MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-483O13
Chromosome	6 (Build37)
Map Location	90,637,675 - 90,638,051
singlet/doublet	singlet
Overlap gene	Iqsec1
Upstream gene	V1r-ps1, V1rb7, V1rb9, V1r-ps2, V1r-ps3, V1ra6, V1ra5, V1rb4, V1r-ps4, V1ra2, V1rb8, V1ra4, V1ra3, V1rb2, V1rb1, V1ra1, LOC625050, V1ra7, V1ra8, V1rb3, LOC100043191, V1r-ps5, V1ra9, BC048671, Chst13, Uroc1, Zxdc, Ccdc37, Klf15, Aldh1l1, Slc41a3
Downstream gene	LOC100043646, EG665685, Nup210, Hdac11, Fbln2, LOC665716, Wnt7a, LOC100043659, LOC625420, Chchd4, Tmem43, Xpc, Lsm3, Slc6a6
Link	Open Mouse BAC browser

Click to get alignment info.

name	V1r-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113869 MGI:2148531
definition	note : vomeronasal 1 receptor, pseudogene 1 pseudo : _no_value

name	V1rb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1r-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113870 MGI:2148532
definition	note : vomeronasal 1 receptor, pseudogene 2 pseudo : _no_value

name	V1r-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113871 MGI:2148533
definition	note : vomeronasal 1 receptor, pseudogene 3 pseudo : _no_value

name	V1ra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	V1r-ps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113872 MGI:2148534
definition	gene_synonym : V1RB3 note : vomeronasal 1 receptor, pseudogene 4 pseudo : _no_value

name	V1ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113846 MGI:2148509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins pseudo : _no_value

name	V1ra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1ra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113853 MGI:2148516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1r-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113873 MGI:2148535
definition	note : vomeronasal 1 receptor, pseudogene 5 pseudo : _no_value

name	V1ra9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins

name	Uroc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243537 MGI:2385332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zxdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ccdc37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	Klf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107747 MGI:1340024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71699 MGI:1918949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Iqsec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins

name	LOC100043646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins

name	EG665685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins pseudo : _no_value

name	Nup210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54563 MGI:1859555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232232 MGI:2385252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 3 Proteins pseudo : _no_value

name	Wnt7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22421 MGI:98961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 mRNAs, 2548 ESTs, 23 Proteins pseudo : _no_value

name	LOC625420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Chchd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72170 MGI:1919420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74122 MGI:1921372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22591 MGI:103557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67678 MGI:1914928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21366 MGI:98488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716538 GeneID:113855 MGI:2148518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B7 transcript_id : NM_053228.1

name	V1rb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716542 GeneID:113857 MGI:2148520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B9 transcript_id : NM_053230.1

name	V1ra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716528 GeneID:113848 MGI:2148511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A6 transcript_id : NM_053221.1

name	V1ra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716526 GeneID:113847 MGI:2148510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A5 transcript_id : NM_053220.1

name	V1rb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553591 GeneID:113854 MGI:2148517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs product : vomeronasal 1 receptor, B4 transcript_id : NM_053227.2

name	V1ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665735 GeneID:22297 MGI:1333762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A2 transcript_id : NM_011684.2

name	V1rb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716540 GeneID:113856 MGI:2148519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B8 transcript_id : NM_053229.1

name	V1ra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716524 GeneID:113846 MGI:2148509
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A4 transcript_id : NM_053219.1

name	V1ra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716522 GeneID:113845 MGI:2148508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A3 transcript_id : NM_053218.1

name	V1rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755950 GeneID:24112 MGI:1344384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1, receptor B2 transcript_id : NM_011911.1

name	V1rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716532 GeneID:113852 MGI:2148515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B1 transcript_id : NM_053225.1

name	V1ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949776 GeneID:22296 MGI:1333759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A1 transcript_id : NM_011683.2

name	V1ra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361225 GeneID:113849 MGI:2148512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A7 transcript_id : NM_053222.1

name	V1ra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361227 GeneID:113850 MGI:2148513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A8 transcript_id : NM_053223.1

name	V1rb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716534 GeneID:113853 MGI:2148516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B3 transcript_id : NM_053226.1

name	V1ra9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716530 GeneID:113851 MGI:2148514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, A9 transcript_id : NM_053224.1

name	BC048671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802476 GeneID:243535 MGI:2679261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048671 transcript_id : NM_177738.2

name	Chst13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377995 GeneID:71797 MGI:1919047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 19 Proteins product : carbohydrate (chondroitin 4) sulfotransferase 13 transcript_id : XM_978459.1

name	Uroc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450100 GeneID:243537 MGI:2385332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocanase domain containing 1 transcript_id : NM_144940.1

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381340 GeneID:80292 MGI:1933108
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_030260.2

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802546 GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_173002.2

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255366 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : coiled-coil domain containing 37, transcript variant 2 transcript_id : XM_001480392.1

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255364 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : coiled-coil domain containing 37, transcript variant 1 transcript_id : XM_001480389.1

name	Klf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130317 GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 15 transcript_id : NM_023184.3

name	Aldh1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532958 GeneID:107747 MGI:1340024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member L1 transcript_id : NM_027406.1

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734230 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_027868.2

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734224 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_001037493.1

name	Iqsec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255368 GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins product : IQ motif and Sec7 domain 1 transcript_id : XM_001480423.1

name	LOC100043646 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255370 GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480428.1

name	Nup210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055313 GeneID:54563 MGI:1859555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 210 transcript_id : NM_018815.1

name	Hdac11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130074 GeneID:232232 MGI:2385252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 11 transcript_id : NM_144919.2

name	Fbln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517703 GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibulin 2 transcript_id : NM_007992.2

name	Fbln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517692 GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibulin 2 transcript_id : NM_001081437.1

name	Wnt7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227223 GeneID:22421 MGI:98961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 7A transcript_id : NM_009527.3

name	LOC625420 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255247 GeneID:625420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : hypothetical LOC625420 transcript_id : XM_001479774.1

name	Chchd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129894 GeneID:72170 MGI:1919420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 4 transcript_id : NM_133928.2

name	Tmem43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801819 GeneID:74122 MGI:1921372
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 43 transcript_id : NM_028766.2

name	Xpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247428 GeneID:22591 MGI:103557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xeroderma pigmentosum, complementation group C transcript_id : NM_009531.2

name	Lsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802858 GeneID:67678 MGI:1914928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_026309.2

name	Slc6a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328477 GeneID:21366 MGI:98488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, taurine), member 6 transcript_id : NM_009320.3

name	V1rb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716539 CCDS:CCDS20346.1 GeneID:113855 MGI:2148518
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B7 protein_id : NP_444458.1

name	V1rb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716543 GeneID:113857 MGI:2148520
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A12 product : vomeronasal 1 receptor, B9 protein_id : NP_444460.1

name	V1ra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716529 GeneID:113848 MGI:2148511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RA10; vomeronasal receptor 1 A1; vomeronasal receptor 1 A3 product : vomeronasal 1 receptor, A6 protein_id : NP_444451.1

name	V1ra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716527 GeneID:113847 MGI:2148510
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A2 product : vomeronasal 1 receptor, A5 protein_id : NP_444450.1

name	V1rb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553592 GeneID:113854 MGI:2148517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A10; vomeronasal receptor V1RB11 product : vomeronasal 1 receptor, B4 protein_id : NP_444457.2

name	V1ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665736 GeneID:22297 MGI:1333762
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 2; vomeronasal 1, receptor 2; vomeronasal receptor V1RA11; vomeronasal receptor 1 A9 product : vomeronasal 1 receptor, A2 protein_id : NP_035814.2

name	V1rb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716541 CCDS:CCDS20348.1 GeneID:113856 MGI:2148519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B8 protein_id : NP_444459.1

name	V1ra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716525 CCDS:CCDS20349.1 GeneID:113846 MGI:2148509
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor 1 A7 product : vomeronasal 1 receptor, A4 protein_id : NP_444449.1

name	V1ra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716523 CCDS:CCDS20350.1 GeneID:113845 MGI:2148508
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A3 protein_id : NP_444448.1

name	V1rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755951 CCDS:CCDS20351.1 GeneID:24112 MGI:1344384
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 5; vomeronasal organ family 1, receptor B2 product : vomeronasal 1, receptor B2 protein_id : NP_036041.1

name	V1rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716533 CCDS:CCDS20352.1 GeneID:113852 MGI:2148515
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal receptor 1 A5 product : vomeronasal 1 receptor, B1 protein_id : NP_444455.1

name	V1ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949777 GeneID:22296 MGI:1333759
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : vomeronasal organ family 1, receptor 1; vomeronasal 1, receptor 1; vomeronasal receptor V1RA1 product : vomeronasal 1 receptor, A1 protein_id : NP_035813.2

name	V1ra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361226 CCDS:CCDS20353.1 GeneID:113849 MGI:2148512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A7 protein_id : NP_444452.1

name	V1ra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361228 CCDS:CCDS20354.1 GeneID:113850 MGI:2148513
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A8 protein_id : NP_444453.1

name	V1rb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716535 CCDS:CCDS20355.1 GeneID:113853 MGI:2148516
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, B3 protein_id : NP_444456.1

name	V1ra9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716531 CCDS:CCDS20356.1 GeneID:113851 MGI:2148514
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, A9 protein_id : NP_444454.1

name	BC048671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244226 CCDS:CCDS20357.1 GeneID:243535 MGI:2679261
definition	codon_start : 1 product : hypothetical protein LOC243535 protein_id : NP_808406.1

name	Chst13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377996 GeneID:71797 MGI:1919047
definition	codon_start : 1 product : carbohydrate (chondroitin 4) sulfotransferase 13 protein_id : XP_983553.1

name	Uroc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450101 GeneID:243537 MGI:2385332
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016153 - urocanate hydratase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence IEA]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : urocanase domain containing 1 protein_id : NP_659189.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370506 CCDS:CCDS20358.1 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ZXD family zinc finger C isoform 2 protein_id : NP_766590.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385100 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : ZXD family zinc finger C isoform 1 protein_id : NP_084536.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255365 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 1 protein_id : XP_001480439.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255367 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 2 protein_id : XP_001480442.1

name	Klf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963561 CCDS:CCDS20360.1 GeneID:66277 MGI:1929988
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Kruppel-like factor 15 protein_id : NP_075673.1

name	Aldh1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532959 CCDS:CCDS20361.1 GeneID:107747 MGI:1340024
definition	EC_number : 1.5.1.6 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0016155 - formyltetrahydrofolate dehydrogenase activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009258 - 10-formyltetrahydrofolate catabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : formyltetrahydrofolate dehydrogenase product : aldehyde dehydrogenase 1 family, member L1 protein_id : NP_081682.1

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734231 CCDS:CCDS20362.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : solute carrier family 41, member 3 isoform 1 protein_id : NP_082144.2

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734225 CCDS:CCDS20363.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : solute carrier family 41, member 3 isoform 2 protein_id : NP_001032570.1

name	Iqsec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255369 GeneID:232227 MGI:1196356
definition	codon_start : 1 product : IQ motif and Sec7 domain 1 protein_id : XP_001480473.1

name	LOC100043646 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255371 GeneID:100043646
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480478.1

name	Nup210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055314 GeneID:54563 MGI:1859555
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005643 - nuclear pore [Evidence ISS] [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear pore membrane glycoprotein 210; nuclear pore membrane protein 210 product : nucleoporin 210 protein_id : NP_061285.1

name	Hdac11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450317 CCDS:CCDS20366.1 GeneID:232232 MGI:2385252
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 11 protein_id : NP_659168.1

name	Fbln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517704 GeneID:14115 MGI:95488
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : fibulin 2 isoform a protein_id : NP_032018.2

name	Fbln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517693 GeneID:14115 MGI:95488
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : fibulin 2 isoform b protein_id : NP_001074906.1

name	Wnt7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543960 GeneID:22421 MGI:98961
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0035115 - embryonic forelimb morphogenesis [Evidence IGI]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IGI]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : postaxial hemimelia product : wingless-related MMTV integration site 7A protein_id : NP_033553.2

name	LOC625420 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255248 GeneID:625420
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479824.1

name	Chchd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527144 CCDS:CCDS20367.1 GeneID:72170 MGI:1919420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 4 protein_id : NP_598689.1

name	Tmem43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311891 CCDS:CCDS20368.1 GeneID:74122 MGI:1921372
definition	codon_start : 1 product : transmembrane protein 43 protein_id : NP_083042.1

name	Xpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247429 GeneID:22591 MGI:103557
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0031573 - intra-S DNA damage checkpoint [Evidence IGI]; GO:0006289 - nucleotide-excision repair [Evidence IEA] [Evidence IMP] [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : xeroderma pigmentosum, complementation group C protein_id : NP_033557.2

name	Lsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385806 CCDS:CCDS20369.1 GeneID:67678 MGI:1914928
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0030629 - U6 snRNA 3'-end binding [Evidence ISS] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006374 - nuclear mRNA splicing via U2-type spliceosome [Evidence ISS]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM3 homolog, U6 small nuclear RNA associated protein_id : NP_080585.1

name	LOC100043191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043191
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:495550
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488212
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495554
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494016
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493164
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:122950
definition	standard_name : 08.MMHAP84FRC8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490656
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488211
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490617
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490615
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493151
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493936
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490596
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490616
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494013
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130773
definition	standard_name : D6Mit227

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494231
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491536
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489262
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494014
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493163
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:124619
definition	standard_name : 46.MMHAP25FRH10.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:495549
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493167
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130675
definition	standard_name : D6Mit131

name	(CDS detail)
type	STS
link
xref	UniSTS:159545
definition	standard_name : AI265605

name	(CDS detail)
type	STS
link
xref	UniSTS:207998
definition	standard_name : BE136473

name	(CDS detail)
type	STS
link
xref	UniSTS:235501
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179418
definition	standard_name : AW048498

name	(CDS detail)
type	STS
link
xref	UniSTS:222798
definition	standard_name : RH140732

name	(CDS detail)
type	STS
link
xref	UniSTS:468007
definition	standard_name : Klf15

name	(CDS detail)
type	STS
link
xref	UniSTS:179415
definition	standard_name : AW494632

name	(CDS detail)
type	STS
link
xref	UniSTS:164331
definition	standard_name : AV048136

name	(CDS detail)
type	STS
link
xref	UniSTS:130674
definition	standard_name : D6Mit130

name	(CDS detail)
type	STS
link
xref	UniSTS:130917
definition	standard_name : D6Mit363

name	(CDS detail)
type	STS
link
xref	UniSTS:207995
definition	standard_name : AU022697

name	(CDS detail)
type	STS
link
xref	UniSTS:180580
definition	standard_name : AU024588

name	(CDS detail)
type	STS
link
xref	UniSTS:165477
definition	standard_name : AI480742

name	(CDS detail)
type	STS
link
xref	UniSTS:167478
definition	standard_name : RH127019

name	(CDS detail)
type	STS
link
xref	UniSTS:235495
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235497
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207997
definition	standard_name : RH127108

name	(CDS detail)
type	STS
link
xref	UniSTS:130775
definition	standard_name : D6Mit229

name	(CDS detail)
type	STS
link
xref	UniSTS:162834
definition	standard_name : RH126122

name	(CDS detail)
type	STS
link
xref	UniSTS:179419
definition	standard_name : AI836801

name	(CDS detail)
type	STS
link
xref	UniSTS:224278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235496
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159544
definition	standard_name : X75285

name	(CDS detail)
type	STS
link
xref	UniSTS:165478
definition	standard_name : AI849442

name	(CDS detail)
type	STS
link
xref	UniSTS:207996
definition	standard_name : BB445750

name	(CDS detail)
type	STS
link
xref	UniSTS:246359
definition	standard_name : BE106651

name	(CDS detail)
type	STS
link
xref	UniSTS:144783
definition	standard_name : Wnt7a

name	(CDS detail)
type	STS
link
xref	UniSTS:235498
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235499
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235500
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:132118
definition	standard_name : DXMit227

name	LOC625050 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255359 GeneID:625050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 52 Proteins product : similar to vomeronasal receptor V1RA11 pseudo : _no_value transcript_id : XR_034665.1

name	EG665685 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255372 GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins product : predicted gene, EG665685 pseudo : _no_value transcript_id : XR_001769.2

name	LOC665716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255377 GeneID:665716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 3 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034701.1

name	LOC100043659 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255378 GeneID:100043659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 mRNAs, 2548 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034702.1

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-111P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-483O13.T7 (MSMg01no483_o13.b1)	MSMg01-483O13.TJ (MSMg01no483_o13.g1)
ACC	AG563724	AG563725
length	771	772
length of high quality (start - end)	377 (324 - 700)	639 (78 - 716)
definition	CHROMAT_FILE: MSMg01no483_o13.b1 PHD_FILE: MSMg01no483_o13.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:05:17 2005	CHROMAT_FILE: MSMg01no483_o13.g1 PHD_FILE: MSMg01no483_o13.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:05:17 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NTTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGC GGAATTCCACTTACCAGAAGATGGGACAGNCCATATAGTGTCATGCTTCC AGAGACATAAAGAGGCTGAACCAATGGCCAAATAAATAGGGCCCACTAGC CAGCCAGCCTAGCTAAATCACTGACTTCCAGGGTTAGAGACTCCAGCCCA GAGAGTAAGATGAAGAATGCAAGAGGACACATGACATCAACCCCTGGTCC TTACCCCATGTGGCACACAGGAATGAAGGACCATATAAGTAGCAAGCAAG ACTTTCAACAGCCAGCCTTTATGAAGTCCTAGGTCAAAGTCATCTAGCAC AGGCCAAAAGTGATGACAGGCAGGTCAAGTAATAGCAATGCATATGTTTG TCCTTGTACCCCCCATGTACCAAGCTTGCATGCTTACAGTCTGGAAGGTG GCGACATCAGTACCAGCCTTGTTTCACAGATGTGAAAAACACAAAATAGG CCCACAGACAAAAAGACCTGGATAGACTTGGGGAGACAGTTCAGTCATCA AAGAGCTTGCTACATAATTACAGGGACCTGAGTTTGATGCTCAGCATCCA TGCAAAAAGCCGACCATCCCAGTCTTGGGGAGGCAGAAACAGGAGGACTA ACCCTAACCCTAACCCTACGGCTTACTAGCCAGCCAACCTAGCTGAATCA CTGACTTCAAGGGTTAGTTAGAGACCCTATCTCAAACATAAGGTGAAGAA TGATAGAAGACAAGTAGGACT	ACGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXTCACCAGAGGAATACCGAATGGC AGAGAAGCACTTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGC AAATCAAAACAACCCTGAGATTCCACCTCACACCAGTCAGAATGGCTAAG ATCAAAAATTCAGGTGACAGCAGATGCTGGCGTGGATGTGGAGAAAGAGG AACACTCCTCCATTGTTGGTGGGAGTGCAGGCTTGTACAACCACTCTGGA AATCAGTCTGGCGGTTCCTCAGAAAACTGGACATAGTACTACCGGAGGAT CCAGCAATATCTCTCCTGGGCATATATCCAGAAGATGCCCCAACAGGTAA GAAGGACACATGCTCCACTATGTTCATAGCAGCCTTATTTATAATAGCCA GAAGCTGGAAAGAACCTAGATGCCCCTCAACAGAGGAATGGATACAGAAA ATGTGGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGA ATTTATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGA GTGAGGTAACACATTCACAAAGAAACTCACACAATATGTATTCACTGATA AGTGGATATTAGCCCCAAACCTAGGATACCCAAGATATAAGATATAATTT GCTAAACACATGAAACTCAAGAAGAATGAAGACCGAAGTGTGGACACTAT GCCCCTCCTTAGATTTGGGAAN
quality values	Open. Hide. 0 3 6 6 8 8 13 13 21 24 28 41 34 29 29 28 23 23 30 21 19 8 8 8 21 21 43 25 16 19 9 9 6 7 7 6 6 6 12 10 11 11 15 15 10 10 10 16 33 44 50 31 31 31 31 33 21 19 8 6 6 6 6 6 6 9 6 7 8 8 8 8 17 19 37 37 23 23 3 0 3 27 27 44 41 47 50 59 59 41 53 53 53 53 53 59 57 53 53 50 50 50 53 53 53 53 53 53 53 59 59 41 31 30 23 23 18 28 14 13 13 13 13 14 28 28 39 42 47 47 50 50 53 53 57 57 57 57 57 59 59 57 57 57 57 57 57 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 54 54 54 54 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 57 57 57 57 57 57 57 57 57 57 57 54 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 57 57 57 57 50 50 53 53 53 53 53 50 59 59 59 59 28 28 11 10 9 9 9 19 21 47 59 59 59 59 59 59 59 59 57 57 57 57 57 53 57 53 53 53 53 57 57 59 53 50 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 53 53 50 50 50 50 41 34 25 12 12 9 6 6 6 6 7 6 9 9 16 12 19 29 41 59 59 59 59 59 53 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 43 43 30 28 28 27 28 32 31 39 44 46 57 57 57 54 48 48 57 59 59 59 57 57 57 57 57 57 59 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 43 43 37 19 14 14 14 14 17 28 34 36 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 54 54 54 54 57 54 54 54 59 59 59 59 57 57 57 57 57 59 59 59 57 57 54 47 47 57 57 57 57 68 68 59 59 59 59 57 57 57 57 54 54 54 57 59 68 57 57 54 48 48 48 48 54 57 57 57 48 54 54 59 59 57 57 47 47 47 57 57 57 57 57 54 57 59 54 54 48 59 59 57 57 50 48 48 37 37 28 33 33 47 47 43 43 43 43 43 48 48 48 59 59 43 43 43 47 59 43 43 43 47 43 43 43 43 40 40 40 39 41 41 38 32 32 32 37 37 39 40 40 40 40 59 59 59 48 48 48 48 37 37 30 39 37 39 37 43 40 43 37 39 35 35 39 59 40 39 35 31 19 25 15 18 18 25 32 59 59 40 39 37 37 35 11 9 9 9 9 18 19 32 32 36 37 41 32 30 31 30 30 25 30 34 31 31 34 34 30 30 25 22 20 32 28 22 20 22 22 29 39 34 34 34 34 35 37 36 26 22 16 16 20 32 31 33 30 23 24 19 12 14 10 10 10 11 19 31 28 34 31 30 30 34 23 20 15 15 15 16 15 22 17 16 16 13 14 11 11 11 17 18 22 22 11 13 11 10 10 9 12 12 11 10 13 13 14 19 16 19 16 12 9 9 10 9 10 16 14 18 15 12 9 9 9 10 11 11 11 15 10 10 6 6 7 13 12 10 10 10 17 14 12 11 12 11 11 7 8 6 6	Open. Hide. 6 6 10 15 15 10 8 8 8 8 21 25 37 37 37 37 31 31 44 39 39 47 47 50 50 50 42 41 44 27 25 9 10 10 10 9 9 14 12 14 12 19 18 22 18 21 15 22 35 39 53 47 41 41 37 37 42 34 25 10 8 6 6 7 6 6 6 15 25 39 39 31 31 31 31 33 36 53 50 50 50 53 53 53 42 53 37 37 37 37 42 42 57 50 50 68 68 68 68 53 53 50 50 57 59 68 68 68 68 68 68 68 68 68 57 57 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 48 48 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 52 44 44 39 39 17 17 23 39 39 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 59 57 57 57 52 52 52 57 57 57 57 68 68 68 68 68 68 68 68 68 59 59 59 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 68 68 57 57 57 52 52 52 59 59 68 57 57 57 57 57 57 57 57 68 57 57 57 57 57 59 57 57 59 59 59 59 59 57 54 54 57 59 59 59 59 59 59 59 48 48 48 57 59 57 57 57 57 57 59 59 57 57 57 57 57 54 57 57 57 57 59 54 54 59 59 59 57 54 54 54 54 54 57 57 57 68 68 57 57 50 50 48 48 48 48 43 43 36 36 36 25 25 25 34 34 48 50 50 47 42 42 41 39 39 39 32 36 38 39 39 39 46 46 46 48 48 48 48 48 48 43 43 43 43 36 43 43 43 43 43 43 43 48 40 41 39 39 32 32 32 26 29 37 41 37 37 43 39 39 35 30 25 30 28 33 33 36 43 59 48 48 48 37 37 30 30 30 37 37 39 37 37 36 41 41 31 31 35 39 41 34 34 25 25 29 30 34 28 24 24 34 31 31 37 37 31 31 35 37 35 30 31 28 28 28 34 28 33 33 32 32 28 30 14 23 23 37 37 41 37 36 39 36 36 36 37 32 35 35 37 36 36 14 9 9 9 9 15 15 19 17 17 30 20 18 16 14 15 19 19 22 19 30 17 22 20 25 20 24 21 21 13 13 13 24 28 20 20 20 28 28 37 32 28 18 27 13 12 12 11 11 11 12 11 11 14 14 27 29 22 9 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no483_o13.b1 MSMg01no483_o13.b1 CHROMAT_FILE:
MSMg01no483_o13.b1 PHD_FILE: MSMg01no483_o13.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:05:17 2005
         (377 letters)



>mm_chr6_90637475_90638251
          Length = 777

 Score =  659 bits (341), Expect = 0.0
 Identities = 368/377 (97%)
 Strand = Plus / Plus

                                                                       
Query: 1   aagtcctaggtcaaagtcatctagcacaggccaaaagtgatgacaggcaggtcaagtaat 60
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 201 aagtcctaggtcaaagtcatctagcacaggccaaaagtgacgacaggcaggtcaagtaat 260

                                                                       
Query: 61  agcaatgcatatgtttgtccttgtaccccccatgtaccaagcttgcatgcttacagtctg 120
           |||||||||||||||||||||||||| |  || |||||||||||||||||||||||||||
Sbjct: 261 agcaatgcatatgtttgtccttgtactcttcacgtaccaagcttgcatgcttacagtctg 320

                                                                       
Query: 121 gaaggtggcgacatcagtaccagccttgtttcacagatgtgaaaaacacaaaataggccc 180
           ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 321 gaaggaggcgacatcagtaccagccctgtttcacagatgtgaaaaacacaaaataggccc 380

                                                                       
Query: 181 acagacaaaaagacctggatagacttggggagacagttcagtcatcaaagagcttgctac 240
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 381 acagacaaaaagacctggataggcttggggagacagttcagtcatcaaagagcttgctac 440

                                                                       
Query: 241 ataattacagggacctgagtttgatgctcagcatccatgcaaaaagccgaccatcccagt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 ataattacagggacctgagtttgatgctcagcatccatgcaaaaagccgaccatcccagt 500

                                                                       
Query: 301 cttggggaggcagaaacaggaggactaaccctaaccctaaccctacggcttactagccag 360
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 cttggggaggcagaaacaagaggactaaccctaaccctaaccctacggcttactagccag 560

                            
Query: 361 ccaacctagctgaatca 377
           |||||||||||||||||
Sbjct: 561 ccaacctagctgaatca 577


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 377
Length of database: 777
Length adjustment: 9
Effective length of query: 368
Effective length of database: 768
Effective search space:   282624
Effective search space used:   282624
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information