MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-010N08
Chromosome	7 (Build37)
Map Location	13,138,334 - 13,139,414
singlet/doublet	singlet
Overlap gene	2900092C05Rik
Upstream gene	LOC100042386, LOC665926, LOC637571, LOC100043042, LOC628853, V1rg1, V1rg2, EG628898, V1rg5, V1rg6, LOC665999, V1rg4, LOC100042423, LOC628946, LOC100043075, LOC100042433, V1rg7, LOC100042437, V1rg3, LOC100042446, LOC100043092, V1rg9, V1rg12, V1rg8, V1rg11, Zfp551, EG666065, Zfp606
Downstream gene	EG637908, EG666085, Vmn2r55, LOC629079, LOC629081, EG232875, LOC100043128, LOC100042515, Zfp329, Zfp110, Zfp128, Zscan22, Rps5, 2310014L17Rik, 1810019N24Rik, Zfp324, Zfp446, Slc27a5, ZBTB45, LOC100042553, Trim28, Chmp2a, Ube2m, Mzf1, V1rj3, LOC100043156, V1rk1, LOC666177, EG232887, V1rj2, 6330408A02Rik, Lig1, Pla2g4c, LOC666225, Cabp5, LOC666232, Gm767, LOC666243
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins pseudo : _no_value

name	LOC637571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	LOC100043042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC628853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	V1rg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins pseudo : _no_value

name	V1rg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	V1rg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	LOC100043075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1rg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171242 MGI:2159646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	V1rg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042446 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043092 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	V1rg9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rg11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619331 MGI:3588205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666065 MGI:3644790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Zfp606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2900092C05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73090 MGI:1920340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG637908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637908 MGI:3644480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG666085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666085 MGI:3704110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r55 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins

name	LOC629079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC629081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	EG232875 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232875 MGI:3643810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs, 3 Proteins

name	LOC100043128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 24 Proteins pseudo : _no_value

name	LOC100042515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 11 Proteins

name	Zfp329 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67230 MGI:1921283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65020 MGI:1890378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243833 MGI:2389445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232878 MGI:2443312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20103 MGI:1097682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310014L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381845 MGI:1924198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810019N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69086 MGI:1916336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243834 MGI:2444641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269870 MGI:2442185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26459 MGI:1347100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ZBTB45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232879 MGI:2685003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	Trim28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21849 MGI:109274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chmp2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68953 MGI:1916203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22192 MGI:108278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mzf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109889 MGI:107457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rj3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252909 MGI:2182262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1rk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171261 MGI:2159698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG232887 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232887 MGI:3648111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 77 ESTs, 1 Protein

name	V1rj2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171260 MGI:2159697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330408A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321008 MGI:2447816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lig1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16881 MGI:101789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pla2g4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232889 MGI:1196403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cabp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29865 MGI:1352746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	Gm767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330470 MGI:2685613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256406 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : similar to CG2712-PA, transcript variant 1 transcript_id : XM_001479610.1

name	LOC100043042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256408 GeneID:100043042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs product : similar to CG2712-PA, transcript variant 2 transcript_id : XM_001479616.1

name	V1rg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003893 GeneID:252905 MGI:2182256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G1 transcript_id : NM_145843.1

name	V1rg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717720 GeneID:171237 MGI:2159641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G2 transcript_id : NM_134203.1

name	V1rg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717734 GeneID:171240 MGI:2159644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G5 transcript_id : NM_134206.1

name	V1rg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717728 GeneID:171241 MGI:2159645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G6 transcript_id : NM_134207.1

name	V1rg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821682 GeneID:171239 MGI:2159643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G4 transcript_id : NM_134205.2

name	LOC628946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256422 GeneID:628946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : similar to vomeronasal V1r-type receptor V1rg16 transcript_id : XM_001479628.1

name	V1rg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717738 GeneID:171242 MGI:2159646
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G7 transcript_id : NM_134208.1

name	LOC100042437 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256137 GeneID:100042437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : similar to vomeronasal receptor V1RG10 transcript_id : XM_001478204.1

name	V1rg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300966 GeneID:171238 MGI:2159642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G3 transcript_id : NM_134204.2

name	LOC100043092 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256434 GeneID:100043092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043092 transcript_id : XM_001479642.1

name	V1rg9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717742 GeneID:171244 MGI:2159648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G9 transcript_id : NM_134210.1

name	V1rg12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717776 GeneID:171268 MGI:2159656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G12 transcript_id : NM_134234.1

name	V1rg8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717732 GeneID:171243 MGI:2159647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G8 transcript_id : NM_134209.1

name	V1rg11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717782 GeneID:171267 MGI:2159655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G11 transcript_id : NM_134233.1

name	Zfp551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802370 GeneID:619331 MGI:3588205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingr protein 551 transcript_id : NM_001033820.2

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129854 GeneID:67370 MGI:1914620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_026112.3

name	Zfp606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90265806 GeneID:67370 MGI:1914620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 606 transcript_id : NM_001039951.1

name	2900092C05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370547 GeneID:73090 MGI:1920340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900092C05 gene transcript_id : NM_028434.2

name	EG666085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517669 GeneID:666085 MGI:3704110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666085 transcript_id : NM_001081449.1

name	Vmn2r55 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256147 GeneID:100042499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins product : vomeronasal receptor Vmn2r55 transcript_id : XM_001478322.1

name	LOC629079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256149 GeneID:629079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to V2R receptor transcript_id : XM_893901.2

name	EG232875 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256152 GeneID:232875 MGI:3643810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 44 ESTs, 3 Proteins product : predicted gene, EG232875 transcript_id : XM_001478350.1

name	LOC100042515 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256154 GeneID:100042515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 11 Proteins product : similar to hCG26831 transcript_id : XM_001478362.1

name	Zfp329 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133505150 GeneID:67230 MGI:1921283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 329 transcript_id : NM_026046.3

name	Zfp110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734473 GeneID:65020 MGI:1890378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 110 transcript_id : NM_022981.3

name	Zfp128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863764 GeneID:243833 MGI:2389445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 128 transcript_id : NM_153802.3

name	Zscan22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374570 GeneID:232878 MGI:2443312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 22 transcript_id : NM_001001447.2

name	Rps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677806 GeneID:20103 MGI:1097682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S5 transcript_id : NM_009095.1

name	2310014L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037476 GeneID:381845 MGI:1924198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310014L17 gene transcript_id : NM_029809.1

name	1810019N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256158 GeneID:69086 MGI:1916336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1810019N24 gene transcript_id : XM_001478400.1

name	Zfp324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118255 GeneID:243834 MGI:2444641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 324 transcript_id : NM_178732.3

name	Zfp446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803275 GeneID:269870 MGI:2442185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 446 transcript_id : NM_175558.3

name	Slc27a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678010 GeneID:26459 MGI:1347100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 5 transcript_id : NM_009512.1

name	ZBTB45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701533 GeneID:232879 MGI:2685003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 45 transcript_id : NM_001024699.1

name	LOC100042553 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256160 GeneID:100042553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : hypothetical protein LOC100042553 transcript_id : XM_001478426.1

name	Trim28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349667 GeneID:21849 MGI:109274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 28 transcript_id : NM_011588.2

name	Chmp2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367036 GeneID:68953 MGI:1916203
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin modifying protein 2A transcript_id : NM_026885.2

name	Ube2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704161 GeneID:22192 MGI:108278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) transcript_id : NM_145578.1

name	Mzf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281742 GeneID:109889 MGI:107457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid zinc finger 1 transcript_id : NM_145819.1

name	V1rj3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003905 GeneID:252909 MGI:2182262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, J3 transcript_id : NM_145847.1

name	V1rk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717770 GeneID:171261 MGI:2159698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, K1 transcript_id : NM_134227.1

name	EG232887 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256456 GeneID:232887 MGI:3648111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 77 ESTs, 1 Protein product : predicted gene, EG232887 transcript_id : XM_124858.7

name	V1rj2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717760 GeneID:171260 MGI:2159697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, J2 transcript_id : NM_134226.1

name	6330408A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50053998 GeneID:321008 MGI:2447816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330408A02 gene transcript_id : NM_177312.3

name	Lig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892265 GeneID:16881 MGI:101789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase I, DNA, ATP-dependent transcript_id : NM_010715.2

name	Lig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892806 GeneID:16881 MGI:101789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase I, DNA, ATP-dependent transcript_id : NM_001083188.1

name	Pla2g4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345222 GeneID:232889 MGI:1196403
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVC (cytosolic, calcium-independent) transcript_id : NM_001004762.2

name	Cabp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802239 GeneID:29865 MGI:1352746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 5 transcript_id : NM_013877.3

name	Gm767 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363657 GeneID:330470 MGI:2685613
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 767, (NCBI) transcript_id : NM_001033418.2

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256407 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479660.1

name	LOC100043042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256409 GeneID:100043042
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479666.1

name	V1rg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003894 CCDS:CCDS20799.1 GeneID:252905 MGI:2182256
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, G1 protein_id : NP_665842.1

name	V1rg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717721 CCDS:CCDS20800.1 GeneID:171237 MGI:2159641
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G2 protein_id : NP_598964.1

name	V1rg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717735 CCDS:CCDS20801.1 GeneID:171240 MGI:2159644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G5 protein_id : NP_598967.1

name	V1rg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717729 CCDS:CCDS20802.1 GeneID:171241 MGI:2159645
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G6 protein_id : NP_598968.1

name	V1rg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821683 CCDS:CCDS20803.1 GeneID:171239 MGI:2159643
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G4 protein_id : NP_598966.2

name	LOC628946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256423 GeneID:628946
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1rg16 protein_id : XP_001479678.1

name	V1rg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717739 CCDS:CCDS20804.1 GeneID:171242 MGI:2159646
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, G7 protein_id : NP_598969.1

name	LOC100042437 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256138 GeneID:100042437
definition	codon_start : 1 product : similar to vomeronasal receptor V1RG10 protein_id : XP_001478254.1

name	V1rg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300967 CCDS:CCDS20805.1 GeneID:171238 MGI:2159642
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G3 protein_id : NP_598965.2

name	LOC100043092 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256435 GeneID:100043092
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479692.1

name	V1rg9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717743 CCDS:CCDS20806.1 GeneID:171244 MGI:2159648
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G9 protein_id : NP_598971.1

name	V1rg12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717777 GeneID:171268 MGI:2159656
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G12 protein_id : NP_598995.1

name	V1rg8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717733 CCDS:CCDS20807.1 GeneID:171243 MGI:2159647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G8 protein_id : NP_598970.1

name	V1rg11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717783 CCDS:CCDS20808.1 GeneID:171267 MGI:2159655
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, G11 protein_id : NP_598994.1

name	Zfp551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702167 CCDS:CCDS20809.1 GeneID:619331 MGI:3588205
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc fingr protein 551 protein_id : NP_001028992.1

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328284 CCDS:CCDS20810.1 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 606 isoform 1 protein_id : NP_080388.2

name	Zfp606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90265807 GeneID:67370 MGI:1914620
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 606 isoform 2 protein_id : NP_001035040.1

name	2900092C05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469013 CCDS:CCDS20811.1 GeneID:73090 MGI:1920340
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73090 protein_id : NP_082710.1

name	EG666085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517670 GeneID:666085 MGI:3704110
definition	codon_start : 1 note : V2R receptor product : predicted gene, EG666085 protein_id : NP_001074918.1

name	Vmn2r55 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256148 GeneID:100042499
definition	codon_start : 1 product : similar to V2R receptor protein_id : XP_001478372.1

name	LOC629079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256150 GeneID:629079
definition	codon_start : 1 product : similar to V2R receptor protein_id : XP_898994.2

name	EG232875 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256153 GeneID:232875 MGI:3643810
definition	codon_start : 1 product : hypothetical protein LOC232875 protein_id : XP_001478400.1

name	LOC100042515 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256155 GeneID:100042515
definition	codon_start : 1 product : similar to hCG26831 protein_id : XP_001478412.1

name	Zfp329 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037393 CCDS:CCDS20813.1 GeneID:67230 MGI:1921283
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 329 protein_id : NP_080322.2

name	Zfp110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734474 CCDS:CCDS20814.1 GeneID:65020 MGI:1890378
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neurotrophin receptor interacting factor product : zinc finger protein 110 protein_id : NP_075357.3

name	Zfp128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418923 CCDS:CCDS20815.1 GeneID:243833 MGI:2389445
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030509 - BMP signaling pathway [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : zinc finger protein 8 product : zinc finger protein 128 protein_id : NP_722497.1

name	Zscan22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47824880 CCDS:CCDS20816.1 GeneID:232878 MGI:2443312
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : GLI-Kruppel family member HKR2 protein_id : NP_001001447.1

name	Rps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677807 CCDS:CCDS20817.1 GeneID:20103 MGI:1097682
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : S5 ribosomal protein product : ribosomal protein S5 protein_id : NP_033121.1

name	2310014L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037477 CCDS:CCDS20818.1 GeneID:381845 MGI:1924198
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381845 protein_id : NP_084085.1

name	1810019N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256159 GeneID:69086 MGI:1916336
definition	codon_start : 1 product : hypothetical protein LOC69086 protein_id : XP_001478450.1

name	Zfp324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118256 CCDS:CCDS20819.1 GeneID:243834 MGI:2444641
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 324 protein_id : NP_848847.3

name	Zfp446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425348 CCDS:CCDS20820.1 GeneID:269870 MGI:2442185
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 446 protein_id : NP_780767.1

name	Slc27a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678011 CCDS:CCDS20821.1 GeneID:26459 MGI:1347100
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047747 - cholate-CoA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : very long-chain acyl-Coenzyme A dehydrogenase synthase related product : solute carrier family 27 (fatty acid transporter), member 5 protein_id : NP_033538.1

name	ZBTB45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701534 CCDS:CCDS20822.1 GeneID:232879 MGI:2685003
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 499 protein_id : NP_001019870.1

name	LOC100042553 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256161 GeneID:100042553
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478476.1

name	Trim28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755787 CCDS:CCDS20823.1 GeneID:21849 MGI:109274
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transcriptional intermediary factor 1, beta product : tripartite motif protein 28 protein_id : NP_035718.1

name	Chmp2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312151 CCDS:CCDS20824.1 GeneID:68953 MGI:1916203
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : putative breast adenocarcinoma marker protein_id : NP_081161.1

name	Ube2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704162 CCDS:CCDS20825.1 GeneID:22192 MGI:108278
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : UBC12 homolog, yeast; ubiquitin C, related sequence 2 product : ubiquitin-conjugating enzyme E2M protein_id : NP_663553.1

name	Mzf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281743 CCDS:CCDS20826.1 GeneID:109889 MGI:107457
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Myeloid zinc finger protein 2; Myeloid zinc finger protein 1; zinc finger protein 121; myeloid-specific retinoic acid-responsive zinc finger protein product : zinc finger protein 98 protein_id : NP_665818.1

name	V1rj3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003906 CCDS:CCDS20827.1 GeneID:252909 MGI:2182262
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, J3 protein_id : NP_665846.1

name	V1rk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717771 CCDS:CCDS20828.1 GeneID:171261 MGI:2159698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, K1 protein_id : NP_598988.1

name	EG232887 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20819708 GeneID:232887 MGI:3648111
definition	codon_start : 1 product : hypothetical protein protein_id : XP_124858.1

name	V1rj2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717761 CCDS:CCDS20830.1 GeneID:171260 MGI:2159697
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor V1RJ1; vomeronasal receptor 1 E8 product : vomeronasal 1 receptor, J2 protein_id : NP_598987.1

name	6330408A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50053999 GeneID:321008 MGI:2447816
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC321008 protein_id : NP_796286.2

name	Lig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892807 GeneID:16881 MGI:101789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ligase I, DNA, ATP-dependent protein_id : NP_001076657.1

name	Lig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892266 GeneID:16881 MGI:101789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ligase I, DNA, ATP-dependent protein_id : NP_034845.2

name	Pla2g4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52317152 GeneID:232889 MGI:1196403
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : CPLA2-gamma; egg and early embryo abundant protein product : phospholipase A2, group IVC (cytosolic, calcium-independent) protein_id : NP_001004762.1

name	Cabp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304943 CCDS:CCDS20831.1 GeneID:29865 MGI:1352746
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 5 protein_id : NP_038905.1

name	Gm767 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701923 CCDS:CCDS20832.1 GeneID:330470 MGI:2685613
definition	codon_start : 1 product : bovine seminal plasma protein-like 1 protein_id : NP_001028590.1

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 2 pseudo : _no_value

name	LOC628853 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628853
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 1 pseudo : _no_value

name	LOC665999 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665999
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 1 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 2 pseudo : _no_value

name	LOC100042423 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042423
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 5 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 4 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 3 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 2 pseudo : _no_value

name	LOC100042433 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042433
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 1 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 2 pseudo : _no_value

name	LOC100042446 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042446
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 1 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 2 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 3 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 4 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 5 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 6 pseudo : _no_value

name	EG666065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666065
definition	number : 7 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 6 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 5 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 4 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 3 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 2 pseudo : _no_value

name	EG637908 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637908
definition	number : 1 pseudo : _no_value

name	LOC100043156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043156
definition	number : 1 pseudo : _no_value

name	LOC666177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666177
definition	number : 1 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 1 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 2 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 3 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 4 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 5 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 6 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 7 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 8 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 9 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 10 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 11 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 12 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 13 pseudo : _no_value

name	LOC665926 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256400 GeneID:665926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034287.1

name	LOC637571 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256403 GeneID:637571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034289.1

name	EG628898 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256136 GeneID:628898 MGI:3645961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 28 Proteins product : predicted gene, EG628898 pseudo : _no_value transcript_id : XR_033554.1

name	LOC100043075 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256426 GeneID:100043075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 5 Proteins product : similar to ring finger protein 141 pseudo : _no_value transcript_id : XR_034297.1

name	LOC629081 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256151 GeneID:629081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : similar to LOC654472 protein pseudo : _no_value transcript_id : XR_033648.1

name	LOC100043128 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256449 GeneID:100043128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 24 Proteins product : similar to DnaJ (Hsp40) homolog, subfamily B, member 6 pseudo : _no_value transcript_id : XR_034320.1

name	LOC666232 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256172 GeneID:666232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to Ac1158 pseudo : _no_value transcript_id : XR_033713.1

name	LOC666243 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256462 GeneID:666243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins product : similar to hCG1787519 pseudo : _no_value transcript_id : XR_034390.1

clone name	MSMg01-420C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-087K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-010N08.b	B6Ng01-010N08.g
ACC	DH846388	DH846389
length	1,028	1,078
definition	DH846388\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010N08, 5' end.	DH846389\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010N08, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttcactaaacccatctggtcttggcccttttttggttgggagac tattaataactgtgtctatttctttagggttatggaactgtttagatggc ttatgtgatcttgttttaactttggtacctggtatgtgtctagaaaattg tccatttcatccagattttccaagtttgttgagtataagcttttgtagta ggatctgattatttttttaaattttcatggtttccattgttatgtcttcc tttttatttctgattttattaatttggttactttctctgtgccctctggt tagtctggctaagggcttatctattttgttgattttctcaaagaactagc tcctggtttggttgaatttttttgtatagttttttttgtttgtttgtttg tttctctttggttgattttagccctgagtttgattatttcctgccatcta ctcctcttgggagtatttgattctttttgttctagagctttcaggtgtgc tgtcaagctgctagtgtaagctctctctgctttcttcttggaggcactta gagctatgagttttcctcttaccactgtttttattgtgtcccataagttt tggtatgatgtatcttcatttccgttaaacttaacgtctttattttcttt ctttctttattctttgaccaagttatcattgagcagggcattgatcatct ttccatgtgtatgcaggttttccattgttttttgaacacactcacgacaa ctggaatcttctgcggcaaagcttttattgcttacttatcaggagggaag accccaaaccgggaaaatggcgctgcttatatagcccgcagcgtgacgtt tcagcacctgatgtggcgtgacagctcctgattcgttgctcgcccatcac cccattactatgccgcgagatgggcagtgactaggcgtgagttactctgt acttaaggcttgttactagtaggtgcagtgaagccagcgcatcttatatg gcgattgcccttgcatccatgcgattgc	gaattcatatcaatgtttgaaaatattgaattaaaggttgtctttagtct tgtgtattttttaatcttcttaaaatttgcttcttggaccagtgcctcaa tcttcctgaatctacatctttacatttaatggaaaacaattttgccatct cacagcatgtgtctaggatagaggttctcaacctatggatctaaactctc ttagggtccaaatgacacattcacaggggctttatatcagatatcctaga tattcaatatttacattatgattcataaaaatagcaacattgcagttatg aagtagaagtgaaagtaattttatgattgggggtcacctcaacatgagga actgtattaaatgatcttggcattaagaaggttgaggaccactagtctag gatgttcgttcttcctgctttttctctatcactgctctttagaatacaat taagctaatcatcaaagtattctttattacccaagtcacatagaactagg tacatagtatgctaggagaaagtaaaatactgtcatctatttccacatca tatggaataatctagttcacagatccacttttagaactggactgacaaag gggaggcacaacctcaagtgcaaaccttaaggaggtgtttaaaaattcac tagtcaggatgaacaatattttaatttagtgtcataaaatatcaataccc aaatagcaatagtttacaaaataatagcatctttctgtgttgctgtgtgt gatcagaggccaatgtctacttctggtatcattcctcagatgccattcac cttgtttttttatctctctctgggatttaagactaggttatatgggtggc aatgggctgcaggaatctgcctgtctctgccttcccagggttgggttgca cgtatgctccatcacactgactaattgatgtggatcctggggattgaact ccttagcttgtgtgataatctttttgctgacaacctgtctcttcagcctc gttaagtacagagtccatgctaagcatgccaagttattagtaaaagaaca attttgtaacattctatatttatttaga
quality values	Open. Hide. 57 42 35 33 61 61 61 61 38 32 61 47 52 61 61 61 61 31 38 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 44 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 39 61 53 53 47 61 61 53 45 61 61 61 61 45 40 61 61 45 53 61 61 61 45 61 61 53 53 53 53 40 43 40 57 57 57 50 57 57 57 45 52 47 57 57 50 53 45 53 57 47 47 53 47 57 47 53 46 46 53 57 47 32 52 52 45 53 36 47 47 47 53 57 47 53 52 33 39 57 57 53 57 50 50 50 50 57 57 45 57 53 52 53 50 53 40 57 32 57 52 41 45 57 53 53 53 57 46 52 53 53 57 52 50 50 57 52 48 30 52 53 33 51 41 53 35 32 29 12 26 28 40 41 33 39 50 33 33 53 50 52 32 37 38 7 47 37 23 37 45 50 47 42 45 50 24 47 30 14 53 19 43 36 32 40 53 33 52 45 40 52 42 36 39 52 32 14 57 53 53 47 43 31 43 47 52 24 57 57 57 57 22 28 41 36 29 24 21 8 20 38 38 34 53 18 41 29 16 19 34 32 47 26 34 32 29 42 41 37 27 50 42 24 30 46 19 29 53 50 11 34 53 57 57 20 19 42 33 35 25 52 32 29 32 44 23 27 50 36 22 16 31 33 32 39 27 34 37 11 36 13 42 40 31 22 27 35 29 37 23 44 42 40 57 57 27 26 36 53 15 28 24 32 31 37 48 30 31 33 31 35 22 15 16 53 35 30 23 34 15 37 27 29 33 27 25 12 32 37 37 13 11 9 22 23 32 40 29 40 37 28 40 18 32 30 18 23 25 26 12 19 10 21 29 29 30 29 28 32 28 24 38 28 10 16 30 23 12 30 30 20 32 29 23 15 22 9 13 19 27 44 29 22 34 28 27 28 22 25 29 30 30 25 9 14 21 27 25 9 7 30 51 29 25 28 19 18 25 28 23 29 22 12 29 19 17 26 19 25 13 14 10 9 12 11 24 21 12 6 11 15 8 10 9 27 18 26 13 17 24 28 20 25 8 15 13 14 18 31 22 20 27 11 19 7 8 11 5 28 27 27 14 13 29 15 26 29 22 41 19 34 14 28 28 15 16 9 13 33 43 23 16 11 9 6 14 14 15 8 7 9 24 5 7 12 14 14 8 21 29 23 13 15 16 24 21 7	Open. Hide. 55 61 55 47 55 47 37 61 61 61 49 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 55 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 53 61 37 50 61 61 61 61 61 61 61 61 61 61 53 61 61 47 61 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 61 61 61 57 57 57 57 57 53 53 52 57 53 57 57 53 57 57 57 57 53 57 57 53 57 57 57 57 53 57 57 57 57 53 57 53 57 53 47 53 50 47 39 47 53 47 47 53 53 45 57 53 53 57 57 57 52 43 57 57 47 53 50 53 53 37 57 57 47 53 38 52 45 50 53 50 39 34 47 53 53 45 57 53 57 57 53 45 50 43 38 43 47 47 50 53 38 57 52 20 41 45 53 47 57 50 47 43 43 43 37 50 53 53 36 52 32 52 53 53 53 45 38 57 37 24 50 41 41 47 37 57 50 50 41 57 57 37 52 52 53 57 39 53 38 53 53 38 39 42 52 31 57 57 57 37 53 52 50 35 53 38 40 38 33 38 36 57 53 42 40 50 44 52 50 52 53 40 46 57 37 37 39 24 57 57 45 33 34 52 31 33 34 38 35 52 43 42 57 40 37 44 53 40 40 53 47 40 29 53 57 53 57 57 57 53 41 40 34 34 33 24 48 28 44 23 27 32 45 33 47 40 37 28 33 36 33 37 27 38 30 30 32 31 29 30 36 30 34 27 41 41 32 28 24 39 22 38 28 30 23 20 30 30 32 26 44 25 30 39 29 47 45 45 46 45 31 23 32 28 31 29 31 29 39 29 22 27 45 51 32 18 51 31 39 33 14 30 23 29 24 18 30 20 29 29 29 29 29 39 46 39 29 31 26 23 43 18 28 31 39 29 30 35 28 18 29 28 14 25 19 28 24 31 28 23 20 19 31 16 18 26 27 27 23 9 7 8 15 20 36 17 18 22 46 30 18 21 22 51 26 18 29 31 29 23 26 24 28 28 28 33 28 20 14 39 15 33 33 25 29 11 28 13 29 43 11 12 8 14 21 24 41 33 23 29 28 19 16 23 29 14 24 17 32 34 44 30 18 14 28 18 13 21 26 13 6 20 16 13 5 6 7 30 8 10 10 26 28 23 34 15 17 28 19 26 24 44 30 37 30 22 19 22 15 9 7 22 26 6 11 22 19 9 11 7 16 19 29 18 14 17 25 12 5 28 31 16 28 15 26 9 5 4 6 10 9 15 9 8 16 22 11 20 29 29 11 8 7 29 8 27 8 23 11 16 20 5 13 4 5 9 7 16 10 6 7 16 42 30 13 6 7 13 16 14 13 11 5 4 6 13 5 18 7 12 9 6 5 13 5 9 4 5 26 31 7 5 11 26 25 9 6 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_13138334_13139414
seq2: B6Ng01-010N08.g_67_1144

seq1  GAATTCATATCAATGTTTGAAAATATTGAATTAAAGGTTGTCTTTAGTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATATCAATGTTTGAAAATATTGAATTAAAGGTTGTCTTTAGTCT  50

seq1  TGTGTATTTTTTAATCTTCTTAAAATTTGCTTCTTGGACCAGTGCCTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTATTTTTTAATCTTCTTAAAATTTGCTTCTTGGACCAGTGCCTCAA  100

seq1  TCTTCCTGAATCTACATCTTTACATTTAATGGAAAACAATTTTGCCATCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTGAATCTACATCTTTACATTTAATGGAAAACAATTTTGCCATCT  150

seq1  CACAGCATGTGTCTAGGATAGAGGTTCTCAACCTATGGATCTAAACTCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCATGTGTCTAGGATAGAGGTTCTCAACCTATGGATCTAAACTCTC  200

seq1  TTAGGGTCCAAATGACACATTCACAGGGGCTTTATATCAGATATCCTAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGGTCCAAATGACACATTCACAGGGGCTTTATATCAGATATCCTAGA  250

seq1  TATTCAATATTTACATTATGATTCATAAAAATAGCAACATTGCAGTTATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAATATTTACATTATGATTCATAAAAATAGCAACATTGCAGTTATG  300

seq1  AAGTAGAAGTGAAAGTAATTTTATGATTGGGGGTCACCTCAACATGAGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAGAAGTGAAAGTAATTTTATGATTGGGGGTCACCTCAACATGAGGA  350

seq1  ACTGTATTAAATGATCTTGGCATTAAGAAGGTTGAGGACCACTAGTCTAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTATTAAATGATCTTGGCATTAAGAAGGTTGAGGACCACTAGTCTAG  400

seq1  GATGTTCGTTCTTCCTGCTTTTTCTCTATCACTGCTCTTTAGAATACAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTTCGTTCTTCCTGCTTTTTCTCTATCACTGCTCTTTAGAATACAAT  450

seq1  TAAGCTAATCATCAAAGTATTCTTTATTACCCAAGTCACATAGAACTAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCTAATCATCAAAGTATTCTTTATTACCCAAGTCACATAGAACTAGG  500

seq1  TACATAGTATGCTAGGAGAAAGTAAAATACTGTCATCTATTTCCACATCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATAGTATGCTAGGAGAAAGTAAAATACTGTCATCTATTTCCACATCA  550

seq1  TATGGAATAATCTAGTTCACAGATCCACTTTTAGAACTGGACTGACAAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGAATAATCTAGTTCACAGATCCACTTTTAGAACTGGACTGACAAAG  600

seq1  GGGAGGCACAACCTCAAGTGCAAACCTTAAGGAGGTGTTTAAAAATTCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGCACAACCTCAAGTGCAAACCTTAAGGAGGTGTTTAAAAATTCAC  650

seq1  TAGTCAGGATGAACAATATTTTAATTTAGTGTCATAAAATATCAATACCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTCAGGATGAACAATATTTTAATTTAGTGTCATAAAATATCAATACCC  700

seq1  AAATAGCAATAGTTTACAAAATAATAGCATCTTTCTGTGTTGCTGTGTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGCAATAGTTTACAAAATAATAGCATCTTTCTGTGTTGCTGTGTGT  750

seq1  GATCAGAGGCCAATGTCTACTTCTGGTATCATTCCTCAGATGCCATTCAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAGAGGCCAATGTCTACTTCTGGTATCATTCCTCAGATGCCATTCAC  800

seq1  CTTGTTTTTTTATCTCTCTCTGGGATTTAAGACTAGGTTATATGGGTGGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTTTTTTTATCTCTCTCTGGGATTTAAGACTAGGTTATATGGGTGGC  850

seq1  AATGGGCTGCAGGAATCTGCCTGTCTCTGCCTTCCCAGGGTTGGGTTGCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGCTGCAGGAATCTGCCTGTCTCTGCCTTCCCAGGGTTGGGTTGCA  900

seq1  CGTATGCTCCATCACACCTGACT-ATTGATGTGGATCCTGGGGATTGAAC  949
      |||||||||||||||| |||||| ||||||||||||||||||||||||||
seq2  CGTATGCTCCATCACA-CTGACTAATTGATGTGGATCCTGGGGATTGAAC  949

seq1  TCCTTAGGCTTGTGTGATAATCTTTTTGCTGACAAACCTGTCTCTTCAGC  999
      |||||| |||||||||||||||||||||||||| ||||||||||||||||
seq2  TCCTTA-GCTTGTGTGATAATCTTTTTGCTGAC-AACCTGTCTCTTCAGC  997

seq1  CCCGTTAAGTACAGAGTCCATGCTAGGCAATGCCAAGGTATTAGTAAAAG  1049
      | ||||||||||||||||||||||| || |||||||| ||||||||||| 
seq2  CTCGTTAAGTACAGAGTCCATGCTAAGC-ATGCCAAGTTATTAGTAAAA-  1045

seq1  GAACAA-TCTGTAACATCCTATATTTATTTAGA  1081
      |||||| | |||||||| |||||||||||||||
seq2  GAACAATTTTGTAACATTCTATATTTATTTAGA  1078

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information