489
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179414
definition	standard_name : AU024342

name	(CDS detail)
type	STS
link
xref	UniSTS:125271
definition	standard_name : MHAa67d2.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:207994
definition	standard_name : AU014819

name	(CDS detail)
type	STS
link
xref	UniSTS:272923
definition	standard_name : PMC313053P1

name	(CDS detail)
type	STS
link
xref	UniSTS:130879
definition	standard_name : D6Mit325

name	(CDS detail)
type	STS
link
xref	UniSTS:159541
definition	standard_name : AI196535

name	(CDS detail)
type	STS
link
xref	UniSTS:495550
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495554
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494016
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493164
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490656
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490617
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490615
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493151
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493936
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490596
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490616
definition

name	LOC665416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255235 GeneID:665416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : similar to Rps19 protein pseudo : _no_value transcript_id : XR_034267.1

clone name	MSMg01-451O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-111P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-454A24.T7 (MSMg01no454_a24.b1)	MSMg01-454A24.TJ (MSMg01no454_a24.g1)
ACC	AG540928	AG540929
length	785	768
length of high quality (start - end)	409 (69 - 477)	282 (76 - 357)
definition	CHROMAT_FILE: MSMg01no454_a24.b1 PHD_FILE: MSMg01no454_a24.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:25:08 2005	CHROMAT_FILE: MSMg01no454_a24.g1 PHD_FILE: MSMg01no454_a24.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:25:08 2005
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(89,069,424 - 89,069,832)	(88,855,795 - 88,856,076)
sequence	NGTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCCCTGCTTTTCTCACAAGGCTGCCCCACTTCCGGTTCCAACTGCA GGTCTCATGTCCTAGGCTCCTTGCCACTCATCTGACTATAGAGCAGGAGC CTGCAGCTTCTGTTCACATCAGAGGATTTTCTAGAATGTTCAGAGAACTC AGGGACACACTGTTTGGAGACTGAGTGGCTGTGAAGGCTTGAAATGGGTA GTCTGAGGAGGCACACAGGCAAGTACAGGAAGGGTCCCAAGCTCTGTGCT CATGGCACTTGGGATGTCCCATCCTCCTGGCATGTTGATGCCCTTCCCCA GCCTATATAATCCCTTAACATCTTCAGTCAGGCTCCATTAGATAATTGTG ATTAACTACAACACTGGCCATGGTGATATCTGCCCAGCTCTTACTTCAAG GTCCAGGAAGGCTGCCAGAACTCCAACCCTCCAGTCACATGGCTAGTTCC CCTGACAACTAGGAACACCCACTGAAATAGTCTAAGGTCATTTTGTTTTA TAAGAAAAACTCAAATTTTTTTTTTGAGTTATTTATTACCAAACCCAAGT ACCCTGGTGCTGAATTCCCAATGCCCCCAAAAAGGGGGGCCGAACCCCTT ATTGGGGGTGTTGGATCCCCATCGGGGGGGTTTTGTTTCGAACTTTCTAT TTATCCCTTAACTCCTTTTTTTTTTAATCTGGAGGACCCCTTTTCTCTCC CTTTATTATGGGGTTCAAAAATATTTTTTTGCGGG	GGACATGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXAGCCTTAACTGGGACACAAGGCCAT GGTAACTAGATAGAGGACTGCACTGTTTCGTTTGGCTGTGGAAGCAGCCT TGGGCATTCATGGAGAGACCTACTTCTATCTCATGGTCTAACATGGCTGC TCTTGTTCCTATCGGCACATCAGTATTCCGGCTGACAGGAAGGAAGAAGG GCACGACCTGAAGCTGGCGAGTTGCACTCTGTTGGTGTCCTTGTGGCCAG TCCCTCCTTCAGGGGAATCTGGAGAAAGCAGACTGAAATCCCGGGTTCTG CTGGTAAGACGTGTGGCTCCTGTAGACTTGTCTGCGCTCTGTTCCCATCA TAGTGAACCACTCCACTGTCTTCTCAGCCCTTATCCCTAGCAGAACTTTG CTTTTTTAAGTACAAAGGTTTGTGTCTTTTTACTCCCACCCCCATCCTTG TGATGATATCCGCCTGAAACGAATCCTTGGGTTGCCCTGGCCCCCCCTTT TCCTTATTCTTTCAGCGAGCGGTCGCGTATATCCCACTTTTTTTTTCCTT TTTTTGCGCTCTCTTTTATTTTCCATCTCCATCGTCGTCTCTTTTTTTCT TTTCTTTCCGCCGTCCCTTTCCCCTCTACACTTTGTTCCCCCCTTTTCTA TCCTCCCCTCTTCACCACTTTATTTTTTTTTTCTTTTTCCCCCCCCCGTT TTTTTTTTTTCTCTCTCC
quality values	Open. Hide. 0 3 6 8 8 8 8 8 14 13 25 15 16 18 16 16 19 28 23 20 20 24 25 30 44 48 28 28 24 20 20 15 23 9 9 9 14 9 10 10 15 14 16 16 14 12 15 15 30 28 36 36 31 31 39 33 59 41 23 21 9 9 9 12 12 10 10 10 21 21 37 33 33 43 43 43 43 57 36 36 36 37 37 42 59 59 59 59 59 59 50 50 42 42 42 47 51 51 43 43 43 50 57 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 50 50 50 50 50 50 68 68 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 57 57 59 59 59 59 57 57 59 59 68 68 59 59 59 57 57 59 59 59 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 43 52 52 52 52 59 59 59 68 68 68 68 68 68 57 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 59 68 68 68 68 68 68 68 68 59 59 59 48 48 57 57 57 57 57 57 48 48 54 57 59 59 57 54 54 54 57 57 59 59 47 35 35 43 43 57 57 57 50 48 47 47 47 47 47 50 57 57 57 57 48 57 48 48 48 50 41 43 41 41 41 41 39 39 36 43 39 37 37 46 46 41 43 36 36 36 36 37 36 39 39 39 37 37 36 35 22 28 26 28 28 27 30 33 30 33 37 41 39 34 31 29 26 32 32 37 31 28 32 32 29 29 32 22 25 14 14 14 21 24 37 24 18 14 14 14 19 21 33 30 37 22 25 12 16 11 16 12 21 11 13 11 19 11 15 16 13 13 11 8 8 8 8 8 9 19 12 16 15 12 10 10 10 10 20 12 12 11 12 11 10 10 9 9 12 10 10 10 10 12 13 17 13 14 8 8 8 8 8 17 8 9 8 8 7 7 7 8 8 9 8 9 9 9 8 8 8 8 8 7 9 9 9 15 14 6 6 6 6 6 8 8 10 15 15 16 13 10 10 10 11 11 6 6 7 6 8 8 14 17 10 8 10 8 8 8 8 8 8 8 8 8 8 10 8 8 10 10 9 9 11 7 9 9 9 9 9 11 9 13 10 13 13 22 19 19 19 18 12 11 10 10 10 9 10 10 9 8 8 12 10 8 8 8 10 8 10 11 11 8 6 6 8 8 8 8 8 8 10 12 13 10 10 10 11 9 12 11 12 12 9 9 12 10 12 12 12 12 14 10 10 10 10 10 8 8 8 8 8 8 8 8 10 8 8 6 6 6 8 8 8 8 9 10 10 10 10 10 17 17 23 23 19 16 10 11 8 6 6 8 8 8 10 8 8 8 6 6 8 8 15 15 10 10 10 9 9 9 8 10 8 8 8 15 12 11 8 8 8 8 8 8 8 8 8 8 10 8 9 10 15 10 10 10 8 8 8 12 12 9 8 8 8 8 8 8 8	Open. Hide. 6 6 6 6 12 19 10 8 6 6 8 17 17 14 9 9 12 23 23 39 43 41 38 32 30 32 29 41 37 25 25 12 9 6 6 8 6 6 6 9 10 17 17 27 24 30 37 37 36 33 33 33 33 33 50 42 30 25 15 12 7 7 8 8 10 8 12 12 20 15 22 33 33 30 30 30 32 35 57 59 59 48 48 48 44 53 47 43 43 47 47 50 50 43 43 47 47 43 47 47 47 68 68 57 57 57 57 54 54 54 54 54 57 59 57 48 48 48 57 57 40 43 43 59 47 59 59 57 57 57 57 57 57 57 54 57 57 57 57 57 57 57 57 59 59 59 57 57 57 59 59 59 57 57 57 68 68 68 68 68 57 57 52 52 52 50 50 50 50 50 50 59 68 68 68 68 68 68 68 68 68 68 59 59 57 59 59 59 59 57 57 57 57 57 57 54 54 54 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 57 57 57 57 57 48 57 57 57 68 57 57 57 48 43 43 39 39 43 57 57 68 68 68 68 68 68 57 57 57 57 68 68 57 57 59 54 54 57 57 57 57 57 57 59 54 59 59 59 59 59 57 57 57 59 59 59 59 43 43 43 43 44 57 43 43 40 43 43 59 59 59 47 47 37 37 37 36 26 22 15 12 12 12 12 11 11 9 12 23 30 47 41 41 44 43 43 47 47 57 48 48 57 57 57 57 59 40 35 35 59 59 57 57 48 48 37 37 23 18 16 22 12 17 19 22 23 18 16 19 12 14 14 22 19 15 8 8 8 11 13 34 34 41 46 48 43 43 43 43 43 39 39 28 28 14 28 28 30 30 39 36 36 43 34 37 28 28 28 21 28 12 12 11 21 20 32 26 19 19 26 22 14 14 18 30 28 37 29 24 17 20 17 20 25 27 20 20 20 28 31 32 26 13 11 10 10 8 8 8 13 15 20 33 28 28 32 37 37 30 24 10 8 8 8 8 10 10 11 11 11 12 12 11 12 14 21 12 9 9 13 12 10 8 10 8 8 8 8 10 13 11 12 10 11 11 15 13 13 13 15 19 13 15 6 6 8 8 8 8 7 8 8 8 8 8 9 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 9 8 8 6 6 8 12 14 14 14 18 18 17 12 15 16 16 14 14 19 20 15 13 10 9 11 10 13 9 11 18 21 10 10 9 9 9 9 10 10 9 9 10 10 8 8 8 8 8 8 6 6 8 8 11 9 9 10 13 10 9 8 10 8 10 10 12 12 12 12 14 11 10 10 10 8 8 8 8 8 10 10 10 15 13 9 9 9 9 9 13 12 9 9 8 8 8 8 11 8 8 10 8 7 9 9 11 13 13 9 9 8 8 8 8 10 19 10 8 8 8 10 10 10 8 8 10 8 11 8 8 6 6 6 8 8 13 10 10 11 11 18 11 11 10 10 10 9 8 8 6 6 8 8 8 10 11 12 12 13 15 11 9 10 9 9 10 8 12 6 6 8 8 10 9 9 9 10 13 15 15 14 14 17 15 25 10 10 9 8 12 12 14 14 19 17 17 19 14 15 15 19 16 21 21 20 19 13 12 15 18 25 25 19 24 15 15 8 8 8 15 11 16 16 18 30 33 33 20 13 15 9 9 9 15 8 10 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no454_a24.b1 MSMg01no454_a24.b1 CHROMAT_FILE:
MSMg01no454_a24.b1 PHD_FILE: MSMg01no454_a24.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:25:08 2005
         (409 letters)



>mm_chr6_89069224_89070032
          Length = 809

 Score =  760 bits (393), Expect = 0.0
 Identities = 405/409 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   acaaggctgccccacttccggttccaactgcaggtctcatgtcctaggctccttgccact 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 609 acaaggctgccccacttccggttccaactgcaggtctcatgtcctaggctccttgccact 550

                                                                       
Query: 61  catctgactatagagcaggagcctgcagcttctgttcacatcagaggattttctagaatg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 549 catctgactatagagcaggagcctgcagcttctgttcacatcagaggattttctagaatg 490

                                                                       
Query: 121 ttcagagaactcagggacacactgtttggagactgagtggctgtgaaggcttgaaatggg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 489 ttcagagaactcagggacacactgtttggagactgagtggctgtgaaggcttgaaatggg 430

                                                                       
Query: 181 tagtctgaggaggcacacaggcaagtacaggaagggtcccaagctctgtgctcatggcac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 429 tagtctgaggaggcacacaggcaagtacaggaagggtcccaagctctgtgctcatggcac 370

                                                                       
Query: 241 ttgggatgtcccatcctcctggcatgttgatgcccttccccagcctatataatcccttaa 300
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 369 ttggggtgtcccatcctcctggcatgttgatgcccttccccagcctatataatcccttaa 310

                                                                       
Query: 301 catcttcagtcaggctccattagataattgtgattaactacaacactggccatggtgata 360
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 309 catcttcagtcaggctccattagataattgtgactaactacaacactggccatggtgata 250

                                                            
Query: 361 tctgcccagctcttacttcaaggtccaggaaggctgccagaactccaac 409
           |||||||||||||| ||||||||||||||||||||| ||||||||||||
Sbjct: 249 tctgcccagctctttcttcaaggtccaggaaggctggcagaactccaac 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 409
Length of database: 809
Length adjustment: 9
Effective length of query: 400
Effective length of database: 800
Effective search space:   320000
Effective search space used:   320000
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

Query= MSMg01no454_a24.g1 MSMg01no454_a24.g1 CHROMAT_FILE:
MSMg01no454_a24.g1 PHD_FILE: MSMg01no454_a24.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:25:08 2005
         (282 letters)



>mm_chr6_88855595_88856276
          Length = 682

 Score =  538 bits (278), Expect = e-157
 Identities = 281/282 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   agccttaactgggacacaaggccatggtaactagatagaggactgcactgtttcgtttgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agccttaactgggacacaaggccatggtaactagatagaggactgcactgtttcgtttgg 260

                                                                       
Query: 61  ctgtggaagcagccttgggcattcatggagagacctacttctatctcatggtctaacatg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 ctgtggaagcagccttgggcattcatggagagacctacttctatctcatggtctaacatg 320

                                                                       
Query: 121 gctgctcttgttcctatcggcacatcagtattccggctgacaggaaggaagaagggcacg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 gctgctcttgttcctatcggcacatcagtattccggctgacaggaaggaagaagggcacg 380

                                                                       
Query: 181 acctgaagctggcgagttgcactctgttggtgtccttgtggccagtccctccttcagggg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 acctgaagctggcgagttgcactctgttggtgtccttgtggccagtccctccttcagggg 440

                                                     
Query: 241 aatctggagaaagcagactgaaatcccgggttctgctggtaa 282
           || |||||||||||||||||||||||||||||||||||||||
Sbjct: 441 aagctggagaaagcagactgaaatcccgggttctgctggtaa 482


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 282
Length of database: 682
Length adjustment: 9
Effective length of query: 273
Effective length of database: 673
Effective search space:   183729
Effective search space used:   183729
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information