MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-010I16
Chromosome	7 (Build37)
Map Location	49,501,755 - 49,502,880
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668561, EG434172, LOC100039221, LOC668565, AI987944, EG269902, LOC100039375, EG628359, 2610021A01Rik, 2810426N06Rik, LOC668576, Gprc2a-rs5, LOC628372, EG668579, EG628403, EG628422, Gprc2a-rs1, EG628444, EG434174, EG637913, EG434175, LOC100039556, EG637898
Downstream gene	Gprc2a-rs2, LOC434177, Vmn2r-ps60, 4933421I07Rik, LOC628503, BC063263, LOC100039449, EG637776, C330019L16Rik, EG434179, EG546965, LOC546964, LOC100039706, EG637572, LOC100039507, EG435975, LOC668606, EG668668, LOC100039543, LOC668612, LOC385199, LOC100039589, EG668620
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG434172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434172 MGI:3648691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC668565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	AI987944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG269902 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins pseudo : _no_value

name	EG628359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610021A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins

name	2810426N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins pseudo : _no_value

name	Gprc2a-rs5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG668579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668579 MGI:3645134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG628403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins

name	EG628422 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	Gprc2a-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110931 MGI:1351346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 Proteins

name	EG628444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628444 MGI:3643747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 Proteins

name	EG434174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434174 MGI:3648695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 631 ESTs, 26 Proteins

name	EG637913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637913 MGI:3647435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 2 Proteins pseudo : _no_value

name	EG434175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 274 ESTs, 42 Proteins

name	LOC100039556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins pseudo : _no_value

name	EG637898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins

name	Gprc2a-rs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	LOC434177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins

name	4933421I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins pseudo : _no_value

name	BC063263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins

name	LOC100039449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG637776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	C330019L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208111 MGI:3036263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434179 MGI:3648690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546965 MGI:3644564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC546964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100039706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	EG637572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637572 MGI:3648273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100039507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	EG435975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435975 MGI:3647107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC668606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668668 MGI:3648888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC668612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC385199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG668620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345369 GeneID:434172 MGI:3648691
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434172 transcript_id : NM_001033782.2

name	AI987944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130718 GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI987944 transcript_id : NM_183167.3

name	EG269902 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369995 GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG269902 transcript_id : NM_177764.3

name	EG628359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257209 GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG628359 transcript_id : XM_893095.3

name	2810426N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130493405 GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810426N06 gene transcript_id : NM_023363.2

name	Gprc2a-rs5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803327 GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 transcript_id : NM_029460.2

name	EG628403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257216 GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins product : predicted gene, EG628403 transcript_id : XM_893137.2

name	EG628422 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257218 GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG628422 transcript_id : XM_145558.7

name	Gprc2a-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257220 GeneID:110931 MGI:1351346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 Proteins product : G protein-coupled receptor, family C, group 2, member A, related sequence 1 transcript_id : XM_001002448.2

name	EG628444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257222 GeneID:628444 MGI:3643747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 Proteins product : predicted gene, EG628444 transcript_id : XM_893188.2

name	EG434174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257235 GeneID:434174 MGI:3648695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 631 ESTs, 26 Proteins product : predicted gene, EG434174 transcript_id : XM_485920.4

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380406 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 41 Proteins product : predicted gene, EG434175, transcript variant 1 transcript_id : XM_485921.3

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257236 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 116 ESTs, 17 Proteins product : predicted gene, EG434175, transcript variant 2 transcript_id : XM_900988.3

name	EG637898 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257226 GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins product : predicted gene, EG637898 transcript_id : XM_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257228 GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 transcript_id : XM_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257230 GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins product : vomeronasal receptor Vmn2r-ps60 transcript_id : XM_893241.3

name	4933421I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803397 GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933421I07 gene transcript_id : NM_027702.2

name	BC063263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380409 GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins product : cDNA sequence BC063263, transcript variant 1 transcript_id : XM_485924.4

name	EG637776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257246 GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG637776 transcript_id : XM_913547.3

name	C330019L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803517 GeneID:208111 MGI:3036263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330019L16 gene transcript_id : NM_001034857.2

name	EG434179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606034 GeneID:434179 MGI:3648690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434179 transcript_id : NM_001008427.1

name	LOC546964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257231 GeneID:546964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to putative pheromone receptor transcript_id : XM_001472972.1

name	LOC100039706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257248 GeneID:100039706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : similar to Predicted gene, EG434179 transcript_id : XM_001472741.1

name	LOC100039507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257233 GeneID:100039507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001473023.1

name	EG435975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905334 GeneID:435975 MGI:3647107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG435975 transcript_id : XM_488033.3

name	EG668668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922661 GeneID:668668 MGI:3648888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668668 transcript_id : NM_001081036.2

name	LOC668612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257238 GeneID:668612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to putative pheromone receptor transcript_id : XM_001473135.1

name	EG668620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257184 GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668620 transcript_id : XM_001002654.2

name	EG434172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702095 GeneID:434172 MGI:3648691
definition	codon_start : 1 product : hypothetical protein LOC434172 protein_id : NP_001028954.1

name	AI987944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147201 GeneID:233168 MGI:2142079
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233168 protein_id : NP_898990.1

name	EG269902 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244266 GeneID:269902 MGI:3703084
definition	codon_start : 1 product : hypothetical protein LOC269902 protein_id : NP_808432.1

name	EG628359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257210 GeneID:628359 MGI:3643456
definition	codon_start : 1 product : similar to EG435970 protein protein_id : XP_898188.3

name	2810426N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789173 GeneID:67607 MGI:1914857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67607 protein_id : NP_075852.1

name	Gprc2a-rs5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386402 GeneID:75835 MGI:1351350
definition	codon_start : 1 note : calcium sensing receptor, related sequence 5 product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 protein_id : NP_083736.1

name	EG628403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257217 GeneID:628403 MGI:3647693
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898230.2

name	EG628422 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257219 GeneID:628422 MGI:3647877
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_145558.7

name	Gprc2a-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257221 GeneID:110931 MGI:1351346
definition	codon_start : 1 note : overriding stop codons product : similar to putative pheromone receptor protein_id : XP_001002448.2 transl_except : (pos:complement(49223613..49223615),aa:OTHER)

name	EG628444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257223 GeneID:628444 MGI:3643747
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898281.2

name	EG434174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762947 GeneID:434174 MGI:3648695
definition	codon_start : 1 product : similar to high-mobility group box 1 protein_id : XP_485920.1

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905069 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 2 protein_id : XP_906081.1

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762951 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 1 protein_id : XP_485921.1

name	EG637898 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257227 GeneID:637898 MGI:3647050
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257229 GeneID:637873 MGI:1351347
definition	codon_start : 1 product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 protein_id : XP_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82905313 GeneID:628490
definition	codon_start : 1 product : similar to calcium-sensing receptor related protein 2 protein_id : XP_898334.1

name	4933421I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386252 GeneID:71162 MGI:1918412
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71162 protein_id : NP_081978.1

name	BC063263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762957 GeneID:434178 MGI:3584269
definition	codon_start : 1 product : similar to ZNF91L isoform 1 protein_id : XP_485924.1

name	EG637776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257247 GeneID:637776 MGI:3645327
definition	codon_start : 1 product : hypothetical protein protein_id : XP_918640.3

name	C330019L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702187 GeneID:208111 MGI:3036263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208111 protein_id : NP_001030029.1

name	EG434179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606035 GeneID:434179 MGI:3648690
definition	codon_start : 1 product : hypothetical protein LOC434179 protein_id : NP_001008427.1

name	LOC546964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257232 GeneID:546964
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001473022.1

name	LOC100039706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257249 GeneID:100039706
definition	codon_start : 1 product : similar to Predicted gene, EG434179 protein_id : XP_001472791.1

name	LOC100039507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257234 GeneID:100039507
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001473073.1

name	EG435975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905335 GeneID:435975 MGI:3647107
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_488033.3

name	EG668668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486640 GeneID:668668 MGI:3648888
definition	codon_start : 1 product : predicted gene, EG668668 protein_id : NP_001074505.1

name	LOC668612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257239 GeneID:668612
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001473185.1

name	EG668620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257185 GeneID:668620 MGI:3643075
definition	codon_start : 1 product : hypothetical protein LOC435970 protein_id : XP_001002654.2

name	LOC668561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668561
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 1 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 3 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 4 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 3 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 2 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 1 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 2 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 1 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 4 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 3 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 2 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 2 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 1 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 2 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 3 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 4 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 5 pseudo : _no_value

name	EG637572 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637572
definition	number : 1 pseudo : _no_value

name	EG637572 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637572
definition	number : 2 pseudo : _no_value

name	LOC668606 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668606
definition	number : 1 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 3 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 2 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 1 pseudo : _no_value

name	LOC385199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385199
definition	number : 1 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 1 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 2 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 3 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 4 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 5 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 6 pseudo : _no_value

name	LOC668565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257208 GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to protein kinase C binding protein 1 pseudo : _no_value transcript_id : XR_030730.1

name	LOC100039375 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257224 GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins product : similar to ornithine decarboxylase pseudo : _no_value transcript_id : XR_030737.1

name	2610021A01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257214 GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins product : RIKEN cDNA 2610021A01 gene transcript_id : XR_030795.1

name	LOC668576 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257215 GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins product : similar to Phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_035655.1

name	EG637913 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257225 GeneID:637913 MGI:3647435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 2 Proteins product : predicted gene, EG637913 pseudo : _no_value transcript_id : XR_002212.2

name	LOC100039556 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257237 GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_030800.1

name	LOC628503 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257242 GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_030821.1

clone name	MSMg01-337G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-473P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476O09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-518H02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413B09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-181L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-010I16.b	B6Ng01-010I16.g
ACC	DH846183	DH846184
length	1,112	1,108
definition	DH846183\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010I16, 5' end.	DH846184\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010I16, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaacataatacctgacacactaaattaagagaagataaattgggg aactcccttgaaatctttggtacaagggacaactttctgaacagaacaac aatagcctaggcactaaatcaacaactaataaatttgagctcatgtaata taaatgcttttgctaggctaagaacattatcaataggataaaacagccac ctggggaataagaaaggtacattcaacaaaggtctaatatccaaaattta caaggaactcaagaaattagatgtcaacaagcgaaataagccaattaaaa aatgggatactgagctaaacagagaatgctcaatagtgggatctcaaata aaataataaattattggaagaaaagtgaaataaaatgttttcaaagaaat actttttataaaatttttctgtgtctagtaatatgcaatctgatttatga cttacatgttatatatggttgatttatctttttctgttcctattcaatat cctagcttaattctcatcatctagttccctaaattcatttacactataca ggaattattttcactaattctttttgatacacgaattttgtattgtgaac atcctggccaagaactatcaatgttagtcaggtgtgttggtgcacacctt taatcctagcacttgggaggcaggggcaggcggatttctgagtttgaggc cagcctggtctacaaagtgagttccaggacagccagggctacacagagat accttgtctcaaaaaaccaaaaataaataaacaaataaataaaaaataaa aaataaaagaactagcaatgttttcactcaaatgtgtatagtttcagtag ttcaagtacatgaagatatctctagtttatcattcaacaattcaataatg cagttacatgacattgtttctttttcctttttgtcacagacatgatttaa tattaatctatgtaatagtgtcaaacattctgtaatgtgtttatatgtca tagaccacatggtctggatgtcttaatgattattatcacattcttaaatg tttaaaatcatctgtatgggtgacatttatatggaaattctagaaaccca tgtgttattaac	gaattctctggctttgtttcccatttttaattggggcttatttcacttga tgtatctaacttcttgagttctttgtaaattttgaatattagacctctgt tgaatgtacagttagtgaagatcttttcccattctctgggttgctgtttt atcctattgatgatatccttagcctggtaaaagctttttcattacatgag gtcaaatttattaatttattaattgttgattaattgttgatctgttcagg aggttggctcttgtgccaatgagttcaaggcagttcaatttatcatctat tatatttagtgtgtcaggaattatgttgagttatttaatccatttggact tgagttacgtgcagggtgataaatatggctttatttacattcttctctat ccacacatccagttagaccagagctgaagatgtgtccttttttccattgt atagctttggctactttgtcaaacatcaagtgtccataggagggaaggtt gatttttttggtgattttttttctttttctttattagatattttctttat ttacatttcaaatgttatctcttttcctattttcccctccaaaaatcccc tatcctctcccctcttcccctgccccccaaccttcccacttgaagtgtcc aaaatttggtcttccttcttgagtttcacatggtttgcaaattgtatctt gggtgctgtaacttctggcctaatatccacttatcactgagtgcatatca tgtgagtttgactccagaaatccaaataacactattcaaatgggatgcag ttctaaagaaagaattatcaattgaggaataccaatggctgagagcacaa aaaagaaaaaaaattcaacatccttaatctcagggaatgcaatcaaacac ctgagattcacttcatgccagcagatgctaagatcaaaacccagtaacag catttgctgggcaaagatatgagaagaaggtaccactggctcatatactg gtaggatgcaggctgtcatgactctagaaaatagttgggattctcaaaat ggacatagtctacgtggaagatcgcagactcctgctcggcgctatgacga cagagtga
quality values	Open. Hide. 57 41 31 47 52 27 17 14 24 17 24 17 14 43 43 50 50 37 55 38 43 24 31 19 28 29 24 19 26 41 41 37 37 52 55 39 52 52 36 49 28 43 52 49 52 52 59 52 59 59 59 52 52 52 52 52 52 49 49 52 37 59 49 52 52 43 49 45 59 59 49 52 59 43 36 36 59 52 59 49 41 49 52 52 52 52 49 49 52 59 49 52 43 36 59 59 59 52 45 59 38 45 52 59 39 45 49 45 45 28 52 52 52 59 59 52 49 49 49 49 43 41 59 52 52 59 38 38 39 38 43 43 49 52 52 49 52 59 41 52 59 59 59 59 59 59 52 59 59 59 59 45 52 49 52 59 49 45 45 45 45 49 43 59 59 39 59 43 52 45 45 31 59 59 52 45 52 52 50 52 52 37 43 52 52 39 52 59 49 49 49 49 52 52 39 39 49 52 43 59 52 49 59 45 59 52 59 59 52 52 59 59 59 49 52 45 59 43 45 59 41 52 49 52 39 41 39 39 39 45 36 61 49 52 52 59 52 52 59 52 49 49 43 49 49 59 52 59 59 49 59 49 59 45 59 59 59 59 59 52 59 52 49 61 52 52 45 43 43 19 49 37 59 52 52 45 52 59 49 36 36 43 36 52 49 52 43 43 43 36 43 52 52 59 59 59 59 59 59 43 59 59 59 61 59 52 59 52 59 59 52 59 52 36 43 41 36 43 55 52 52 36 55 43 52 55 52 55 52 49 52 49 49 52 52 43 52 55 55 55 61 55 55 52 52 43 43 52 52 55 55 55 55 55 52 52 52 52 52 52 52 52 52 52 52 55 52 55 55 41 55 49 52 52 39 41 52 52 52 52 52 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 50 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 50 61 47 61 53 53 61 53 61 53 53 61 61 61 61 61 61 45 61 61 61 53 53 61 61 61 61 61 61 61 52 61 61 61 61 61 53 50 52 61 50 61 53 61 47 53 53 42 46 53 45 47 32 57 57 57 57 57 57 53 47 53 53 57 47 57 53 38 42 40 57 39 57 53 47 52 52 57 52 46 57 53 47 34 47 53 47 53 53 53 47 53 45 57 52 57 40 53 57 52 45 57 46 50 53 50 53 53 53 57 43 45 45 42 53 53 43 53 45 39 40 40 52 38 47 57 50 52 23 57 21 43 24 57 57 53 38 45 37 47 38 45 47 37 43 53 45 50 52 42 52 30 37 53 50 45 53 17 47 34 52 24 30 43 45 18 20 10 7 18 23 33 33 29 57 33 38 41 45 53 28 37 28 35 31 29 29 47 39 18 45 50 47 34 28 45 53 57 30 41 27 50 33 40 21 33 41 29 37 32 34 37 33 40 34 53 32 42 37 40 50 37 52 50 52 30 30 52 34 37 37 26 23 22 16 18 27 35 35 53 32 53 23 39 18 53 32 53 25 29 16 53 53 53 37 34 53 53 57 57 53 53 43 53 34 44 17 23 30 23 24 39 37 30 39 39 33 30 37 25 6 38 41 37 48 20 35 31 40 16 57 21 29 41 31 37 25 31 35 34 34 24 25 15 19 15 23 24 21 24 31 37 36 40 22 29 37 20 39 18 44 35 41 39 15 29 10 8 13 27 35 36 29 28 34 39 51 23 27 23 32 18 29 29 31 12 33 34 22 23 29 12 27 30 11 16 31 21 18 29 14 22 17 27 21 16 28 14 28 31 24 10 13 24 19 30 19 24 13 11 8 20 31 51 29 13 18 8 5 5 12 15 11 11 27 15 24 39 20 35 22 20 23 27 20 19 46 33 31 28 29 23 8 32 19 29 28 29 27 12 9 29 15 36 6 9 24 7 11 29 21 31 18 51 29 20 6 20 9 22 15 33 21 10 26 23 33 30 13 27 51 25 20 12 15 8 23 9 12 20 27 41 14 28 8 17 12 10 8 20 12 27 28 34 38 15 9 22 19 27 16 20 9 28 29 29 15 22 31 26 6 5 9 8 12 7 9 9 19 9 22 17 30 12 30 17 38 22 9 10 23 38 9 36 31 51 11 7 20 5 5 20 12 35 7 6 6 15 14 10 18 22 15 13 9 18 8 9 5 12 6 7 5 7 13 32 17 9 22 5 7 18 4 4 29 10 5 33 23 9 7 5 6 18 7 15 15 4 17 14 5 5	Open. Hide. 61 47 45 38 55 50 49 43 41 49 30 36 49 43 43 52 31 36 35 35 36 35 35 49 52 52 52 45 45 43 37 52 59 52 59 59 52 52 43 52 52 52 52 49 43 49 52 52 52 49 45 52 39 39 44 45 38 30 31 37 37 36 43 31 39 52 49 49 52 49 52 39 36 35 35 27 35 31 36 39 36 39 34 43 49 45 45 43 49 45 45 28 49 45 45 45 45 49 59 52 45 52 44 45 49 59 35 32 49 43 43 43 39 38 28 31 41 38 45 28 59 52 45 36 52 52 52 52 59 52 41 49 52 52 43 49 43 49 49 59 59 52 59 59 61 61 52 52 49 49 45 49 49 45 39 43 45 49 45 36 35 44 52 45 43 49 52 49 44 35 35 30 43 49 45 52 43 39 45 49 45 39 36 45 45 45 49 43 43 45 39 45 43 43 52 39 52 52 59 39 59 41 59 43 45 45 44 35 39 39 39 36 39 36 41 45 38 36 39 36 37 49 41 44 52 36 39 45 49 43 38 39 39 49 52 59 36 36 36 41 49 41 41 52 39 41 52 38 23 49 44 26 49 27 39 52 49 36 39 45 39 41 49 36 45 43 39 34 39 49 59 59 49 52 52 49 39 45 45 59 39 39 33 39 36 39 33 31 41 45 49 36 36 37 29 39 43 45 49 49 49 43 49 43 49 45 43 39 36 36 59 49 59 43 49 49 59 61 52 52 49 49 43 52 59 52 43 52 52 45 52 49 38 43 36 35 33 43 39 49 52 45 52 49 49 43 49 59 41 41 43 36 39 30 49 36 36 43 33 39 49 43 33 28 52 49 33 52 52 43 41 49 36 43 41 43 49 52 43 52 49 49 33 43 41 41 30 36 36 52 52 52 43 52 52 49 52 52 52 52 55 47 41 55 49 55 43 55 52 49 39 41 49 52 43 37 52 52 49 43 37 55 41 55 61 55 55 52 49 61 55 55 55 55 52 52 55 52 55 61 61 61 61 50 37 35 50 50 55 47 55 55 43 34 43 50 49 50 55 50 50 55 50 43 50 50 50 50 49 61 49 55 55 55 49 55 50 49 49 49 55 61 49 36 36 29 49 37 23 43 43 31 61 61 61 61 43 61 49 50 52 47 61 50 50 50 50 50 50 53 47 47 50 47 47 50 43 50 50 50 50 50 50 45 50 50 32 32 43 32 27 38 39 35 43 52 32 61 38 45 39 50 45 43 39 42 45 40 50 41 50 47 38 43 39 50 38 38 32 38 29 38 45 47 47 39 47 61 53 61 61 50 61 38 35 35 35 24 42 52 47 47 53 53 47 47 47 53 50 33 24 47 43 50 50 40 42 45 39 39 47 53 52 53 50 47 47 39 45 38 42 42 38 45 50 50 47 47 39 42 47 53 21 42 32 38 34 31 28 32 35 45 38 38 28 28 32 38 50 47 47 36 53 40 35 35 43 34 38 28 31 45 45 34 52 46 47 52 38 14 32 42 23 23 30 37 23 38 45 52 53 45 34 52 52 47 40 29 45 40 52 52 50 37 45 45 36 45 18 34 44 45 53 52 24 52 38 37 23 52 53 42 53 50 52 32 53 24 12 43 33 30 30 23 33 39 47 31 10 43 23 52 30 35 47 50 28 24 18 24 32 35 38 42 40 30 33 30 34 25 24 29 42 42 40 25 19 34 29 18 30 45 37 36 53 20 41 37 31 36 31 27 32 36 36 30 20 38 53 24 40 25 37 37 27 27 29 32 29 29 16 35 31 33 23 25 21 26 10 33 34 30 28 27 8 7 26 24 27 8 38 19 19 30 26 45 36 27 43 45 31 12 27 15 26 19 20 36 29 30 14 30 41 30 32 29 26 47 32 24 29 30 19 16 16 9 31 18 18 48 28 45 5 11 4 6 6 37 5 6 8 5 5 6 4 8 6 6 16 7 8 7 6 11 21 21 20 6 7 10 19 21 11 7 29 25 20 30 10 14 21 13 14 29 18 29 39 25 20 9 10 15 28 21 28 9 13 22 32 23 13 12 23 21 11 10 6 17 19 15 12 12 24 20 12 10 23 20 20 23 10 7 11 8 30 11 32 10 19 28 33 11 16 13 25 31 51 51 20 13 11 13 11 38 15 32 14 17 20 23 20 6 6 34 25 19 16 8 11 34 15 9 17 30 29 8 25 9 8 4 6 4 6 39 17 13 9 11 6 24 13 19 9 6 9 19 31 15 13 17 17 32 9 15 6 12 13 30 18 9 10 17 10 22 9 15 22 12 23 23 9 23 8 14 3 1 3 3 1 3 4 4 9 6 4 3 6 4 30 26 18 12 3 3 4 2 9 4 3 1 4 3 4 5 5 10 6 8 16 4 6 13 19 6 5 4 7 3 4 5 7 7 12 4 3 6 9 27 12 5 8 5 24 4 12 5 4 3 3 4 10 4 6 6 14 7 14 16 14 5 4 3 6 18 7 7 6 17 4 14 5 4 6 12 3 5 5 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_49501755_49502880
seq2: B6Ng01-010I16.b_43_1154 (reverse)

seq1  GTTAATTTAACACATGGGTTTCTTATGAAATTTCAATAATAAATGTCACC  50
      |||||  |||||||||||||||   |  |||||| || ||||||||||||
seq2  GTTAA--TAACACATGGGTTTC---TAGAATTTCCAT-ATAAATGTCACC  44

seq1  CATACAGATGATTTTTAAACATTAAAGAATGTGATAATAATCATTAAGAC  100
      ||||||||||| ||||||||||| ||||||||||||||||||||||||||
seq2  CATACAGATGA-TTTTAAACATTTAAGAATGTGATAATAATCATTAAGAC  93

seq1  ATCAAGACCAATGT-GTCTATGACATATAAACAACATTAACAGAATGTTT  149
      ||| ||||| |||| ||||||||||||||||| ||||| |||||||||||
seq2  ATCCAGACC-ATGTGGTCTATGACATATAAAC-ACATT-ACAGAATGTTT  140

seq1  GACACTTATTACATAGATTAATATTAAATCATGTCTTGTGACAAATAGGA  199
      ||||| ||||||||||||||||||||||||||||| ||||||||| ||||
seq2  GACAC-TATTACATAGATTAATATTAAATCATGTC-TGTGACAAAAAGGA  188

seq1  AAAATGAAACAATGTCATGTAACTGCATTATTGAATTGTTGAATGATAAA  249
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAA-GAAACAATGTCATGTAACTGCATTATTGAATTGTTGAATGATAAA  237

seq1  CTAGAGATATCTTCATGTACTTGAACTACTGAAACTATACACATTTGAGT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGAGATATCTTCATGTACTTGAACTACTGAAACTATACACATTTGAGT  287

seq1  GAAAACATTGCTAGTTCTTTTATTTTTTTATTTTTTATTTATTTGTTTAT  349
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GAAAACATTGCTAGTTCTTTTA-TTTTTTATTTTTTATTTATTTGTTTAT  336

seq1  TTATTTTTTGGTTTTTTGAGACAAGGTATCTCTGTGTAGCCCTGGCTGTC  399
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTA-TTTTTGGTTTTTTGAGACAAGGTATCTCTGTGTAGCCCTGGCTGTC  385

seq1  CTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAAATCCGCCT  435

seq1  GCCCCTGCCTCCCAAGTGCTAGGATTAAAGGTGTGCACCAACACACCTGA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCTGCCTCCCAAGTGCTAGGATTAAAGGTGTGCACCAACACACCTGA  485

seq1  CTAACATTGATAGTTCTTGGCCAGGATGTTCACAATACAAAATTCGTGTA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACATTGATAGTTCTTGGCCAGGATGTTCACAATACAAAATTCGTGTA  535

seq1  TCAAAAAGAATTAGTGAAAATAATTCCTGTATAGTGTAAATGAATTTAGG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAAAGAATTAGTGAAAATAATTCCTGTATAGTGTAAATGAATTTAGG  585

seq1  GAACTAGATGATGAGAATTAAGCTAGGATATTGAATAGGAACAGAAAAAG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAGATGATGAGAATTAAGCTAGGATATTGAATAGGAACAGAAAAAG  635

seq1  ATAAATCAACCATATATAACATGTAAGTCATAAATCAGATTGCATATTAC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATCAACCATATATAACATGTAAGTCATAAATCAGATTGCATATTAC  685

seq1  TAGACACAGAAAAATTTTATAAAAAGTATTTCTTTGAAAACATTTTATTT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACACAGAAAAATTTTATAAAAAGTATTTCTTTGAAAACATTTTATTT  735

seq1  CACTTTTCTTCCAATAATTTATTATTTTATTTGAGATCCCACTATTGAGC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTTTCTTCCAATAATTTATTATTTTATTTGAGATCCCACTATTGAGC  785

seq1  ATTCTCTGTTTAGCTCAGTATCCCATTTTTTAATTGGCTTATTTCGCTTG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCTGTTTAGCTCAGTATCCCATTTTTTAATTGGCTTATTTCGCTTG  835

seq1  TTGACATCTAATTTCTTGAGTTCCTTGTAAATTTTGGATATTAGACCTTT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACATCTAATTTCTTGAGTTCCTTGTAAATTTTGGATATTAGACCTTT  885

seq1  GTTGAATGTACCTTTCTTATTCCCCAGGTGGCTGTTTTATCCTATTGATA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAATGTACCTTTCTTATTCCCCAGGTGGCTGTTTTATCCTATTGATA  935

seq1  ATGTTCTTAGCCTAGCAAAAGCATTTATATTACATGAGCTCAAATTTATT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTCTTAGCCTAGCAAAAGCATTTATATTACATGAGCTCAAATTTATT  985

seq1  AGTTGTTGATTTAGTGCCTAGGCTATTGTTGTTCTGTTCAGAAAGTTGTC  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGTTGATTTAGTGCCTAGGCTATTGTTGTTCTGTTCAGAAAGTTGTC  1035

seq1  CCTTGTACCAAAGATTTCAAGGGAGTTCCCCAATTTATCTTCTCTTAATT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGTACCAAAGATTTCAAGGGAGTTCCCCAATTTATCTTCTCTTAATT  1085

seq1  TAGTGTGTCAGGTATTATGTTGAATTC  1126
      |||||||||||||||||||||||||||
seq2  TAGTGTGTCAGGTATTATGTTGAATTC  1112

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information