MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-005F02
Chromosome	7 (Build37)
Map Location	12,151,903 - 12,153,038
singlet/doublet	singlet
Overlap gene	LOC665926
Upstream gene	V1re9, V1rl1, EG628596, Nlrp4b, LOC333184, V1re13, BQ559217, LOC637237, LOC236479, EG665879, Zscan4b, LOC665793, EG665798, Gm397, Zscan4-ps1, LOC635187, LOC100042997, LOC100042293, Zscan4d, LOC628737, LOC676750, LOC672893, LOC546931, LOC675762, Zscan4e, LOC665857, LOC665861, Zscan4f, LOC673742, LOC665887, LOC637541, LOC100042361, Zscan4-ps2, LOC675782, LOC100042386
Downstream gene	LOC637571, LOC100043042, LOC628853, V1rg1, V1rg2, EG628898, V1rg5, V1rg6, LOC665999, V1rg4, LOC100042423, LOC628946, LOC100043075, LOC100042433, V1rg7, LOC100042437, V1rg3, LOC100042446, LOC100043092, V1rg9, V1rg12, V1rg8, V1rg11, Zfp551, EG666065, Zfp606, 2900092C05Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	V1re9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252904 MGI:2182253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171262 MGI:2159699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628596 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628596 MGI:3645052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 351 ESTs, 7 Proteins

name	Nlrp4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210045 MGI:3056570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC333184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:333184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins pseudo : _no_value

name	V1re13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252910 MGI:2182255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BQ559217 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434555 MGI:3574103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein

name	LOC637237 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC236479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 46 Proteins pseudo : _no_value

name	EG665879 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665879 MGI:3646728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zscan4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665780 MGI:3645447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC665793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG665798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins pseudo : _no_value

name	Gm397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs

name	LOC635187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC100042997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins pseudo : _no_value

name	LOC100042293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zscan4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC628737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins pseudo : _no_value

name	LOC676750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC672893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC675762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Zscan4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC665857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins pseudo : _no_value

name	Zscan4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC673742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC637541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Zscan4-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC675782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100042386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins pseudo : _no_value

name	LOC637571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	LOC100043042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC628853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	V1rg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins pseudo : _no_value

name	V1rg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1rg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	LOC100043075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1rg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171242 MGI:2159646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	V1rg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043092 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	V1rg9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619331 MGI:3588205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666065 MGI:3644790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Zfp606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900092C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73090 MGI:1920340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560757 GeneID:252904 MGI:2182253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E9 transcript_id : NM_145842.2

name	V1rl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717764 GeneID:171262 MGI:2159699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, L1 transcript_id : NM_134228.1

name	EG628596 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379401 GeneID:628596 MGI:3645052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 351 ESTs, 7 Proteins product : predicted gene, EG628596 transcript_id : XM_893358.2

name	Nlrp4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350253 GeneID:210045 MGI:3056570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4B transcript_id : NM_172481.2

name	V1re13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543929 GeneID:252910 MGI:2182255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E13 transcript_id : NM_145848.2

name	Zscan4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256349 GeneID:665780 MGI:3645447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : zinc finger and SCAN domain containing 4B transcript_id : XM_979403.2

name	Gm397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131157 GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 397, (NCBI) transcript_id : NM_001013765.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379416 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 2 transcript_id : XM_891198.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379414 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 3 transcript_id : XM_983203.1

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379420 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 4 transcript_id : XM_899474.2

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379421 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 1 transcript_id : XM_620418.3

name	Zscan4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256374 GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : zinc finger and SCAN domain containing 4E transcript_id : XM_979850.2

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256381 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4F transcript_id : XM_001479557.1

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379425 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4F, transcript variant 2 transcript_id : XM_983435.1

name	LOC100042361 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256132 GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001478041.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256390 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 1 transcript_id : XM_001479576.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256392 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 2 transcript_id : XM_001479587.1

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256406 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : similar to CG2712-PA, transcript variant 1 transcript_id : XM_001479610.1

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256408 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs product : similar to CG2712-PA, transcript variant 2 transcript_id : XM_001479616.1

name	V1rg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003893 GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G1 transcript_id : NM_145843.1

name	V1rg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717720 GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G2 transcript_id : NM_134203.1

name	V1rg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717734 GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G5 transcript_id : NM_134206.1

name	V1rg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717728 GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G6 transcript_id : NM_134207.1

name	V1rg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821682 GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G4 transcript_id : NM_134205.2

name	LOC628946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256422 GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : similar to vomeronasal V1r-type receptor V1rg16 transcript_id : XM_001479628.1

name	V1rg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717738 GeneID:171242 MGI:2159646
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G7 transcript_id : NM_134208.1

name	LOC100042437 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256137 GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : similar to vomeronasal receptor V1RG10 transcript_id : XM_001478204.1

name	V1rg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300966 GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G3 transcript_id : NM_134204.2

name	LOC100043092 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256434 GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043092 transcript_id : XM_001479642.1

name	V1rg9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717742 GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G9 transcript_id : NM_134210.1

name	V1rg12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717776 GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G12 transcript_id : NM_134234.1

name	V1rg8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717732 GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G8 transcript_id : NM_134209.1

name	V1rg11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717782 GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G11 transcript_id : NM_134233.1

name	Zfp551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802370 GeneID:619331 MGI:3588205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingr protein 551 transcript_id : NM_001033820.2

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129854 GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_026112.3

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90265806 GeneID:67370 MGI:1914620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_001039951.1

name	2900092C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370547 GeneID:73090 MGI:1920340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900092C05 gene transcript_id : NM_028434.2

name	V1re9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003898 CCDS:CCDS20793.1 GeneID:252904 MGI:2182253
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, E9 protein_id : NP_665841.1

name	V1rl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717765 CCDS:CCDS20794.1 GeneID:171262 MGI:2159699
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 D2 product : vomeronasal 1 receptor, L1 protein_id : NP_598989.1

name	EG628596 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903391 GeneID:628596 MGI:3645052
definition	codon_start : 1 product : similar to isolog of yeast sui1 and rice gos2; putative protein_id : XP_898451.1

name	Nlrp4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369660 CCDS:CCDS20795.1 GeneID:210045 MGI:3056570
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NACHT/LRR/pyrin domain-containing protein 4b product : NACHT, leucine rich repeat and PYD containing 4B protein_id : NP_766069.1

name	V1re13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003900 CCDS:CCDS20796.1 GeneID:252910 MGI:2182255
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, E13 protein_id : NP_665847.1

name	Zscan4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379403 GeneID:665780 MGI:3645447
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) protein_id : XP_984497.1

name	Gm397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000642 GeneID:245109 MGI:2685243
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245109 protein_id : NP_001013787.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903136 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 2 protein_id : XP_896291.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379415 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 3 protein_id : XP_988297.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555372 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 1 protein_id : XP_620418.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903148 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 4 protein_id : XP_904567.1

name	Zscan4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379413 GeneID:665848 MGI:3643613
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) protein_id : XP_984944.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256382 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479607.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379426 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_988529.1

name	LOC100042361 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256133 GeneID:100042361
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001478091.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256391 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479626.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256393 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479637.1

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256407 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479660.1

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256409 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479666.1

name	V1rg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003894 CCDS:CCDS20799.1 GeneID:252905 MGI:2182256
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, G1 protein_id : NP_665842.1

name	V1rg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717721 CCDS:CCDS20800.1 GeneID:171237 MGI:2159641
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G2 protein_id : NP_598964.1

name	V1rg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717735 CCDS:CCDS20801.1 GeneID:171240 MGI:2159644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G5 protein_id : NP_598967.1

name	V1rg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717729 CCDS:CCDS20802.1 GeneID:171241 MGI:2159645
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G6 protein_id : NP_598968.1

name	V1rg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821683 CCDS:CCDS20803.1 GeneID:171239 MGI:2159643
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G4 protein_id : NP_598966.2

name	LOC628946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256423 GeneID:628946
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1rg16 protein_id : XP_001479678.1

name	V1rg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717739 CCDS:CCDS20804.1 GeneID:171242 MGI:2159646
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, G7 protein_id : NP_598969.1

name	LOC100042437 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256138 GeneID:100042437
definition	codon_start : 1 product : similar to vomeronasal receptor V1RG10 protein_id : XP_001478254.1

name	V1rg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300967 CCDS:CCDS20805.1 GeneID:171238 MGI:2159642
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G3 protein_id : NP_598965.2

name	LOC100043092 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256435 GeneID:100043092
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479692.1

name	V1rg9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717743 CCDS:CCDS20806.1 GeneID:171244 MGI:2159648
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G9 protein_id : NP_598971.1

name	V1rg12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717777 GeneID:171268 MGI:2159656
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G12 protein_id : NP_598995.1

name	V1rg8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717733 CCDS:CCDS20807.1 GeneID:171243 MGI:2159647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G8 protein_id : NP_598970.1

name	V1rg11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717783 CCDS:CCDS20808.1 GeneID:171267 MGI:2159655
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G11 protein_id : NP_598994.1

name	Zfp551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702167 CCDS:CCDS20809.1 GeneID:619331 MGI:3588205
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc fingr protein 551 protein_id : NP_001028992.1

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328284 CCDS:CCDS20810.1 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 606 isoform 1 protein_id : NP_080388.2

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90265807 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 606 isoform 2 protein_id : NP_001035040.1

name	2900092C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469013 CCDS:CCDS20811.1 GeneID:73090 MGI:1920340
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73090 protein_id : NP_082710.1

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 1 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 2 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 3 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 4 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 5 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 6 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 7 pseudo : _no_value

name	EG665879 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665879
definition	number : 2 pseudo : _no_value

name	EG665879 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665879
definition	number : 1 pseudo : _no_value

name	LOC665793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665793
definition	number : 1 pseudo : _no_value

name	LOC665793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665793
definition	number : 2 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 1 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 2 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 3 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 4 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 5 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 6 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 7 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 3 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 2 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 1 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 3 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 2 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 2 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 3 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 4 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 5 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 6 pseudo : _no_value

name	LOC546931 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546931
definition	number : 1 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 3 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 2 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 2 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 1 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 2 pseudo : _no_value

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 1 pseudo : _no_value

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 2 pseudo : _no_value

name	LOC628853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628853
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 1 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 5 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 4 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 2 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 2 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 1 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 2 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 4 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 5 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 6 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 7 pseudo : _no_value

name	LOC333184 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256130 GeneID:333184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins product : similar to Mitochondrial methionyl-tRNA formyltransferase pseudo : _no_value transcript_id : XR_033395.1

name	BQ559217 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256343 GeneID:434555 MGI:3574103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein product : expresssed sequence BQ559217 transcript_id : XR_034223.1

name	LOC236479 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256346 GeneID:236479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 46 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034228.1

name	EG665798 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256351 GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins product : predicted gene, EG665798 pseudo : _no_value transcript_id : XR_002295.2

name	LOC100042997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256358 GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034250.1

name	LOC628737 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256365 GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034260.1

name	LOC665861 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256378 GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : similar to serine/threonine kinase AIE1 pseudo : _no_value transcript_id : XR_034271.1

name	LOC665887 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256385 GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034281.1

name	LOC637541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256131 GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033505.1

name	LOC675782 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256135 GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033520.1

name	LOC665926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256400 GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034287.1

name	LOC637571 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256403 GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034289.1

name	EG628898 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256136 GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins product : predicted gene, EG628898 pseudo : _no_value transcript_id : XR_033554.1

name	LOC100043075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256426 GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins product : similar to ring finger protein 141 pseudo : _no_value transcript_id : XR_034297.1

clone name	MSMg01-466C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-371O03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517B24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-005F02.b	B6Ng01-005F02.g
ACC	DH842484	DH842485
length	1,110	809
definition	DH842484\|Mus musculus domesticus DNA, BAC clone: B6Ng01-005F02, 5' end.	DH842485\|Mus musculus domesticus DNA, BAC clone: B6Ng01-005F02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccatgatcctgggcccactgtcccacttctctggcagtgaaatga gttccttggtcagaagcaatactgtgtggaataccatgacgatagattca gtagtagctgtgaatgaaagtccaaggatctagcagttactcagcctcac acagcaagcaggctaaggaataagagcaagactcccttcttccaatgtcc ttatattgtctccaacagaaggtatagcccagattaaaggcgtgttccac cacacctttaatcccagatgaccttgaagtcagagatttaatcttctgga attcatagccactatgcctcaagatctccataccaagatgcagatcagaa acttctatctccaagcctctagataatggtcactggtgggccttccaatt ctggattgtagttcattccaaatatagtcaagttgacaaccaggaatagc cactacaggtggggacactttaaagatcagcacaccactaccccacagac tgcaaagaattctcactgccaatggcttggccaagctaacccaaccccca aaaagcaaaacaaaaaaaaaaatcaaataatgtaaaattttaaaagtttt tttttcatataatctattcaagatttctctagcactgactgatacaaagc acaatgagatggcactttagagacctcagctttaggaaagggagatgaga tgatgttcatgtggctaaatcagtgacacaaacacaattttccttttctc tgtctaccgtgggggcaggtgaactataagaggtcagcacaacactaagg ggcggtatgatccatctttgagcagttaggaaagggatagagctgcgaca agtttggtttcaggctgggtgcttaaatggtagcacgtttgcctaacatt catgaggccatggggaggtggggcttctcagatttcttcactgttctttt tttggtcacattctggatgggaaaagtacaaaattaaaaataagggttaa agttgttcaaagaaacaagctgaaaaccttcacagtcctggacagttttt tgtttgctgacttcctagatctcctgttgtctgctagacttgtgcagagt cctgagctct	gaattccttacagaatgaaataaaatttttactacaataggatggcccgt tatctgtcttaataagtttaggcaatcccatgggattaaaggcttgctgg caatgatcaattacgtttttagaagcctctcctgtatgcagagaagggat ctggacggtgtattgaagttaaatgtaccacaggtctcaaataagggtac tgaatgtgtaacatataaattgtcagtaaagatattaaaagcctcatgta cagactgaaagacctgtagtactgttgttaatttggctaactgagctgaa aggccaggagtctctaagataacttgttgattattaataagatatccagc ttgccctttagaggagccatcagtaaaaatcaatagagcattatataaag gctgtaaagaagtcattttaggaaatatcacatcacgtacatttaaaaat tttataaacctatcttggggatagtggatgtctatagttcccttaaaagg ttgaacaatgatatctggctctttgccaaaataagttaatgtctgccttc ttccagtgataatcatctgtgccactgctttgtgatatggcaagatatta catttaggagaaatccttgagtgtatccaccttataggaaaattttgcta tagcggttccataggcacatgagtcgtattaaaaattaacagatgcaggg gcaaggagtaatctatataagtgacaaattgctcttcaatagctttttcc actagctgtaaggccagcaacccttctgaggttagggatctaggggaagt ggggggatg
quality values	Open. Hide. 50 43 39 35 61 61 38 14 61 61 47 47 61 61 47 61 61 61 61 61 49 31 61 61 61 55 15 25 31 11 14 19 30 22 26 25 43 59 59 59 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 43 43 45 28 36 28 43 41 43 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 55 61 61 61 59 55 55 59 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 61 61 59 59 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 59 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 55 44 31 55 61 55 61 61 61 61 61 61 61 61 61 61 55 55 55 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 35 50 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 55 55 55 50 55 55 55 55 50 55 61 61 61 61 53 61 61 53 50 50 53 53 61 61 61 61 61 61 61 61 61 52 61 53 61 53 50 47 50 50 47 47 50 50 50 47 43 50 53 50 61 61 61 61 47 52 53 61 61 61 61 61 61 61 53 53 46 53 47 61 61 61 43 61 61 61 61 61 61 61 61 61 53 42 47 57 53 57 53 52 53 47 47 53 53 52 53 53 47 47 47 50 53 57 53 53 50 53 50 50 53 53 53 47 50 57 57 57 57 57 57 57 57 57 53 50 53 57 57 57 47 51 47 53 53 53 57 57 47 53 57 57 38 43 57 57 57 52 52 57 57 57 57 57 57 57 57 45 39 47 47 53 53 47 50 50 53 52 53 57 38 41 57 50 53 35 57 57 41 52 47 52 53 53 53 53 52 53 53 38 34 38 52 52 42 50 57 42 53 57 53 53 34 50 18 14 11 15 19 21 52 37 57 53 47 37 47 53 53 39 50 36 53 38 34 50 39 37 38 38 24 46 46 46 37 35 33 37 52 57 38 33 57 38 33 22 33 17 52 57 31 43 28 33 45 23 37 37 44 33 29 37 53 40 52 46 31 32 28 57 40 40 37 28 31 39 53 35 27 24 41 28 53 45 45 27 47 27 53 33 57 53 13 16 30 10 53 44 31 29 7 32 24 34 30 30 32 30 32 36 31 24 48 51 51 47 44 32 28 38 39 28 48 32 32 20 17 26 25 10 39 20 33 14 51 28 44 38 21 29 22 30 30 21 37 25 30 38 28 29 21 47 47 29 28 29 48 22 28 37 35 37 24 30 20 20 26 23 38 51 43 25 39 11 29 29 13 9 27 23 23 22 29 51 33 27 51 29 29 14 29 17 26 14 29 36 28 36 7 24 12 18 35 23 19 46 20 29 12 5 5 6 9 6 12 12 21 23 10 46 11 11 29 31 15 9 41 51 28 33 46 46 15 35 23 29 23 31 28 22 51 21 28 17 22 28 33 5 14 21 14 9 18 23 29 29 23 13 29 15 18 14 12 20 51 46 8 23 9 32 13 19 51 38 38 19 27 26 20 16 27 23 9 18 12 51 15 10 5 12 20 19 21 28 24 8 15 15 15 14 5 5 14 15 22 28 32 22 28 15 25 13 23 6 7 20 19 9 32 13 12 35 9 33 39 35 21 4 6 6 10 14 35 30 8 11 6 19 42 44 31 4 4 7 16 4 44 29 7 9 30 35 14 9 13 28 33 26 34 25 19 31 23 23 25 33 6 4 4 3 11 17 26 20 23 37 31 25 6 16 19 10 7 11 16 6 7 4 22 18 4 6 9 24 6 23 5 21 36 37 37 26 5 7 18 22 17 6 7 17 14 14 12 19 23 6 12 16 27 8 20 4 5 16 24 23 8 21 7 15 24 6 8 5 30 8 16 26 8 26 15 17 5 23 4 12 16 24 6 17 9 5 4 3 8 12 12 6 7 4 5 6	Open. Hide. 61 47 52 49 61 61 26 19 13 12 18 8 12 26 20 19 28 41 52 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 59 59 59 59 59 61 61 61 61 61 61 38 39 43 49 30 28 30 35 36 36 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 59 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 61 61 61 61 59 61 59 59 59 59 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 55 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 59 61 52 59 59 52 59 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 61 59 59 52 59 43 55 59 59 61 59 61 61 59 61 52 59 59 59 55 55 52 43 52 52 61 61 61 61 61 61 55 61 61 61 52 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 52 61 61 61 61 61 61 52 61 61 55 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 50 55 55 49 50 49 55 50 55 50 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 61 61 61 61 47 38 61 61 53 61 61 61 47 61 61 43 61 61 61 61 61 61 50 50 50 50 50 47 61 61 61 61 61 43 43 61 61 61 61 53 39 61 53 61 61 50 61 61 61 61 61 61 53 61 61 61 61 61 52 50 52 39 50 47 61 45 53 53 52 47 39 53 53 57 57 53 53 53 57 53 47 53 53 45 42 42 42 24 22 34 53 53 53 42 53 53 47 53 53 57 57 53 53 45 50 47 38 42 45 53 57 53 53 46 57 53 50 57 39 52 53 53 53 43 38 52 35 53 52 40 45 48 41 37 50 38 38 50 43 52 53 57 57 20 57 57 50 50 50 45 45 45 46 57 33 43 52 45 37 45 35 30 21 22 22 27 34 53 52 41 21 23 27 57 43 23 17 57 47 46 34 34 52 50 50 41 52 52 52 53 33 25 20 47 23 44 30 31 46 37 37 34 13 26 37 57 37 48 48 27 25 42 37 53 36 53 57 57 26 20 18 31 43 52 29 25 40 17 17 23 24 36 53 45 39 35 25 35 24 57 33 20 48 33 37 29 41 48 36 53 40 41 37 30 24 40 40 37 32 41 57 30 30 44 48 30 29 32 41 9 16 28 32 29 38 29 41 40 47 46 45 19 29 30 14 25 29 33 25 39 30 29 26 31 33 18 39 10 38 20 25 29 19 27 29 25 10 22 17 12 21 25 29 13 47 29 9 14 20 38 29 29 24 29 25 27 12 51 43 43 33 41 18 21 33 39 46 46 51 5 13 9 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_12151903_12153038
seq2: B6Ng01-005F02.b_45_1154 (reverse)

seq1  AGAGCTCAGGCAGGCTCCTCTGTGGGAGAGCTCAGTGCTCTGCACCAAGT  50
                                |||||||||  ||||||| |||||
seq2  --------------------------AGAGCTCAGGACTCTGCA-CAAGT  23

seq1  CTTAGCCAGACAACAGGGAGATTCTAGGAAGTCAGCCAAAAACAAAAAAC  100
      | ||| ||||||||| ||||| ||||||||||||||   |||||||||||
seq2  C-TAG-CAGACAACA-GGAGA-TCTAGGAAGTCAGC---AAACAAAAAAC  66

seq1  TGTTCCGGGCTGTGAAGGTTTTCAGCTTTGGTTTCTTTGAACAACTTT-A  149
      ||| | || |||||||||||||||||||  |||||||||||||||||| |
seq2  TGTCCAGGACTGTGAAGGTTTTCAGCTT--GTTTCTTTGAACAACTTTAA  114

seq1  CCCTTATTTTT-ATTTTGTACTTTTTCCAT-CAG-ATGTGACCAAATAA-  195
      ||||||||||| ||||||||||||| |||| ||| ||||||||||| || 
seq2  CCCTTATTTTTAATTTTGTACTTTTCCCATCCAGAATGTGACCAAAAAAA  164

seq1  -GACAGTG-AGAAATCTGAGAAGCCCCACCT-CCCATGGCCTCATGAATG  242
        |||||| |||||||||||||||||||||| ||||||||||||||||||
seq2  GAACAGTGAAGAAATCTGAGAAGCCCCACCTCCCCATGGCCTCATGAATG  214

seq1  TTAGGCAAACGTGCTACCATTT-AGCACCAGCCCTGAGACCAAACTTGTC  291
      |||||||||||||||||||||| ||||||   ||||| ||||||||||||
seq2  TTAGGCAAACGTGCTACCATTTAAGCACCCAGCCTGAAACCAAACTTGTC  264

seq1  GCAGCTCTATCCCTTTCCTAACTGCTCAAAGATGGATCATACCGCCCCTT  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTCTATCCCTTTCCTAACTGCTCAAAGATGGATCATACCGCCCCTT  314

seq1  AGTGTTGTGCTGACCTCTTATAGTTCACCTGCCCCCACGGTAGACAG-GG  390
      ||||||||||||||||||||||||||||||||||||||||||||||| | 
seq2  AGTGTTGTGCTGACCTCTTATAGTTCACCTGCCCCCACGGTAGACAGAGA  364

seq1  AAAGGAAAATTGTGTTTGTGTCACTGATTTAGCCACATGAACATCATCTC  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAAAATTGTGTTTGTGTCACTGATTTAGCCACATGAACATCATCTC  414

seq1  ATCTCCCTTTCCTAAAGCTGAGGTCTCTAAAGTGCCATCTCATTGTGCTT  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCCCTTTCCTAAAGCTGAGGTCTCTAAAGTGCCATCTCATTGTGCTT  464

seq1  TGTATCAGTCAGTGCTAGAGAAATCTTGAATAGATTATATGAAAAAAAAA  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATCAGTCAGTGCTAGAGAAATCTTGAATAGATTATATGAAAAAAAAA  514

seq1  CTTTTAAAATTTTACATTATTTGATTTTTTTTTTTGTTTTGCTTTTTGGG  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTAAAATTTTACATTATTTGATTTTTTTTTTTGTTTTGCTTTTTGGG  564

seq1  GGTTGGGTTAGCTTGGCCAAGCCATTGGCAGTGAGAATTCTTTGCAGTCT  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGGGTTAGCTTGGCCAAGCCATTGGCAGTGAGAATTCTTTGCAGTCT  614

seq1  GTGGGGTAGTGGTGTGCTGATCTTTAAAGTGTCCCCACCTGTAGTGGCTA  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGGTAGTGGTGTGCTGATCTTTAAAGTGTCCCCACCTGTAGTGGCTA  664

seq1  TTCCTGGTTGTCAACTTGACTATATTTGGAATGAACTACAATCCAGAATT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGGTTGTCAACTTGACTATATTTGGAATGAACTACAATCCAGAATT  714

seq1  GGAAGGCCCACCAGTGACCATTATCTAGAGGCTTGGAGATAGAAGTTTCT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGCCCACCAGTGACCATTATCTAGAGGCTTGGAGATAGAAGTTTCT  764

seq1  GATCTGCATCTTGGTATGGAGATCTTGAGGCATAGTGGCTATGAATTCCA  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGCATCTTGGTATGGAGATCTTGAGGCATAGTGGCTATGAATTCCA  814

seq1  GAAGATTAAATCTCTGACTTCAAGGTCATCTGGGATTAAAGGTGTGGTGG  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGATTAAATCTCTGACTTCAAGGTCATCTGGGATTAAAGGTGTGGTGG  864

seq1  AACACGCCTTTAATCTGGGCTATACCTTCTGTTGGAGACAATATAAGGAC  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACGCCTTTAATCTGGGCTATACCTTCTGTTGGAGACAATATAAGGAC  914

seq1  ATTGGAAGAAGGGAGTCTTGCTCTTATTCCTTAGCCTGCTTGCTGTGTGA  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGAAGAAGGGAGTCTTGCTCTTATTCCTTAGCCTGCTTGCTGTGTGA  964

seq1  GGCTGAGTAACTGCTAGATCCTTGGACTTTCATTCACAGCTACTACTGAA  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGAGTAACTGCTAGATCCTTGGACTTTCATTCACAGCTACTACTGAA  1014

seq1  TCTATCGTCATGGTATTCCACACAGTATTGCTTCTGACCAAGGAACTCAT  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCGTCATGGTATTCCACACAGTATTGCTTCTGACCAAGGAACTCAT  1064

seq1  TTCACTGCCAGAGAAGTGGGACAGTGGGCCCAGGATCATGGAATTC  1136
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACTGCCAGAGAAGTGGGACAGTGGGCCCAGGATCATGGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information