MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-002H21
Chromosome	7 (Build37)
Map Location	112,489,072 - 112,490,197
singlet/doublet	singlet
Overlap gene	none
Upstream gene	9230105E10Rik, A530023O14Rik, EG434219, LOC100041595, Trim30, AI451617, LOC672495, LOC625305, EG625321, Olfr651, Olfr652, Olfr653, Olfr654, Olfr655, Olfr656, Olfr657, Olfr658, LOC667882, Olfr659, GA_x5J8B7W3SPQ-80592-80214, Olfr661, LOC625495, Olfr662-ps1, Olfr663, Olfr664, EG625530, LOC100042613, LOC233637, Dub1a, Dub1, Olfr665, Olfr666, Olfr667, Olfr668, Olfr669, EG545987, Olfr670, Olfr671, Olfr672, GA_x5J8B7W6B6J-189947-189022, Olfr674-ps1, Olfr675, Olfr676, Olfr677, LOC667987, Olfr678, Olfr679, Olfr680-ps1, Olfr681, Olfr682-ps1, Olfr683, Olfr684, Olfr685, Olfr686, EG668035, Olfr688, Olfr689, Olfr690, Olfr691
Downstream gene	Olfr692, EG545989, 4632419K20Rik, Cnga4, EG244189, Cckbr, Prkcdbp, Smpd1, Apbb1, Hpxn, Trim3, Arfip2, Fxc1, Dnhd1, LOC100042811, LOC672646, 1500003O22Rik, Ilk, Taf10, Tpp1, Dchs1, Mrpl17, 9130208D14Rik, LOC626055, LOC100042856, LOC100042047, EG668108, EG668117, Gvin1, LOC672660, LOC100042097, LOC668128
Link	Open Mouse BAC browser

Click to get alignment info.

name	9230105E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319236 MGI:2441735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530023O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100041595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	Trim30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20128 MGI:98178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI451617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209387 MGI:3035181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 13 Proteins pseudo : _no_value

name	LOC625305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins pseudo : _no_value

name	EG625321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625321 MGI:3643754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258809 MGI:3030485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr652 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259050 MGI:3030486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr653 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57250 MGI:3030487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258377 MGI:3030488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258817 MGI:3030489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr656 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259078 MGI:3030490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr657 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258309 MGI:3030491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr658 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259051 MGI:3030492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259052 MGI:3030493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3SPQ-80592-80214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257836
definition	note : olfactory receptor GA_x5J8B7W3SPQ-80592-80214 pseudo : _no_value

name	Olfr661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258743 MGI:3030495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr662-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404413 MGI:3030496
definition	gene_synonym : MOR34-13_p note : olfactory receptor 662, pseudogene 1 pseudo : _no_value

name	Olfr663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257914 MGI:3030497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr664 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667918 MGI:3030498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 161 Proteins

name	EG625530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625530 MGI:3643640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC233637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:233637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 60 ESTs, 8 Proteins

name	Dub1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381944 MGI:3051498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13531 MGI:107699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr665 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258810 MGI:3030499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr666 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259100 MGI:3030500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259062 MGI:3030501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259061 MGI:3030502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259045 MGI:3030503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545987 MGI:3643907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 5 Proteins

name	Olfr670 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384703 MGI:3030504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257910 MGI:3030505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258755 MGI:3030506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-189947-189022 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257774
definition	note : olfactory receptor GA_x5J8B7W6B6J-189947-189022 pseudo : _no_value

name	Olfr674-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258172 MGI:3030508
definition	gene_synonym : MOR32-7P note : olfactory receptor 674, pseudogene 1 pseudo : _no_value

name	Olfr675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258147 MGI:3030509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr676 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259099 MGI:3030510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr677 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258355 MGI:3030511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr678 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258753 MGI:3030512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr679 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259046 MGI:3030513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr680-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257981 MGI:3030514
definition	gene_synonym : MOR40-10P note : olfactory receptor 680, pseudogene 1 pseudo : _no_value

name	Olfr681 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404318 MGI:3030515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr682-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404415 MGI:3030516
definition	gene_synonym : MOR40-19_p note : olfactory receptor 682, pseudogene 1 pseudo : _no_value

name	Olfr683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259047 MGI:3030517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244187 MGI:3030518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258160 MGI:3030519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr686 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259072 MGI:3030520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668035 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668035 MGI:3643397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 Proteins

name	Olfr688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259161 MGI:3030522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258745 MGI:3030523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr690 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56860 MGI:3030524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr691 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259063 MGI:3030525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr692 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258352 MGI:3030526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545989 MGI:3643909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	4632419K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74349 MGI:1921599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnga4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233649 MGI:2664099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins pseudo : _no_value

name	Cckbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12426 MGI:99479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcdbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20597 MGI:98325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11785 MGI:107765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15458 MGI:105112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55992 MGI:1860040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arfip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76932 MGI:1924182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14356 MGI:1315196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77505 MGI:1924755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein

name	LOC100042811 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 2 Proteins

name	LOC672646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	1500003O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101867 MGI:1914251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ilk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16202 MGI:1195267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24075 MGI:1346320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12751 MGI:1336194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dchs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233651 MGI:2685011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 104 ESTs, 17 Proteins

name	Mrpl17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27397 MGI:1351608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130208D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77700 MGI:1924950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 3 Proteins

name	LOC626055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	LOC100042856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 113 ESTs, 4 Proteins

name	LOC100042047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668108 MGI:3703149
definition	note : predicted gene, EG668108 pseudo : _no_value

name	EG668117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Gvin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC672660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100042097 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668128
definition	note : very large inducible GTPase 1 pseudogene pseudo : _no_value

name	9230105E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982206 GeneID:319236 MGI:2441735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230105E10 gene transcript_id : NM_175677.3

name	A530023O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342270 GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530023O14 gene transcript_id : NM_175648.2

name	EG434219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257631 GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434219 transcript_id : XM_485980.4

name	Trim30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347378 GeneID:20128 MGI:98178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 30 transcript_id : NM_009099.2

name	AI451617 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255280 GeneID:209387 MGI:3035181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI451617 transcript_id : NM_199146.1

name	EG625321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348957 GeneID:625321 MGI:3643754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625321 transcript_id : NM_001037924.2

name	Olfr651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129230 GeneID:258809 MGI:3030485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 651 transcript_id : NM_146813.1

name	Olfr652 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128858 GeneID:259050 MGI:3030486
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 652 transcript_id : NM_147048.1

name	Olfr653 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203818 GeneID:57250 MGI:3030487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 653 transcript_id : NM_147074.1

name	Olfr654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129542 GeneID:258377 MGI:3030488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 654 transcript_id : NM_146379.1

name	Olfr655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129220 GeneID:258817 MGI:3030489
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 655 transcript_id : NM_146820.1

name	Olfr656 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128816 GeneID:259078 MGI:3030490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 656 transcript_id : NM_147075.1

name	Olfr657 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129666 GeneID:258309 MGI:3030491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 657 transcript_id : NM_146312.1

name	Olfr658 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801805 GeneID:259051 MGI:3030492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 658 transcript_id : NM_147049.3

name	Olfr659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128854 GeneID:259052 MGI:3030493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 659 transcript_id : NM_147050.1

name	Olfr661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128636 GeneID:258743 MGI:3030495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 661 transcript_id : NM_146748.1

name	Olfr663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801301 GeneID:257914 MGI:3030497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 663 transcript_id : NM_001011757.1

name	Olfr664 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257634 GeneID:667918 MGI:3030498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 161 Proteins product : olfactory receptor 664 transcript_id : XM_001476881.1

name	EG625530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380902 GeneID:625530 MGI:3643640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG625530 transcript_id : XM_890107.2

name	LOC100042613 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257657 GeneID:100042613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042613 transcript_id : XM_001478060.1

name	LOC233637 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257636 GeneID:233637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 60 ESTs, 8 Proteins product : similar to Twinfilin, actin-binding protein, homolog 1 (Drosophila) transcript_id : XM_001476895.1

name	Dub1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299770 GeneID:381944 MGI:3051498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 1a transcript_id : NM_201409.2

name	Dub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681236 GeneID:13531 MGI:107699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 1 transcript_id : NM_007887.1

name	Olfr665 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129232 GeneID:258810 MGI:3030499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 665 transcript_id : NM_146814.1

name	Olfr666 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128776 GeneID:259100 MGI:3030500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 666 transcript_id : NM_147096.1

name	Olfr667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529282 GeneID:259062 MGI:3030501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 667 transcript_id : NM_147060.2

name	Olfr668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128840 GeneID:259061 MGI:3030502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 668 transcript_id : NM_147059.1

name	Olfr669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203814 GeneID:259045 MGI:3030503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 669 transcript_id : NM_147043.1

name	EG545987 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380903 GeneID:545987 MGI:3643907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 5 Proteins product : predicted gene, EG545987, transcript variant 2 transcript_id : XM_899834.2

name	Olfr670 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261733 GeneID:384703 MGI:3030504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 670 transcript_id : NM_207146.1

name	Olfr671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801297 GeneID:257910 MGI:3030505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 671 transcript_id : NM_001011755.1

name	Olfr672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203786 GeneID:258755 MGI:3030506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 672 transcript_id : NM_146760.1

name	Olfr675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801453 GeneID:258147 MGI:3030509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 675 transcript_id : NM_001011848.1

name	Olfr676 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128774 GeneID:259099 MGI:3030510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 676 transcript_id : NM_147095.1

name	Olfr677 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129582 GeneID:258355 MGI:3030511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 677 transcript_id : NM_146358.1

name	Olfr678 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129332 GeneID:258753 MGI:3030512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 678 transcript_id : NM_146758.1

name	Olfr679 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128866 GeneID:259046 MGI:3030513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 679 transcript_id : NM_147044.1

name	Olfr681 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430573 GeneID:404318 MGI:3030515
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 681 transcript_id : NM_207557.1

name	Olfr683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128860 GeneID:259047 MGI:3030517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 683 transcript_id : NM_147045.1

name	Olfr684 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402250 GeneID:244187 MGI:3030518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 684 transcript_id : NM_207249.1

name	Olfr685 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801471 GeneID:258160 MGI:3030519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 685 transcript_id : NM_001011857.1

name	Olfr686 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128818 GeneID:259072 MGI:3030520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 686 transcript_id : NM_147069.1

name	EG668035 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257638 GeneID:668035 MGI:3643397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 Proteins product : predicted gene, EG668035 transcript_id : XM_001477192.1

name	Olfr688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090808 GeneID:259161 MGI:3030522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 688 transcript_id : NM_001011533.2

name	Olfr689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129348 GeneID:258745 MGI:3030523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 689 transcript_id : NM_146750.1

name	Olfr690 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938013 GeneID:56860 MGI:3030524
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 690 transcript_id : NM_020290.1

name	Olfr691 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128836 GeneID:259063 MGI:3030525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 691 transcript_id : NM_147061.1

name	Olfr692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129592 GeneID:258352 MGI:3030526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 692 transcript_id : NM_146355.1

name	EG545989 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82907340 GeneID:545989 MGI:3643909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG545989 transcript_id : XM_620543.2

name	4632419K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930594 GeneID:74349 MGI:1921599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632419K20 gene transcript_id : NM_199009.1

name	Cnga4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370142 GeneID:233649 MGI:2664099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide gated channel alpha 4 transcript_id : NM_001033317.2

name	Cckbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349437 GeneID:12426 MGI:99479
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin B receptor transcript_id : NM_007627.3

name	Prkcdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22324937 GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, delta binding protein transcript_id : NM_028444.1

name	Smpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755581 GeneID:20597 MGI:98325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 1, acid lysosomal transcript_id : NM_011421.1

name	Apbb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363757 GeneID:11785 MGI:107765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 1 transcript_id : NM_009685.2

name	Hpxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956085 GeneID:15458 MGI:105112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemopexin transcript_id : NM_017371.1

name	Trim3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921616 GeneID:55992 MGI:1860040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 3 transcript_id : NM_018880.2

name	Arfip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803130 GeneID:76932 MGI:1924182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor interacting protein 2 transcript_id : NM_029802.3

name	Fxc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982715 GeneID:14356 MGI:1315196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fractured callus expressed transcript 1 transcript_id : NM_019502.2

name	Dnhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257641 GeneID:77505 MGI:1924755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein product : dynein heavy chain domain 1 transcript_id : XM_908793.3

name	LOC100042811 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257683 GeneID:100042811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 73 ESTs, 2 Proteins product : similar to mitochondrial ribosomal protein S36 transcript_id : XM_001478446.1

name	LOC672646 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257643 GeneID:672646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to dynein heavy chain domain 1 transcript_id : XM_001477292.1

name	1500003O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270197 GeneID:101867 MGI:1914251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500003O22 gene transcript_id : NM_025897.1

name	Ilk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754341 GeneID:16202 MGI:1195267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin linked kinase transcript_id : NM_010562.1

name	Taf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559395 GeneID:24075 MGI:1346320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_020024.3

name	Tpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368689 GeneID:12751 MGI:1336194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripeptidyl peptidase I transcript_id : NM_009906.3

name	Dchs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257685 GeneID:233651 MGI:2685011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 104 ESTs, 17 Proteins product : dachsous 1 (Drosophila) transcript_id : XM_194371.8

name	Mrpl17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875533 GeneID:27397 MGI:1351608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L17 transcript_id : NM_025301.2

name	9130208D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380911 GeneID:77700 MGI:1924950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 3 Proteins product : RIKEN cDNA 9130208D14 gene transcript_id : XM_620545.3

name	LOC100042856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257691 GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 4 Proteins product : similar to very large inducible GTPase-1, transcript variant 2 transcript_id : XM_001478507.1

name	LOC100042856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257689 GeneID:100042856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 105 ESTs, 4 Proteins product : similar to very large inducible GTPase-1, transcript variant 1 transcript_id : XM_001478498.1

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270967 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_001039160.2

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270957 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_029000.3

name	LOC672660 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257693 GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to very large inducible GTPase 1 transcript_id : XM_001478554.1

name	9230105E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982207 GeneID:319236 MGI:2441735
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : tripartite motif protein TRIM5 protein_id : NP_783608.2

name	A530023O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316738 GeneID:244183 MGI:2443916
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC244183 protein_id : NP_783579.1

name	EG434219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257632 GeneID:434219 MGI:3647719
definition	codon_start : 1 product : similar to Expressed sequence AI451617 protein_id : XP_485980.4

name	Trim30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347379 GeneID:20128 MGI:98178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : regulatory protein, T lymphocyte 1 product : tripartite motif protein 30 protein_id : NP_033125.2

name	AI451617 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255281 GeneID:209387 MGI:3035181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tripartite motif protein 30-like product : hypothetical protein LOC209387 protein_id : NP_954597.1

name	EG625321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702328 GeneID:625321 MGI:3643754
definition	codon_start : 1 product : hypothetical protein LOC625321 protein_id : NP_001033013.1

name	Olfr651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129231 CCDS:CCDS21617.1 GeneID:258809 MGI:3030485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7179540-7180481; olfactory receptor MOR31-11 product : olfactory receptor 651 protein_id : NP_667024.1

name	Olfr652 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128859 CCDS:CCDS21618.1 GeneID:259050 MGI:3030486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7191524-7192471; olfactory receptor MOR31-8 product : olfactory receptor 652 protein_id : NP_667259.1

name	Olfr653 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203819 CCDS:CCDS21619.1 GeneID:57250 MGI:3030487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7206970-7207923; olfactory receptor MOR33-1; odorant receptor S19 product : olfactory receptor 653 protein_id : NP_667285.1

name	Olfr654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129543 CCDS:CCDS21620.1 GeneID:258377 MGI:3030488
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7215221-7216195; olfactory receptor MOR38-2 product : olfactory receptor 654 protein_id : NP_666491.1

name	Olfr655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129221 CCDS:CCDS21621.1 GeneID:258817 MGI:3030489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7224628-7223702; olfactory receptor MOR38-1 product : olfactory receptor 655 protein_id : NP_667031.1

name	Olfr656 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128817 CCDS:CCDS21622.1 GeneID:259078 MGI:3030490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7245486-7246451; olfactory receptor MOR27-1 product : olfactory receptor 656 protein_id : NP_667286.1

name	Olfr657 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129667 CCDS:CCDS21623.1 GeneID:258309 MGI:3030491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7263864-7264823; olfactory receptor MOR40-13 product : olfactory receptor 657 protein_id : NP_666424.1

name	Olfr658 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128853 CCDS:CCDS21624.1 GeneID:259051 MGI:3030492
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7273558-7272587; olfactory receptor MOR34-5 product : olfactory receptor 658 protein_id : NP_667260.1

name	Olfr659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128855 CCDS:CCDS21625.1 GeneID:259052 MGI:3030493
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7298889-7299857; olfactory receptor MOR34-4 product : olfactory receptor 659 protein_id : NP_667261.1

name	Olfr661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128637 CCDS:CCDS21626.1 GeneID:258743 MGI:3030495
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7316375-7317334; olfactory receptor MOR40-4; odorant receptor S83; G-protein-coupled receptor product : olfactory receptor 661 protein_id : NP_666959.1

name	Olfr663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801302 GeneID:257914 MGI:3030497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7331927-7332961; olfactory receptor MOR40-12 product : olfactory receptor 663 protein_id : NP_001011757.1

name	Olfr664 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257635 GeneID:667918 MGI:3030498
definition	codon_start : 1 product : olfactory receptor 664 protein_id : XP_001476931.1

name	EG625530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907334 GeneID:625530 MGI:3643640
definition	codon_start : 1 product : deubiquitinating enzyme 6 protein_id : XP_895200.1

name	LOC100042613 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257658 GeneID:100042613
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478110.1

name	LOC233637 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257637 GeneID:233637
definition	codon_start : 1 product : similar to Twinfilin, actin-binding protein, homolog 1 (Drosophila) protein_id : XP_001476945.1

name	Dub1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299771 CCDS:CCDS21628.1 GeneID:381944 MGI:3051498
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : deubiquitinating enzyme 1a protein_id : NP_958811.2

name	Dub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681237 CCDS:CCDS21629.1 GeneID:13531 MGI:107699
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : deubiquitinating enzyme 1 protein_id : NP_031913.1

name	Olfr665 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129233 CCDS:CCDS21630.1 GeneID:258810 MGI:3030499
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7509539-7510489; olfactory receptor MOR34-7 product : olfactory receptor 665 protein_id : NP_667025.1

name	Olfr666 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128777 CCDS:CCDS21631.1 GeneID:259100 MGI:3030500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7522449-7521493; olfactory receptor MOR34-1 product : olfactory receptor 666 protein_id : NP_667307.1

name	Olfr667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529283 GeneID:259062 MGI:3030501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7546146-7545166; olfactory receptor MOR34-2 product : olfactory receptor 667 protein_id : NP_667271.2

name	Olfr668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128841 GeneID:259061 MGI:3030502
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7554614-7553658; olfactory receptor MOR34-3 product : olfactory receptor 668 protein_id : NP_667270.1

name	Olfr669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203815 CCDS:CCDS21632.1 GeneID:259045 MGI:3030503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7567376-7568329; olfactory receptor MOR34-6 product : olfactory receptor 669 protein_id : NP_667254.1

name	EG545987 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907314 GeneID:545987 MGI:3643907
definition	codon_start : 1 product : similar to MEK binding partner 1 isoform 2 protein_id : XP_904927.1

name	Olfr670 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261734 CCDS:CCDS21634.1 GeneID:384703 MGI:3030504
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7589577-7588639; olfactory receptor MOR32-8; olfactory receptor GA_x5J8B7W6B6J-141796-141659 product : olfactory receptor 670 protein_id : NP_997029.1

name	Olfr671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801298 CCDS:CCDS21635.1 GeneID:257910 MGI:3030505
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7604826-7603885; olfactory receptor MOR32-12 product : olfactory receptor 671 protein_id : NP_001011755.1

name	Olfr672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203787 GeneID:258755 MGI:3030506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7625746-7624808; olfactory receptor MOR32-4; odorant receptor S46 product : olfactory receptor 672 protein_id : NP_666971.1

name	Olfr675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801454 CCDS:CCDS21636.1 GeneID:258147 MGI:3030509
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7653782-7652841; olfactory receptor MOR32-9P product : olfactory receptor 675 protein_id : NP_001011848.1

name	Olfr676 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128775 CCDS:CCDS21637.1 GeneID:259099 MGI:3030510
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7664016-7664969; olfactory receptor MOR32-1 product : olfactory receptor 676 protein_id : NP_667306.1

name	Olfr677 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129583 CCDS:CCDS21638.1 GeneID:258355 MGI:3030511
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7685262-7686200; olfactory receptor MOR32-11 product : olfactory receptor 677 protein_id : NP_666470.1

name	Olfr678 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129333 CCDS:CCDS21639.1 GeneID:258753 MGI:3030512
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7698491-7699432; olfactory receptor MOR32-5 product : olfactory receptor 678 protein_id : NP_666969.1

name	Olfr679 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128867 CCDS:CCDS21640.1 GeneID:259046 MGI:3030513
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7714499-7715446; olfactory receptor MOR40-2 product : olfactory receptor 679 protein_id : NP_667255.1

name	Olfr681 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430574 CCDS:CCDS21641.1 GeneID:404318 MGI:3030515
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7750163-7751110 product : olfactory receptor 681 protein_id : NP_997440.1

name	Olfr683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128861 CCDS:CCDS21642.1 GeneID:259047 MGI:3030517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7773007-7772066; olfactory receptor MOR40-1; odorant receptor S51 product : olfactory receptor 683 protein_id : NP_667256.1

name	Olfr684 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402251 CCDS:CCDS21643.1 GeneID:244187 MGI:3030518
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2PBJ9-7786441-7785503 product : olfactory receptor 684 protein_id : NP_997132.1

name	Olfr685 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801472 CCDS:CCDS21644.1 GeneID:258160 MGI:3030519
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7810071-7809121; olfactory receptor MOR37-1 product : olfactory receptor 685 protein_id : NP_001011857.1

name	Olfr686 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128819 CCDS:CCDS21645.1 GeneID:259072 MGI:3030520
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7832633-7831680; olfactory receptor MOR35-1 product : olfactory receptor 686 protein_id : NP_667280.1

name	EG668035 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257639 GeneID:668035 MGI:3643397
definition	codon_start : 1 product : similar to olfactory receptor Olfr687 protein_id : XP_001477242.1

name	Olfr688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090809 GeneID:259161 MGI:3030522
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7917168-7918148; olfactory receptor MOR40-5; olfactory receptor 688, pseudogene 1 product : olfactory receptor 688 protein_id : NP_001011533.2

name	Olfr689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129349 CCDS:CCDS21646.1 GeneID:258745 MGI:3030523
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7942985-7943947; olfactory receptor MOR40-3 product : olfactory receptor 689 protein_id : NP_666961.1

name	Olfr690 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938014 GeneID:56860 MGI:3030524
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PBJ9-7959171-7958224; olfactory receptor MOR31-2; odorant receptor S18 product : olfactory receptor 690 protein_id : NP_064686.1

name	Olfr691 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128837 CCDS:CCDS21647.1 GeneID:259063 MGI:3030525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7966695-7965727; olfactory receptor MOR31-6 product : olfactory receptor 691 protein_id : NP_667272.1

name	Olfr692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129593 CCDS:CCDS21648.1 GeneID:258352 MGI:3030526
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7994144-7995106; olfactory receptor MOR36-1 product : olfactory receptor 692 protein_id : NP_666467.1

name	EG545989 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907341 GeneID:545989 MGI:3643909
definition	codon_start : 1 product : similar to Chromosome 11 open reading frame 42 protein_id : XP_620543.2

name	4632419K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930595 CCDS:CCDS21649.1 GeneID:74349 MGI:1921599
definition	codon_start : 1 product : hypothetical protein LOC74349 protein_id : NP_950174.1

name	Cnga4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370304 CCDS:CCDS21650.1 GeneID:233649 MGI:2664099
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence TAS]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IMP] codon_start : 1 note : olfactory cyclic nucleotide-gated channel; cyclic nucleotide gated cation channel; cyclic nucleotide-gated cation channel alpha 4 product : cyclic nucleotide gated channel alpha 4 protein_id : NP_001028489.1

name	Cckbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106265 CCDS:CCDS21651.1 GeneID:12426 MGI:99479
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0046935 - phosphatidylinositol 3-kinase regulator activity [Evidence ISS]; GO:0004435 - phosphoinositide phospholipase C activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0007586 - digestion [Evidence ISS]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence ISS]; GO:0007631 - feeding behavior [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007202 - phospholipase C activation [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0007600 - sensory perception [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CCK2/gastrin receptor; CCK-B/gastrin receptor product : cholecystokinin B receptor protein_id : NP_031653.1

name	Prkcdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22324938 CCDS:CCDS21652.1 GeneID:109042 MGI:1923422
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : protein kinase C, delta binding protein protein_id : NP_082720.1

name	Smpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755582 CCDS:CCDS21653.1 GeneID:20597 MGI:98325
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006685 - sphingomyelin catabolism [Evidence IEA] codon_start : 1 note : acid sphingomyelinase product : sphingomyelin phosphodiesterase 1, acid lysosomal protein_id : NP_035551.1

name	Apbb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468877 GeneID:11785 MGI:107765
definition	GO_component : GO:0030426 - growth cone [Evidence ISS]; GO:0030027 - lamellipodium [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0045202 - synapse [Evidence ISS] GO_function : GO:0001540 - beta-amyloid binding [Evidence ISS] [Evidence IDA]; GO:0035035 - histone acetyltransferase binding [Evidence ISS] [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence ISS] [Evidence IDA] GO_process : GO:0030048 - actin filament-based movement [Evidence ISS] [Evidence NAS]; GO:0007411 - axon guidance [Evidence IGI]; GO:0007050 - cell cycle arrest [Evidence ISS] [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030308 - negative regulation of cell growth [Evidence ISS] [Evidence IDA]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence ISS] [Evidence IDA]; GO:0050760 - negative regulation of thymidylate synthase biosynthesis [Evidence ISS] [Evidence IDA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0050821 - protein stabilization [Evidence ISS] [Evidence NAS]; GO:0045449 - regulation of transcription [Evidence ISS] [Evidence IDA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0008542 - visual learning [Evidence IMP] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family B, member 1 protein_id : NP_033815.1

name	Hpxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956086 CCDS:CCDS21654.1 GeneID:15458 MGI:105112
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hemopexin protein_id : NP_059067.1

name	Trim3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468961 CCDS:CCDS21655.1 GeneID:55992 MGI:1860040
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : ring finger protein 22 product : tripartite motif protein 3 protein_id : NP_061368.1

name	Arfip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981363 CCDS:CCDS21656.1 GeneID:76932 MGI:1924182
definition	codon_start : 1 exception : mismatches in translation note : Arfaptin 2; partner of RAC1 (arfaptin 2) product : ADP-ribosylation factor interacting protein 2 protein_id : NP_084078.2

name	Fxc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507187 CCDS:CCDS21657.1 GeneID:14356 MGI:1315196
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042719 - mitochondrial intermembrane space protein transporter complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045039 - protein import into mitochondrial inner membrane [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0006626 - protein targeting to mitochondrion [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : small zinc finger-like protein; Fracture Callus 1 product : fractured callus expressed transcript 1 protein_id : NP_062375.1

name	Dnhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257642 GeneID:77505 MGI:1924755
definition	codon_start : 1 product : dynein heavy chain domain 1 protein_id : XP_913886.3

name	LOC100042811 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257684 GeneID:100042811
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478496.1

name	LOC672646 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257644 GeneID:672646
definition	codon_start : 1 product : similar to dynein heavy chain domain 1 protein_id : XP_001477342.1

name	1500003O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270198 CCDS:CCDS21658.1 GeneID:101867 MGI:1914251
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC101867 protein_id : NP_080173.1

name	Ilk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754342 CCDS:CCDS21659.1 GeneID:16202 MGI:1195267
definition	GO_component : GO:0005925 - focal adhesion [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0001658 - ureteric bud branching [Evidence IDA] codon_start : 1 exception : mismatches in translation product : integrin linked kinase protein_id : NP_034692.1

name	Taf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518499 CCDS:CCDS21660.1 GeneID:24075 MGI:1346320
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence TAS] [Evidence ISS] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0006915 - apoptosis [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30 kDa; TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30 kDa product : TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_064408.2

name	Tpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753448 CCDS:CCDS21661.1 GeneID:12751 MGI:1336194
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IDA] [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA]; GO:0019131 - tripeptidyl-peptidase I activity [Evidence IMP] [Evidence IEA] GO_process : GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IC] [Evidence IEA]; GO:0050885 - regulation of balance [Evidence IMP] codon_start : 1 note : tripeptidyl peptidase-I; ceroid-lipofuscinosis, neuronal 2 product : tripeptidyl-peptidase I protein_id : NP_034036.1

name	Dchs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257686 GeneID:233651 MGI:2685011
definition	codon_start : 1 product : dachsous 1 protein_id : XP_194371.7

name	Mrpl17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384658 CCDS:CCDS21662.1 GeneID:27397 MGI:1351608
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0000002 - mitochondrial genome maintenance [Evidence TAS]; GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L26 product : mitochondrial ribosomal protein L17 protein_id : NP_079577.1

name	9130208D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63561913 GeneID:77700 MGI:1924950
definition	codon_start : 1 product : hypothetical protein LOC77700 protein_id : XP_620545.1

name	LOC100042856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257690 GeneID:100042856
definition	codon_start : 1 product : similar to very large inducible GTPase-1 isoform 1 protein_id : XP_001478548.1

name	LOC100042856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257692 GeneID:100042856
definition	codon_start : 1 product : similar to very large inducible GTPase-1 isoform 2 protein_id : XP_001478557.1

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270968 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_001034249.2

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270958 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_083276.2

name	LOC672660 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257694 GeneID:672660
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478604.1

name	LOC100041595 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041595
definition	number : 2 pseudo : _no_value

name	LOC100041595 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041595
definition	number : 1 pseudo : _no_value

name	LOC625305 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625305
definition	number : 1 pseudo : _no_value

name	LOC667882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667882
definition	number : 1 pseudo : _no_value

name	LOC667882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667882
definition	number : 2 pseudo : _no_value

name	LOC625495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625495
definition	number : 2 pseudo : _no_value

name	LOC625495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625495
definition	number : 1 pseudo : _no_value

name	LOC667987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667987
definition	number : 1 pseudo : _no_value

name	LOC667987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667987
definition	number : 2 pseudo : _no_value

name	LOC100042047 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042047
definition	number : 1 pseudo : _no_value

name	LOC100042097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042097
definition	number : 1 pseudo : _no_value

name	LOC672495 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257633 GeneID:672495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 13 Proteins product : similar to cyclin Y-like 1 pseudo : _no_value transcript_id : XR_032873.1

name	EG244189 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257640 GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins product : predicted gene, EG244189 pseudo : _no_value transcript_id : XR_035686.1

name	LOC626055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257645 GeneID:626055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to Ornithine decarboxylase (ODC) pseudo : _no_value transcript_id : XR_033197.1

name	EG668117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380912 GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : predicted gene, EG668117 pseudo : _no_value transcript_id : XR_002142.1

clone name	MSMg01-543B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-389A14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-547A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-484I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-518H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-183A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-046L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-510J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-461L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-487E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465G13
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-202F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-002H21.b	B6Ng01-002H21.g
ACC	DH840498	DH840499
length	922	1,137
definition	DH840498\|Mus musculus domesticus DNA, BAC clone: B6Ng01-002H21, 5' end.	DH840499\|Mus musculus domesticus DNA, BAC clone: B6Ng01-002H21, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttggcttttccaagacacatcatgaaggggtgttagattttgtc aaatgctttcttagcacttaatgaaatgatcacatgggtgggtttttttt ttttagtttgattatatagtggactatgttgatggattttcgtatattga cctatccatgcatccctggcatgaagcctagttgatcatgatggatgatc attttgatttgttcttggattcagtttacaagaattttattgggtatttt tgcatagatattcataagggaaattggtctgaagttctctttctttgtgg gtctttgtgtagtttagatatcagagtaattgtggtttcatagaacgagt tggatagagttccttctgtttctattttgtggaatagtttgaagagcatt ggtattaggtcttctttgaaggtctgacaaggactctgaactaaactcat ctggtcctgggctttttttggctgggagactattaatgactgtttctatt tctttaggggatatgggactatttagatcgttaatctgatcctgatttaa ctttggtacctggtatctgtctagaaaattgtccatttgatccatatttt ccagttctgttgaatataggcttttgtagtagagtctgatgattctttgg gtttccacggtttccattgttatgtctcactttttcatttctgattttat taatttggatacagtctctgttccctctggttagtctagctaaaagttta tcttacccccccctgctaaaaaacaagctcctggttttgttgaccttttt gtatagttcttttttgtttctacttggtttgatttcagccctgagtttga ttgtttcctgccatcacttctcctgggtatatttgcttctttttgtccag acctttgagggtatgctgttca	gaattccttaattgtttgttttatttatctttgttatttttatgtgtgtg taacgtatgtgtcatggatgctgcatgtgtggagatcagaggaggacttt tggcagatagttctctcttgtgggttctgcagatctaaatcaggtcctga ggcttgtgtgccagggcttttacccactgagccatggcattagctcaggt gagaactgttcaggacatttattccttggtaatttgggagtctgatttac tcagcttctaaactcattctgtccactctcttgcattttggagagcatca atagaacatgtaaatttttgttaggcagagaaaataaattcaagggatct atttttcaccatagtggctgtggttaataagagcatattatctatttaaa attgctttgaaagtagattttaaatgtctgatgtgaaataatatgcataa tacttcactttattagatatgttatagtaatttatatgtatataaatata taatatgtgtgtatgtataatgttgtatactctacatgaacttttatttg ttaaaaatgacttaccaattctctaaagatgtggtagtgagtcagggact cttggtgcctctgcagtctagctaatgctgactttagattgtgaccctgg ggcatgctgtctgagtgcctgtgggcaggagtgaggactaaatctgaatt tgtatcaatacattgaaaggtaaacattttacaaattgcaaacttcgccc cattaatgtgtacaattaatgcatgttagtgaggacagttaaagaaaaat gaagttctgtgatacaactcacagtaaacctgctataacgtacgctgtta tgtctgacagatgcacgacttcagtgtgcaggtagagagtctgaatggtg gaaaactcttgaaatacgaaaggcatttacaaggaagatggcaaagtgaa attaatacatgtattaataagtatccagggtgattcagctaggcaaaaag cagcctcctgtagtcacttagcagttccatagatggggatgtatgaagtt catctcctggtcatattataatagattataaaaacctccaaaatccggct gtaagaattacaaaaaggtctttgtgttactctcaga
quality values	Open. Hide. 47 28 43 35 61 61 53 61 50 47 53 61 61 50 50 50 32 16 43 61 61 55 55 61 49 61 11 12 18 20 14 15 18 28 28 28 37 61 59 59 61 61 61 61 61 59 55 44 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 45 45 43 44 36 30 28 32 55 59 59 55 59 59 52 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 59 61 61 61 61 61 61 61 61 59 61 59 61 59 59 59 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 43 52 61 61 61 61 59 59 59 59 59 59 52 59 59 59 43 59 61 59 52 59 59 55 59 59 61 59 59 61 61 61 61 52 41 52 59 49 52 39 59 59 59 61 59 59 52 59 61 61 61 61 61 61 61 59 59 59 59 49 59 59 59 61 61 61 61 61 61 45 41 36 35 41 49 61 61 59 59 52 41 37 39 61 59 52 41 44 36 39 59 55 59 61 61 61 61 61 61 61 61 59 59 59 59 61 61 59 59 52 49 45 34 59 59 36 59 59 52 59 52 52 45 52 61 61 61 59 61 61 61 61 61 61 59 52 44 52 52 59 61 61 39 45 49 44 49 52 49 52 45 49 45 49 61 59 61 61 59 59 49 52 52 52 61 61 61 59 61 61 61 61 61 59 61 52 61 61 59 61 59 59 49 59 59 59 61 61 61 61 61 59 61 61 59 59 59 59 52 59 61 52 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 59 52 52 52 52 52 52 52 39 59 59 59 59 59 52 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 52 59 59 59 59 61 61 61 61 61 61 61 39 59 45 49 52 49 45 52 52 61 61 61 59 44 59 45 52 52 59 59 52 45 49 49 59 59 45 52 41 45 43 59 59 52 59 49 49 49 52 52 52 49 52 52 52 43 38 13 21 24 31 59 59 59 52 59 59 61 61 61 61 59 61 59 43 59 59 61 59 59 49 59 40 52 59 61 61 61 61 49 59 59 41 49 59 59 59 59 59 49 59 59 59 52 52 49 49 49 61 55 61 61 61 61 36 55 61 55 49 36 52 37 43 43 61 61 61 61 52 61 61 61 49 55 61 24 24 15 19 10 21 28 52 49 49 41 52 49 49 61 41 41 41 43 52 49 61 61 43 34 43 49 49 49 50 61 38 39 41 41 43 50 61 38 61 61 50 55 55 55 61 19 19 27 16 21 19 39 55 55 61 55 47 39 49 37 43 40 61 55 61 43 37 43 37 37 37 12 21 14 15 21 11 37 37 50 50 50 50 47 24 18 29 25 35 31 53 52 53 37 24 35 53 61 45 61 35 52 45 61 53 61 30 52 39 28 28 29 29 24 61 53 52 53 52 35 27 15 16 10 17 13 26 5 19 13 15 17 16 39 43 61 42 37 53 42 61 34 47 39 28 47 34 39 53 45 38 31 39 39 25 23 13 14 17 24 61 47 46 53 45 50 33 61 61 61 53 53 53 53 25 45 28 26 38 21 30 28 32 28 24 16 43 24 21 23 14 8 16 43 35 47 50 35 53 47 34 53 28 17 53 21 24 30 17 20 20 31 16 14 20 12 13 17 24 27 8 9 8 15 10 5 8 7 10 16 4 5 13 4 4 7 9 13 26 17 16 20 47 38 33 23 19 27 32 42 16 57 53 53 36 33 24 22 30 42 27 21 20 29 33 16 13 12 15 45 27 36 21 31 30 28 27 34 53 50 39 21 24 14 24 24 24 6 17 20 18 21 24 24 10 24 10 21 41 42 52 30 32 18 24 20 39 31 26 30 35 18 16 9 11 22 40 41 20 42 19 24 17 17 17 18 24 14 12 13 11 6 6 15 14 16 27 8 10 8 9 15 46 34 24 22 16 23 18 23 22 26 19 14 26 30 31 25 25 31 23 21 18 23 11 11 8 23 10 10 12 5 15 17 31 12 20 12 16 23 34 16 23 31 20 7 14 11 7	Open. Hide. 61 59 59 59 61 61 19 13 13 12 12 19 30 28 22 26 30 34 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 61 61 61 61 52 52 37 31 28 30 31 45 45 52 61 59 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 59 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 50 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 45 61 61 61 61 61 57 57 57 52 53 53 57 57 53 53 53 53 57 53 57 57 53 53 53 47 53 53 53 47 47 47 57 57 57 53 53 50 53 53 57 57 53 43 38 53 53 57 57 53 57 53 57 57 57 50 53 53 50 35 57 47 53 45 53 53 57 47 57 47 50 53 43 47 37 40 52 57 53 53 50 45 53 52 47 47 53 52 32 57 53 57 38 57 53 57 45 53 57 50 53 31 40 32 57 53 50 53 53 30 38 43 46 41 23 41 43 43 35 38 53 50 53 52 52 50 53 52 57 26 50 53 34 38 37 53 47 53 57 57 39 38 37 50 53 27 52 46 50 21 53 37 30 50 32 57 19 38 50 50 37 53 36 47 57 57 53 39 37 41 36 31 52 40 37 38 17 39 38 36 52 53 37 28 53 27 37 44 37 39 28 41 57 57 57 37 45 19 46 43 37 41 44 40 40 57 36 36 32 40 40 24 40 53 37 33 26 48 48 29 40 37 53 40 37 35 31 37 12 45 31 26 18 53 31 44 32 25 36 38 15 45 30 34 30 32 31 20 46 30 20 29 30 31 22 20 51 44 32 46 51 51 46 30 30 31 30 38 22 29 43 29 29 30 29 37 41 34 33 29 23 24 29 48 29 25 29 29 28 22 19 45 21 23 30 29 48 29 29 24 22 17 29 29 29 30 29 30 19 30 34 39 19 21 33 33 29 28 29 29 27 29 23 28 25 29 20 24 29 14 31 16 43 30 22 41 28 28 29 28 43 28 25 21 18 9 31 16 29 28 43 29 41 27 18 14 15 27 28 26 31 35 41 29 30 24 38 51 41 29 22 29 28 29 30 30 33 51 13 29 21 29 19 40 46 24 17 36 13 14 33 51 16 14 14 17 17 17 29 32 27 20 22 11 16 26 25 26 41 29 13 27 28 21 44 19 22 22 22 16 16 12 16 12 26 36 28 34 38 33 27 28 26 25 29 26 36 22 26 12 38 8 5 38 12 12 22 20 23 15 22 23 19 30 21 9 21 20 15 25 34 44 44 8 9 25 19 14 17 7 12 8 5 9 9 4 4 12 18 25 5 16 6 7 13 15 18 15 8 16 9 23 22 14 23 8 5 3 6 16 33 30 15 15 13 9 5 5 16 8 23 7 7 5 25 8 6 15 4 4 27 22 7 9 4 3 5 9 4 3 9 7 5 8 5 12 12 14 12 12 8 10 8 11 9 19 19 6 4 4 5 3 2 5 5 24 26 7 16 4 3 7 16 5 5 5 5 3 2 4 4 6 3 7 14 6 11 21 16 26 8 4 12 4 9 24 27 10 5 4 4 5 5 7 12 14 8 7 19 4 4 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_112489072_112490197
seq2: B6Ng01-002H21.g_66_1202 (reverse)

seq1  TCTG-GAGTTACACAAAGACC-TTTTGTATCTC-TACAGCCTGAATTTGG  47
      |||| |||| ||||||||||| |||||||  || ||||||| || |||||
seq2  TCTGAGAGTAACACAAAGACCTTTTTGTAATTCTTACAGCCGGATTTTGG  50

seq1  AAGACTTTAT-ATC-ATAATAATATGA-CAG--GATGAAC-TCATACATC  91
      | |  ||||| ||| || ||||||||| |||  ||||||| |||||||||
seq2  AGGTTTTTATAATCTATTATAATATGACCAGGAGATGAACTTCATACATC  100

seq1  CCATCCTATGGAACTGCTAGGTGACTACATGA-GCTGCTTTTTGCCTAGC  140
      ||   |||||||||||||| ||||||||| || |||||||||||||||||
seq2  CCCATCTATGGAACTGCTAAGTGACTACAGGAGGCTGCTTTTTGCCTAGC  150

seq1  TGAATCA-CCTGGATACTTATTAATACATGTATTAATTTCACTTTGCCAT  189
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATCACCCTGGATACTTATTAATACATGTATTAATTTCACTTTGCCAT  200

seq1  CTTCCTTGTAAATGCCTTTCGTATTTCAAGAGTTTTCCACCATTCAGACT  239
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTGTAAATGCCTTTCGTATTTCAAGAGTTTTCCACCATTCAGACT  250

seq1  CTCTACCTGCACACTGAAGTCGTGCATCTGTCAGACATAACAGCGTACGT  289
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTACCTGCACACTGAAGTCGTGCATCTGTCAGACATAACAGCGTACGT  300

seq1  TATAGCAGGTTTACTGTGAGTTGTATCACAGAACTTCATTTTTCTTTAAC  339
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGCAGGTTTACTGTGAGTTGTATCACAGAACTTCATTTTTCTTTAAC  350

seq1  TGTCCTCACTAACATGCATTAATTGTACACATTAATGGGGCGAAGTTTGC  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTCACTAACATGCATTAATTGTACACATTAATGGGGCGAAGTTTGC  400

seq1  AATTTGTAAAATGTTTACCTTTCAATGTATTGATACAAATTCAGATTTAG  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGTAAAATGTTTACCTTTCAATGTATTGATACAAATTCAGATTTAG  450

seq1  TCCTCACTCCTGCCCACAGGCACTCAGACAGCATGCCCCAGGGTCACAAT  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCACTCCTGCCCACAGGCACTCAGACAGCATGCCCCAGGGTCACAAT  500

seq1  CTAAAGTCAGCATTAGCTAGACTGCAGAGGCACCAAGAGTCCCTGACTCA  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAGTCAGCATTAGCTAGACTGCAGAGGCACCAAGAGTCCCTGACTCA  550

seq1  CTACCACATCTTTAGAGAATTGGTAAGTCATTTTTAACAAATAAAAGTTC  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCACATCTTTAGAGAATTGGTAAGTCATTTTTAACAAATAAAAGTTC  600

seq1  ATGTAGAGTATACAACATTATACATACACACATATTATATATTTATATAC  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAGAGTATACAACATTATACATACACACATATTATATATTTATATAC  650

seq1  ATATAAATTACTATAACATATCTAATAAAGTGAAGTATTATGCATATTAT  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAATTACTATAACATATCTAATAAAGTGAAGTATTATGCATATTAT  700

seq1  TTCACATCAGACATTTAAAATCTACTTTCAAAGCAATTTTAAATAGATAA  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACATCAGACATTTAAAATCTACTTTCAAAGCAATTTTAAATAGATAA  750

seq1  TATGCTCTTATTAACCACAGCCACTATGGTGAAAAATAGATCCCTTGAAT  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCTCTTATTAACCACAGCCACTATGGTGAAAAATAGATCCCTTGAAT  800

seq1  TTATTTTCTCTGCCTAACAAAAATTTACATGTTCTATTGATGCTCTCCAA  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTTCTCTGCCTAACAAAAATTTACATGTTCTATTGATGCTCTCCAA  850

seq1  AATGCAAGAGAGTGGACAGAATGAGTTTAGAAGCTGAGTAAATCAGACTC  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCAAGAGAGTGGACAGAATGAGTTTAGAAGCTGAGTAAATCAGACTC  900

seq1  CCAAATTACCAAGGAATAAATGTCCTGAACAGTTCTCACCTGAGCTAATG  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAATTACCAAGGAATAAATGTCCTGAACAGTTCTCACCTGAGCTAATG  950

seq1  CCATGGCTCAGTGGGTAAAAGCCCTGGCACACAAGCCTCAGGACCTGATT  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGGCTCAGTGGGTAAAAGCCCTGGCACACAAGCCTCAGGACCTGATT  1000

seq1  TAGATCTGCAGAACCCACAAGAGAGAACTATCTGCCAAAAGTCCTCCTCT  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATCTGCAGAACCCACAAGAGAGAACTATCTGCCAAAAGTCCTCCTCT  1050

seq1  GATCTCCACACATGCAGCATCCATGACACATACGTTACACACACATAAAA  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTCCACACATGCAGCATCCATGACACATACGTTACACACACATAAAA  1100

seq1  ATAACAAAGATAAATAAAACAAACAATTAAGGAATTC  1126
      |||||||||||||||||||||||||||||||||||||
seq2  ATAACAAAGATAAATAAAACAAACAATTAAGGAATTC  1137

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information