MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-014L02
Chromosome	7 (Build37)
Map Location	109,497,444 - 109,498,674
singlet/doublet	singlet
Overlap gene	Stim1
Upstream gene	Centd2, Pde2a, Art2a, EG630138, Art2b, Clpb, Phox2a, Inppl1, Folr2, Folr1, 3200002M19Rik, F930017I19Rik, 2400001E08Rik, Lrrc51, LOC667222, Numa1, Il18bp, Rnf121, Trpc2, Art5, Art1, Chrna10, Nup98, Frag1, Rhog
Downstream gene	Rrm1, Olfr543, Olfr544, Olfr545, LOC667284, Olfr547, Olfr548-ps1, Olfr549, Trim21, LOC384699, Olfr550, Olfr551, Olfr552, Olfr553, Olfr554, LOC100040840, Olfr555, Olfr556, Trim68, Olfr557, Olfr558, Olfr33, Olfr559, Olfr78, Olfr560, Olfr561, Olfr562-ps1, Olfr563-ps1, Olfr564, Olfr565-ps1, Olfr566, GA_x5J8B7W5P47-379997-380552, Olfr567-ps1, Olfr568, Olfr569, Olfr570, Olfr571, Olfr572, Olfr573-ps1, Olfr574, Olfr575, Olfr576, Olfr577, Olfr578, Olfr1527-ps1, Olfr579-ps1, Olfr580-ps1, Olfr581-ps1, Olfr582, Olfr583, Olfr584, Olfr585, Olfr586, Olfr587-ps1, Olfr588-ps1, Olfr589, Olfr590-ps1, Olfr591, Olfr592, Olfr593, Olfr594, Olfr595-ps1, Usp17, Dub2a, LOC100041187, Olfr597, GA_x5J8B7TU1BB-380-666, Olfr598, Olfr599, Olfr600
Link	Open Mouse BAC browser

Click to get alignment info.

name	Centd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Pde2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207728 MGI:2446107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11871 MGI:107546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630138 MGI:3644555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1180 ESTs, 4 Proteins pseudo : _no_value

name	Art2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11872 MGI:107545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20480 MGI:1100517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phox2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11859 MGI:106633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inppl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16332 MGI:1333787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Folr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14276 MGI:95569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Folr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14275 MGI:95568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3200002M19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75430 MGI:1922680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F930017I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:791260 MGI:3707696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2400001E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66508 MGI:1913758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69358 MGI:1916608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	LOC667222 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Numa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101706 MGI:2443665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il18bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16068 MGI:1333800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75212 MGI:1922462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22064 MGI:109527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11875 MGI:107948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11870 MGI:107511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:504186 MGI:3609260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269966 MGI:109404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233575 MGI:2385286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56212 MGI:1928370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20866 MGI:107476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20133 MGI:98180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr543 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257947 MGI:3030377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr544 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257926 MGI:3030378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258837 MGI:3030379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 10 Proteins pseudo : _no_value

name	Olfr547 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259083 MGI:3030381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr548-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258229 MGI:3030382
definition	gene_synonym : MOR31-13 note : olfactory receptor 548, pseudogene 1 pseudo : _no_value

name	Olfr549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259105 MGI:3030383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Olfr550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259108 MGI:3030384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258750 MGI:3030385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259106 MGI:3030386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233578 MGI:3030387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258322 MGI:3030388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr555 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259107 MGI:3030389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258749 MGI:3030390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101700 MGI:2142077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr557 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258358 MGI:3030391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr558 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259097 MGI:3030392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18332 MGI:109302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr559 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259116 MGI:3030393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170639 MGI:2157548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259117 MGI:3030394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259096 MGI:3030395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr562-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259090 MGI:3030396
definition	gene_synonym : MOR14-5 note : olfactory receptor 562, pseudogene 1 pseudo : _no_value

name	Olfr563-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259157 MGI:3030397
definition	gene_synonym : MOR0-4P note : olfactory receptor 563, pseudogene 1 pseudo : _no_value

name	Olfr564 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258356 MGI:3030398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr565-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258142 MGI:3030399
definition	gene_synonym : MOR14-8P note : olfactory receptor 565, pseudogene 1 pseudo : _no_value

name	Olfr566 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258168 MGI:3030400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5P47-379997-380552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257730
definition	note : olfactory receptor GA_x5J8B7W5P47-379997-380552 pseudo : _no_value

name	Olfr567-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258140 MGI:3030401
definition	gene_synonym : MOR30-4P note : olfactory receptor 567, pseudogene 1 pseudo : _no_value

name	Olfr568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259095 MGI:3030402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr569 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259092 MGI:3030403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259114 MGI:3030404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr571 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259089 MGI:3030405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259093 MGI:3030406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr573-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258230 MGI:3030407
definition	gene_synonym : MOR10-3P; MOR10-4 note : olfactory receptor 573, pseudogene 1 pseudo : _no_value

name	Olfr574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258357 MGI:3030408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259118 MGI:3030409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258248 MGI:3030410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259113 MGI:3030411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr578 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259119 MGI:3030412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1527-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259158 MGI:3031361
definition	gene_synonym : MOR8-6P note : olfactory receptor 1527, pseudogene 1 pseudo : _no_value

name	Olfr579-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258141 MGI:3030413
definition	gene_synonym : MOR171-29P; MOR8-9_p note : olfactory receptor 579, pseudogene 1 pseudo : _no_value

name	Olfr580-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258213 MGI:3030414
definition	gene_synonym : MOR8-4P note : olfactory receptor 580, pseudogene 1 pseudo : _no_value

name	Olfr581-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404406 MGI:3030415
definition	gene_synonym : MOR8-8_p note : olfactory receptor 581, pseudogene 1 pseudo : _no_value

name	Olfr582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259055 MGI:3030416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258752 MGI:3030417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259056 MGI:3030418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr585 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259091 MGI:3030419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr586 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259115 MGI:3030420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr587-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404407 MGI:3030421
definition	gene_synonym : MOR7-3_p note : olfactory receptor 587, pseudogene 1 pseudo : _no_value

name	Olfr588-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259094 MGI:3030422
definition	gene_synonym : MOR6-1 note : olfactory receptor 588, pseudogene 1 pseudo : _no_value

name	Olfr589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259054 MGI:3030423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr590-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258170 MGI:3030424
definition	gene_synonym : MOR0-1P note : olfactory receptor 590, pseudogene 1 pseudo : _no_value

name	Olfr591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258139 MGI:3030425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404317 MGI:3030426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258378 MGI:3030427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258246 MGI:3030428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr595-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258175 MGI:3030429
definition	gene_synonym : MOR32-6P note : olfactory receptor 595, pseudogene 1 pseudo : _no_value

name	Usp17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436004 MGI:3582591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dub2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384701 MGI:3051372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 436 Proteins

name	Olfr597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258135 MGI:3030431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TU1BB-380-666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257742
definition	note : olfactory receptor GA_x5J8B7TU1BB-380-666 pseudo : _no_value

name	Olfr598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257975 MGI:3030432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258726 MGI:3030433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259048 MGI:3030434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091594 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_001040111.1

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091596 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_001040112.1

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091598 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_027180.3

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37655162 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_198096.1

name	Pde2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723648 GeneID:207728 MGI:2446107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 2A, cGMP-stimulated transcript_id : NM_001008548.2

name	Art2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671576 GeneID:11871 MGI:107546
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 2a transcript_id : NM_007490.1

name	Art2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815850 GeneID:11872 MGI:107545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 2b transcript_id : NM_019915.2

name	Clpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130483 GeneID:20480 MGI:1100517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ClpB caseinolytic peptidase B homolog (E. coli) transcript_id : NM_009191.3

name	Phox2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679398 GeneID:11859 MGI:106633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-like homeobox 2a transcript_id : NM_008887.1

name	Inppl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859565 GeneID:16332 MGI:1333787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate phosphatase-like 1 transcript_id : NM_010567.1

name	Folr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679824 GeneID:14276 MGI:95569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folate receptor 2 (fetal) transcript_id : NM_008035.1

name	Folr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982844 GeneID:14275 MGI:95568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folate receptor 1 (adult) transcript_id : NM_008034.2

name	3200002M19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803253 GeneID:75430 MGI:1922680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3200002M19 gene transcript_id : NM_027532.2

name	F930017I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157493 GeneID:791260 MGI:3707696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA F930017I19 clone transcript_id : NM_001081679.1

name	2400001E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802197 GeneID:66508 MGI:1913758
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2400001E08 gene transcript_id : NM_025605.2

name	Lrrc51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380867 GeneID:69358 MGI:1916608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : leucine rich repeat containing 51, transcript variant 2 transcript_id : XM_890234.2

name	Numa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29788769 GeneID:101706 MGI:2443665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear mitotic apparatus protein 1 transcript_id : NM_133947.2

name	Il18bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754313 GeneID:16068 MGI:1333800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 18 binding protein transcript_id : NM_010531.1

name	Rnf121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778931 GeneID:75212 MGI:1922462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 121 transcript_id : NM_029211.2

name	Trpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755886 GeneID:22064 MGI:109527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily C, member 2 transcript_id : NM_011644.1

name	Art5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25092604 GeneID:11875 MGI:107948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 5 transcript_id : NM_007491.1

name	Art1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803149 GeneID:11870 MGI:107511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 1 transcript_id : NM_009710.4

name	Chrna10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487260 GeneID:504186 MGI:3609260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 10 transcript_id : NM_001081424.1

name	Nup98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930412 GeneID:269966 MGI:109404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 98 transcript_id : NM_022979.1

name	Frag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130185 GeneID:233575 MGI:2385286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FGF receptor activating protein 1 transcript_id : NM_145583.2

name	Rhog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254552 GeneID:56212 MGI:1928370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member G transcript_id : NM_019566.2

name	Stim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802100 GeneID:20866 MGI:107476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal interaction molecule 1 transcript_id : NM_009287.3

name	Rrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982025 GeneID:20133 MGI:98180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleotide reductase M1 transcript_id : NM_009103.2

name	Olfr543 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801333 GeneID:257947 MGI:3030377
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 543 transcript_id : NM_001011782.1

name	Olfr544 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938011 GeneID:257926 MGI:3030378
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 544 transcript_id : NM_020289.1

name	Olfr545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203792 GeneID:258837 MGI:3030379
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 545 transcript_id : NM_146840.1

name	Olfr547 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735423 GeneID:259083 MGI:3030381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 547 transcript_id : NM_147079.2

name	Olfr549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128766 GeneID:259105 MGI:3030383
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 549 transcript_id : NM_147101.1

name	Trim21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139523 GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 21 transcript_id : NM_001082552.1

name	Trim21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139139 GeneID:20821 MGI:106657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 21 transcript_id : NM_009277.3

name	Olfr550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128764 GeneID:259108 MGI:3030384
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 550 transcript_id : NM_147104.1

name	Olfr551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129334 GeneID:258750 MGI:3030385
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 551 transcript_id : NM_146755.1

name	Olfr552 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583539 GeneID:259106 MGI:3030386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 552 transcript_id : NM_147102.2

name	Olfr553 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518535 GeneID:233578 MGI:3030387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 553 transcript_id : NM_207621.1

name	Olfr554 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247461 GeneID:258322 MGI:3030388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 554 transcript_id : NM_146325.2

name	Olfr555 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128762 GeneID:259107 MGI:3030389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 555 transcript_id : NM_147103.1

name	Olfr556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129340 GeneID:258749 MGI:3030390
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 556 transcript_id : NM_146754.1

name	Trim68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574099 GeneID:101700 MGI:2142077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif containing 68 transcript_id : NM_198012.1

name	Olfr557 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129580 GeneID:258358 MGI:3030391
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 557 transcript_id : NM_146361.1

name	Olfr558 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369590 GeneID:259097 MGI:3030392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 558 transcript_id : NM_147093.3

name	Olfr33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165411 GeneID:18332 MGI:109302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 33 transcript_id : NM_147073.1

name	Olfr559 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128740 GeneID:259116 MGI:3030393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 559 transcript_id : NM_147112.1

name	Olfr78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362165 GeneID:170639 MGI:2157548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 78 transcript_id : NM_130866.3

name	Olfr560 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583537 GeneID:259117 MGI:3030394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 560 transcript_id : NM_147113.2

name	Olfr561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128784 GeneID:259096 MGI:3030395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 561 transcript_id : NM_147092.1

name	Olfr564 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129584 GeneID:258356 MGI:3030398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 564 transcript_id : NM_146359.1

name	Olfr566 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372143 GeneID:258168 MGI:3030400
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 566 transcript_id : NM_001011536.1

name	Olfr568 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983540 GeneID:259095 MGI:3030402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 568 transcript_id : NM_147091.2

name	Olfr569 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128792 GeneID:259092 MGI:3030403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 569 transcript_id : NM_147088.1

name	Olfr570 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128736 GeneID:259114 MGI:3030404
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 570 transcript_id : NM_147110.1

name	Olfr571 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128800 GeneID:259089 MGI:3030405
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 571 transcript_id : NM_147085.1

name	Olfr572 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128786 GeneID:259093 MGI:3030406
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 572 transcript_id : NM_147089.1

name	Olfr574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719162 GeneID:258357 MGI:3030408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 574 transcript_id : NM_146360.2

name	Olfr575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128744 GeneID:259118 MGI:3030409
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 575 transcript_id : NM_147114.1

name	Olfr576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090632 GeneID:258248 MGI:3030410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 576 transcript_id : NM_001001805.2

name	Olfr577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128796 GeneID:259113 MGI:3030411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 577 transcript_id : NM_147109.1

name	Olfr578 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128746 GeneID:259119 MGI:3030412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 578 transcript_id : NM_147115.1

name	Olfr582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128844 GeneID:259055 MGI:3030416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 582 transcript_id : NM_147053.1

name	Olfr583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129330 GeneID:258752 MGI:3030417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 583 transcript_id : NM_146757.1

name	Olfr584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128846 GeneID:259056 MGI:3030418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 584 transcript_id : NM_147054.1

name	Olfr585 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892363 GeneID:259091 MGI:3030419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 585 transcript_id : NM_147087.2

name	Olfr586 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128738 GeneID:259115 MGI:3030420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 586 transcript_id : NM_147111.1

name	Olfr589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128850 GeneID:259054 MGI:3030423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 589 transcript_id : NM_147052.1

name	Olfr591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801451 GeneID:258139 MGI:3030425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 591 transcript_id : NM_001011847.1

name	Olfr592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583632 GeneID:404317 MGI:3030426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 592 transcript_id : NM_207556.2

name	Olfr593 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129544 GeneID:258378 MGI:3030427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 593 transcript_id : NM_146380.1

name	Olfr594 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369490 GeneID:258246 MGI:3030428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 594 transcript_id : NM_207143.1

name	Usp17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802311 GeneID:436004 MGI:3582591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 17 (homolog) transcript_id : NM_001033494.2

name	Dub2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983633 GeneID:384701 MGI:3051372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 2a transcript_id : NM_001001559.2

name	LOC100041187 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257620 GeneID:100041187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 436 Proteins product : similar to olfactory receptor MOR32-2 transcript_id : XM_001475935.1

name	Olfr597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801447 GeneID:258135 MGI:3030431
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 597 transcript_id : NM_001011845.1

name	Olfr598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801351 GeneID:257975 MGI:3030432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 598 transcript_id : NM_001011793.1

name	Olfr599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129380 GeneID:258726 MGI:3030433
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 599 transcript_id : NM_146731.1

name	Olfr600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128862 GeneID:259048 MGI:3030434
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 600 transcript_id : NM_147046.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92091595 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : centaurin, delta 2 isoform 3 protein_id : NP_001035200.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37655161 CCDS:CCDS21510.1 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : centaurin, delta 2 isoform 1 protein_id : NP_081456.2

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92091597 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : centaurin, delta 2 isoform 4 protein_id : NP_001035201.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37655163 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : centaurin, delta 2 isoform 2 protein_id : NP_932764.1

name	Pde2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606121 GeneID:207728 MGI:2446107
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phosphodiesterase 2A, cGMP-stimulated protein_id : NP_001008548.1

name	Art2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671577 GeneID:11871 MGI:107546
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ADP-ribosyltransferase 2a protein_id : NP_031516.1

name	Art2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815851 CCDS:CCDS21512.1 GeneID:11872 MGI:107545
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0018120 - peptidyl-arginine ADP-ribosylation [Evidence IDA]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : ADP-ribosyltransferase 2b protein_id : NP_064299.2

name	Clpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677983 CCDS:CCDS21513.1 GeneID:20480 MGI:1100517
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : suppressor of K+ transport defect 3 protein_id : NP_033217.1

name	Phox2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679399 CCDS:CCDS21514.1 GeneID:11859 MGI:106633
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paired mesoderm homeobox 2a; aristaless homeobox gene homolog product : paired-like homeobox 2a protein_id : NP_032913.1

name	Inppl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859566 CCDS:CCDS21515.1 GeneID:16332 MGI:1333787
definition	codon_start : 1 exception : mismatches in translation product : inositol polyphosphate phosphatase-like 1 protein_id : NP_034697.1

name	Folr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679825 CCDS:CCDS21516.1 GeneID:14276 MGI:95569
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005542 - folic acid binding [Evidence TAS]; GO:0008517 - folic acid transporter activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006620 - posttranslational protein targeting to membrane [Evidence TAS] codon_start : 1 note : folate binding protein 2 product : folate receptor 2 (fetal) protein_id : NP_032061.1

name	Folr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982845 CCDS:CCDS21517.1 GeneID:14275 MGI:95568
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005542 - folic acid binding [Evidence TAS]; GO:0008517 - folic acid transporter activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0046655 - folic acid metabolism [Evidence IMP]; GO:0006620 - posttranslational protein targeting to membrane [Evidence TAS] codon_start : 1 note : folate binding protein 1; folate receptor; folate-binding protein 1 product : folate receptor 1 (adult) protein_id : NP_032060.2

name	3200002M19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229109 CCDS:CCDS21518.1 GeneID:75430 MGI:1922680
definition	codon_start : 1 product : hypothetical protein LOC75430 protein_id : NP_081808.2

name	F930017I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157494 GeneID:791260 MGI:3707696
definition	codon_start : 1 note : catechol O-methyltransferase-like product : Riken cDNA F930017I19 clone protein_id : NP_001075148.1

name	2400001E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385060 CCDS:CCDS21519.1 GeneID:66508 MGI:1913758
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66508 protein_id : NP_079881.1

name	Lrrc51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907225 GeneID:69358 MGI:1916608
definition	codon_start : 1 product : leucine rich repeat containing 51 isoform 2 protein_id : XP_895327.1

name	Numa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788770 GeneID:101706 MGI:2443665
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0015631 - tubulin binding [Evidence ISS] codon_start : 1 exception : mismatches in translation product : nuclear mitotic apparatus protein 1 protein_id : NP_598708.2

name	Il18bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754314 CCDS:CCDS21522.1 GeneID:16068 MGI:1333800
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0042007 - interleukin-18 binding [Evidence ISS]; GO:0048019 - receptor antagonist activity [Evidence ISS] GO_process : GO:0042088 - T-helper 1 type immune response [Evidence ISS] codon_start : 1 note : interferon gamma inducing factor binding protein product : interleukin 18 binding protein protein_id : NP_034661.1

name	Rnf121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778932 CCDS:CCDS21523.1 GeneID:75212 MGI:1922462
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 121 protein_id : NP_083487.2

name	Trpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755887 CCDS:CCDS21524.1 GeneID:22064 MGI:109527
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0015279 - store-operated calcium channel activity [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IPI]; GO:0006811 - ion transport [Evidence IEA]; GO:0000012 - single strand break repair [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transient receptor protein 2; transient receptor potential 2-like protein product : transient receptor potential cation channel, subfamily C, member 2 protein_id : NP_035774.1

name	Art5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092605 CCDS:CCDS21525.1 GeneID:11875 MGI:107948
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0003953 - NAD+ nucleosidase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation function : NAD glycohydrolysis product : ADP-ribosyltransferase 5 precursor protein_id : NP_031517.1

name	Art1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21687250 CCDS:CCDS21526.1 GeneID:11870 MGI:107511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : ADP-ribosyltransferase 1 protein_id : NP_033840.2

name	Chrna10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487261 GeneID:504186 MGI:3609260
definition	codon_start : 1 product : cholinergic receptor, nicotinic, alpha polypeptide 10 protein_id : NP_001074893.1

name	Nup98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930413 CCDS:CCDS21528.1 GeneID:269966 MGI:109404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IEA]; GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nucleoporin 98 protein_id : NP_075355.1

name	Frag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704172 GeneID:233575 MGI:2385286
definition	GO_component : GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0042770 - DNA damage response, signal transduction [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] codon_start : 1 product : FGF receptor activating protein 1 protein_id : NP_663558.1

name	Rhog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625037 CCDS:CCDS21529.1 GeneID:56212 MGI:1928370
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog G (RhoG); ras homolog G (RhoG) product : ras homolog gene family, member G protein_id : NP_062512.1

name	Stim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981983 CCDS:CCDS21530.1 GeneID:20866 MGI:107476
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0032237 - activation of store-operated calcium channel activity [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0005513 - detection of calcium ion [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0051924 - regulation of calcium ion transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : stromal interaction molecule 1 protein_id : NP_033313.2

name	Rrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982026 GeneID:20133 MGI:98180
definition	GO_component : GO:0005971 - ribonucleoside-diphosphate reductase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004748 - ribonucleoside-diphosphate reductase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : ribonucleotide reductase M1 protein_id : NP_033129.2

name	Olfr543 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801334 CCDS:CCDS21531.1 GeneID:257947 MGI:3030377
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5199377-5198367; olfactory receptor MOR42-2 product : olfactory receptor 543 protein_id : NP_001011782.1

name	Olfr544 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938012 CCDS:CCDS21532.1 GeneID:257926 MGI:3030378
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5206624-5205620; odorant receptor S6; olfactory receptor MOR42-3; odorant receptor S79; G-protein-coupled receptor product : olfactory receptor 544 protein_id : NP_064685.1

name	Olfr545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203793 CCDS:CCDS21533.1 GeneID:258837 MGI:3030379
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5216160-5215210; olfactory receptor MOR42-1 product : olfactory receptor 545 protein_id : NP_667051.1

name	Olfr547 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735424 GeneID:259083 MGI:3030381
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5256044-5256988; olfactory receptor MOR31-4 product : olfactory receptor 547 protein_id : NP_667290.2

name	Olfr549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128767 CCDS:CCDS21534.1 GeneID:259105 MGI:3030383
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5274337-5275287; olfactory receptor MOR31-3 product : olfactory receptor 549 protein_id : NP_667312.1

name	Trim21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139524 GeneID:20821 MGI:106657
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Sjogren syndrome antigen A1; 52kD Ro/SSA autoantigen product : tripartite motif protein 21 protein_id : NP_001076021.1

name	Trim21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139140 GeneID:20821 MGI:106657
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Sjogren syndrome antigen A1; 52kD Ro/SSA autoantigen product : tripartite motif protein 21 protein_id : NP_033303.3

name	Olfr550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128765 CCDS:CCDS21535.1 GeneID:259108 MGI:3030384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5297243-5298193; olfactory receptor MOR16-1 product : olfactory receptor 550 protein_id : NP_667315.1

name	Olfr551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129335 CCDS:CCDS21536.1 GeneID:258750 MGI:3030385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5307445-5306498; olfactory receptor MOR29-1 product : olfactory receptor 551 protein_id : NP_666966.1

name	Olfr552 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583540 CCDS:CCDS21537.1 GeneID:259106 MGI:3030386
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5323062-5324015; olfactory receptor MOR28-1 product : olfactory receptor 552 protein_id : NP_667313.2

name	Olfr553 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518536 CCDS:CCDS21538.1 GeneID:233578 MGI:3030387
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5333671-5332712; GA_x5J8B7W5P47-604988-605242 product : olfactory receptor 553 protein_id : NP_997504.1

name	Olfr554 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247462 CCDS:CCDS21539.1 GeneID:258322 MGI:3030388
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5356887-5357840; olfactory receptor MOR25-1 product : olfactory receptor 554 protein_id : NP_666437.2

name	Olfr555 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128763 CCDS:CCDS21540.1 GeneID:259107 MGI:3030389
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5375442-5376389; olfactory receptor MOR10-1 product : olfactory receptor 555 protein_id : NP_667314.1

name	Olfr556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129341 CCDS:CCDS21541.1 GeneID:258749 MGI:3030390
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5386601-5387575; olfactory receptor MOR41-1 product : olfactory receptor 556 protein_id : NP_666965.1

name	Trim68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574100 GeneID:101700 MGI:2142077
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 137 product : tripartite motif containing 68 protein_id : NP_932129.1

name	Olfr557 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129581 CCDS:CCDS21542.1 GeneID:258358 MGI:3030391
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5414934-5415902; olfactory receptor MOR18-3 product : olfactory receptor 557 protein_id : NP_666473.1

name	Olfr558 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128779 CCDS:CCDS21543.1 GeneID:259097 MGI:3030392
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5425951-5426904; olfactory receptor MOR18-1; prostate overexpressed G protein coupled receptor product : olfactory receptor 558 protein_id : NP_667304.1

name	Olfr33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165412 CCDS:CCDS21544.1 GeneID:18332 MGI:109302
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5431102-5430146; odorant receptor product : olfactory receptor 33 protein_id : NP_667284.1

name	Olfr559 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128741 CCDS:CCDS21545.1 GeneID:259116 MGI:3030393
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5441154-5440198; olfactory receptor MOR11-1 product : olfactory receptor 559 protein_id : NP_667323.1

name	Olfr78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700008 CCDS:CCDS21546.1 GeneID:170639 MGI:2157548
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5459657-5458695; olfactory receptor MOR18-2 product : olfactory receptor 78 protein_id : NP_570936.1

name	Olfr560 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583538 GeneID:259117 MGI:3030394
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5470572-5469628; olfactory receptor MOR14-1 product : olfactory receptor 560 protein_id : NP_667324.2

name	Olfr561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128785 CCDS:CCDS21547.1 GeneID:259096 MGI:3030395
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5491151-5492095; olfactory receptor MOR14-2 product : olfactory receptor 561 protein_id : NP_667303.1

name	Olfr564 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129585 GeneID:258356 MGI:3030398
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PBJ9-5513635-5514627; olfactory receptor MOR14-10 product : olfactory receptor 564 protein_id : NP_666471.1

name	Olfr566 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372144 CCDS:CCDS21548.1 GeneID:258168 MGI:3030400
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5560696-5559746; olfactory receptor MOR14-7P product : olfactory receptor 566 protein_id : NP_001011536.1

name	Olfr568 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983541 CCDS:CCDS21549.1 GeneID:259095 MGI:3030402
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5588278-5589228; olfactory receptor MOR14-3 product : olfactory receptor 568 protein_id : NP_667302.2

name	Olfr569 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128793 CCDS:CCDS21550.1 GeneID:259092 MGI:3030403
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5599295-5598351; olfactory receptor MOR30-1 product : olfactory receptor 569 protein_id : NP_667299.1

name	Olfr570 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128737 CCDS:CCDS21551.1 GeneID:259114 MGI:3030404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5611412-5612350; olfactory receptor MOR8-3 product : olfactory receptor 570 protein_id : NP_667321.1

name	Olfr571 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128801 CCDS:CCDS21552.1 GeneID:259089 MGI:3030405
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-5620890-5619922; olfactory receptor MOR21-1 product : olfactory receptor 571 protein_id : NP_667296.1

name	Olfr572 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128787 CCDS:CCDS21553.1 GeneID:259093 MGI:3030406
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5638785-5639741; olfactory receptor MOR10-2 product : olfactory receptor 572 protein_id : NP_667300.1

name	Olfr574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719163 CCDS:CCDS21554.1 GeneID:258357 MGI:3030408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5659738-5660748; olfactory receptor MOR14-9 product : olfactory receptor 574 protein_id : NP_666472.2

name	Olfr575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128745 CCDS:CCDS21555.1 GeneID:259118 MGI:3030409
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5666843-5665908; olfactory receptor MOR8-1 product : olfactory receptor 575 protein_id : NP_667325.1

name	Olfr576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090633 GeneID:258248 MGI:3030410
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5676385-5677371; olfactory receptor MOR8-5; olfactory receptor 576, pseudogene 1 product : olfactory receptor 576 protein_id : NP_001001805.2

name	Olfr577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128797 CCDS:CCDS21556.1 GeneID:259113 MGI:3030411
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5685322-5684384; olfactory receptor MOR7-2 product : olfactory receptor 577 protein_id : NP_667320.1

name	Olfr578 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128747 CCDS:CCDS21557.1 GeneID:259119 MGI:3030412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5696486-5695545; olfactory receptor MOR7-1 product : olfactory receptor 578 protein_id : NP_667326.1

name	Olfr582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128845 CCDS:CCDS21558.1 GeneID:259055 MGI:3030416
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5752857-5753801; olfactory receptor MOR30-3 product : olfactory receptor 582 protein_id : NP_667264.1

name	Olfr583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129331 CCDS:CCDS21559.1 GeneID:258752 MGI:3030417
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5762668-5763618; olfactory receptor MOR14-6 product : olfactory receptor 583 protein_id : NP_666968.1

name	Olfr584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128847 CCDS:CCDS21560.1 GeneID:259056 MGI:3030418
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5796876-5797820; olfactory receptor MOR30-2 product : olfactory receptor 584 protein_id : NP_667265.1

name	Olfr585 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892364 GeneID:259091 MGI:3030419
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5809085-5810035; olfactory receptor MOR14-4 product : olfactory receptor 585 protein_id : NP_667298.2

name	Olfr586 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128739 CCDS:CCDS21561.1 GeneID:259115 MGI:3030420
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5836380-5835439; olfactory receptor MOR8-2 product : olfactory receptor 586 protein_id : NP_667322.1

name	Olfr589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128851 CCDS:CCDS21562.1 GeneID:259054 MGI:3030423
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5871256-5870303; olfactory receptor MOR32-3 product : olfactory receptor 589 protein_id : NP_667263.1

name	Olfr591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801452 CCDS:CCDS21563.1 GeneID:258139 MGI:3030425
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5889409-5888465; olfactory receptor MOR24-1P product : olfactory receptor 591 protein_id : NP_001011847.1

name	Olfr592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583633 CCDS:CCDS21564.1 GeneID:404317 MGI:3030426
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5902266-5903204 product : olfactory receptor 592 protein_id : NP_997439.2

name	Olfr593 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129545 CCDS:CCDS21565.1 GeneID:258378 MGI:3030427
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5927412-5928362; olfactory receptor MOR24-2 product : olfactory receptor 593 protein_id : NP_666492.1

name	Olfr594 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369491 CCDS:CCDS21566.1 GeneID:258246 MGI:3030428
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-5935234-5936169; olfactory receptor MOR32-10 product : olfactory receptor 594 protein_id : NP_997026.1

name	Dub2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983634 CCDS:CCDS21567.1 GeneID:384701 MGI:3051372
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IC] codon_start : 1 product : deubiquitinating enzyme 2a protein_id : NP_001001559.2

name	Usp17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677446 GeneID:436004 MGI:3582591
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : ubiquitin specific protease 17 (homolog) product : ubiquitin specific peptidase 17 (homolog) protein_id : NP_001028666.1

name	LOC100041187 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257621 GeneID:100041187
definition	codon_start : 1 product : similar to olfactory receptor MOR32-2 protein_id : XP_001475985.1

name	Olfr597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801448 GeneID:258135 MGI:3030431
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6029614-6030561; olfactory receptor MOR23-2; olfactory receptor GA_x5J8B7TU1BB-380-666 product : olfactory receptor 597 protein_id : NP_001011845.1

name	Olfr598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801352 GeneID:257975 MGI:3030432
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6037823-6038782; olfactory receptor MOR23-4P product : olfactory receptor 598 protein_id : NP_001011793.1

name	Olfr599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129381 CCDS:CCDS21568.1 GeneID:258726 MGI:3030433
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6047402-6048349; olfactory receptor MOR23-1 product : olfactory receptor 599 protein_id : NP_666942.1

name	Olfr600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128863 CCDS:CCDS21569.1 GeneID:259048 MGI:3030434
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6056235-6055291; olfactory receptor MOR39-1 product : olfactory receptor 600 protein_id : NP_667257.1

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 5 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 4 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 3 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 2 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 1 pseudo : _no_value

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 3 pseudo : _no_value

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 2 pseudo : _no_value

name	LOC384699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384699
definition	number : 1 pseudo : _no_value

name	LOC100040840 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040840
definition	number : 2 pseudo : _no_value

name	LOC100040840 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040840
definition	number : 1 pseudo : _no_value

name	EG630138 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257610 GeneID:630138 MGI:3644555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1180 ESTs, 4 Proteins product : predicted gene, EG630138 pseudo : _no_value transcript_id : XR_001600.2

name	LOC667284 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257615 GeneID:667284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 10 Proteins product : similar to Hmgb1 protein pseudo : _no_value transcript_id : XR_032143.1

clone name	MSMg01-387B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-100H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275M17
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-112M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260O22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-014L02.b
ACC	DH849164
length	1,216
definition	DH849164\|Mus musculus domesticus DNA, BAC clone: B6Ng01-014L02, 5' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctgcctcctgctgagaagaactgggtctcttcttggacacgagg acatggtgttctaataagtgcaggaacatctctcaaattggctggattgt acacatcccagtgacctgatctttctccttggtgactagacttgctatgt ctttcactggggacctttcccctctcaacactaaatctgtatctatagtc ttcatatctctagtcagtccactcatctactctgccttgctcatctccac tttagtttccttgtaactttgtctctgaaacttctgtttcttgaccagat ctgagagtcttcccagggttaatattctcagtctgaaacttttgatctct ttctgagggcaagggtttatctcttcattcagttagccagccagcatttg ctgatttttgcttgacatggagaatgttagcagtgatgacagactgaact ctcgggaataaaatgagttaaacttggttcttgcccttttctggatgtgg catgtgaacaacgcgggacatgaaaattcatacgctggaactatgtacaa agtgctttgaagcatgggacagtgagcagtaaatgactaactctgccttg gggagagaactttgaatttcctctggaatagtaagaatagtaagaggctg cttatgtcttaaaggactcggctctctcattccatcatgtgagctccaga tgtctaactctgaattccctcctgaaggttgaggagtgagactgaaagtc tcttaaccttggcttggcctttctatgaccagctcccctcctgatgctgc ttagaggttgcattaggatatgccaccagcagagaaagatacccttatca ttttgaaaaattacaaggattctaggagatatatgtctgaaaatagcaat ggagattaatatgtatgcacatatgtaaatacatgctgtgctcaagggac ataataaagctctgcttcatggagagactgatggttatctgtgaaacgca ccagaaaggcatcagaacccctggaactggagttacaaatagttctagta cccatggagggtgctgagagtcaactcagtctctggagaacagccagtgc ctctaaactggggagcttcttctcagcccccctgaaccctctagactagt cttattgaaatttccagcgaactgaactggtgaagagctcggcctctggc atctatggttaaggct
quality values	Open. Hide. 61 43 50 39 61 61 61 47 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 36 52 36 30 30 36 30 52 59 61 61 61 61 61 59 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 41 61 61 61 61 61 61 61 34 47 61 61 61 61 61 61 53 61 61 61 45 61 61 57 53 57 57 53 57 57 57 53 57 50 57 57 57 53 57 50 57 57 53 53 57 53 53 57 57 57 57 57 47 53 53 57 57 57 57 57 45 57 53 57 57 57 52 57 57 53 57 57 57 53 53 57 53 40 53 50 53 53 57 50 53 53 43 47 47 53 53 57 57 57 57 40 57 50 53 52 38 53 57 52 53 57 45 45 57 52 42 46 53 53 53 47 53 52 50 38 38 42 50 50 57 45 57 42 42 52 39 52 53 57 32 57 32 52 30 53 53 50 46 53 52 50 57 42 50 50 53 42 57 53 28 57 47 24 53 50 53 52 39 52 50 57 53 53 36 36 53 53 36 46 24 53 52 35 52 53 37 40 52 40 52 40 28 34 29 52 53 35 53 37 42 38 45 52 37 52 36 37 42 43 42 29 40 24 46 45 35 31 43 36 44 41 53 29 53 33 48 48 53 21 37 40 30 40 47 44 40 40 20 35 37 37 57 53 35 37 36 40 44 31 47 31 39 30 44 32 32 32 30 32 39 29 32 31 30 37 24 51 32 30 32 32 35 34 33 19 44 25 29 31 30 29 51 45 43 35 35 47 28 33 48 25 39 35 39 41 34 29 29 29 21 48 22 38 21 31 28 24 30 31 25 23 23 12 28 29 28 31 28 27 41 25 29 29 22 35 29 29 28 46 14 38 51 41 20 29 22 25 29 36 30 29 36 25 28 25 23 28 46 46 29 29 38 51 51 51 28 27 22 29 21 17 18 33 21 29 29 17 30 28 26 15 28 35 22 41 13 25 28 22 26 29 29 31 29 24 36 51 51 34 31 23 22 29 27 21 28 21 33 30 12 28 15 33 19 29 31 28 28 35 23 26 25 28 29 15 28 14 29 22 28 31 28 26 51 21 26 20 31 14 28 36 34 31 31 26 28 21 28 28 17 12 14 51 15 28 17 6 13 16 29 28 23 51 34 16 15 32 19 24 33 30 28 25 28 20 34 22 18 16 10 14 3 9 15 30 30 12 15 19 19 18 19 22 29 29 13 4 4 4 4 29 27 15 19 34 19 19 22 13 5 15 44 5 4 5 6 18 34 29 9 6 17 17 9 28 22 22 26 17 17 10 16 14 10 30 18 29 23 20 12 30 12 11 33 19 16 18 13 23 6 5 20 13 15 29 20 15 16 22 10 14 30 9 11 6 29 7 10 9 13 20 17 24 7 19 12 10 10 8 8 4 4 10 9 4 4 20 6 7 4 10 6 11 3 15 14 8 5 4 12 15 4 1 1 8 8 7 6 8 10 2 13 9 9 4 4 17 3 4 3 3 6 17 15 7 15 10 4 6 6 7 9 10 18 30 29 29 16 4 9 10 5 27 24 5 5 11 4 3 5 20 6 6 9 6 1 5 5 5 5 12 10 6 5 5 5 7 4 5 4 2 2 11 6 10 4 12 8 12 3 3 6 1 1 1 13 5 7 9 5 8 4 4 6 9 6 5 4 4 8 13 16 7 5 7 5 2 3 5 9 4 3 7 7 1 9 4 4 13 4 5 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_109497444_109498674
seq2: B6Ng01-014L02.b_48_1263

seq1  GAATTCCTGCCTCCTGCTGAGAAGAACTGGGTCTCTTCTTGGACACGAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGCCTCCTGCTGAGAAGAACTGGGTCTCTTCTTGGACACGAGG  50

seq1  ACATGGTGTTCTAATAAGTGCAGGAACATCTCTCAAATTGGCTGGATTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGGTGTTCTAATAAGTGCAGGAACATCTCTCAAATTGGCTGGATTGT  100

seq1  ACACATCCCAGTGACCTGATCTTTCTCCTTGGTGACTAGACTTGCTATGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACATCCCAGTGACCTGATCTTTCTCCTTGGTGACTAGACTTGCTATGT  150

seq1  CTTTCACTGGGGACCTTTCCCCTCTCAACACTAAATCTGTATCTATAGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCACTGGGGACCTTTCCCCTCTCAACACTAAATCTGTATCTATAGTC  200

seq1  TTCATATCTCTAGTCAGTCCACTCATCTACTCTGCCTTGCTCATCTCCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATATCTCTAGTCAGTCCACTCATCTACTCTGCCTTGCTCATCTCCAC  250

seq1  TTTAGTTTCCTTGTAACTTTGTCTCTGAAACTTCTGTTTCTTGACCAGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGTTTCCTTGTAACTTTGTCTCTGAAACTTCTGTTTCTTGACCAGAT  300

seq1  CTGAGAGTCTTCCCAGGGTTAATATTCTCAGTCTGAAACTTTTGATCTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGAGTCTTCCCAGGGTTAATATTCTCAGTCTGAAACTTTTGATCTCT  350

seq1  TTCTGAGGGCAAGGGTTTATCTCTTCATTCAGTTAGCCAGCCAGCATTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGGGCAAGGGTTTATCTCTTCATTCAGTTAGCCAGCCAGCATTTG  400

seq1  CTGATTTTTGCTTGACATGGAGAATGTTAGCAGTGATGACAGACTGAACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATTTTTGCTTGACATGGAGAATGTTAGCAGTGATGACAGACTGAACT  450

seq1  CTCGGGAATAAAATGAGTTAAACTTGGTTCTTGCCCTTTTCTGGATGTGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGGGAATAAAATGAGTTAAACTTGGTTCTTGCCCTTTTCTGGATGTGG  500

seq1  CATGTGAACAACGCGGGACATGAAAATTCATACGCTGGAACTATGTACAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGAACAACGCGGGACATGAAAATTCATACGCTGGAACTATGTACAA  550

seq1  AGTGCTTTGAAGCATGGGACAGTGAGCAGTAAATGACTAACTCTGCCTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTTTGAAGCATGGGACAGTGAGCAGTAAATGACTAACTCTGCCTTG  600

seq1  GGGAGAGAACTTTGAATTTCCTCTGGAATAGTAAGAATAGTAAGAGGCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGAGAACTTTGAATTTCCTCTGGAATAGTAAGAATAGTAAGAGGCTG  650

seq1  CTTATGTCTTAAAGGACTCGGCTCTCTCATTCCATCATGTGAGCTCCAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATGTCTTAAAGGACTCGGCTCTCTCATTCCATCATGTGAGCTCCAGA  700

seq1  TGTCTAACTCTGAATTCCCTCCTGAAGGTTGAGGAGTGAGACTGAAAGTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTAACTCTGAATTCCCTCCTGAAGGTTGAGGAGTGAGACTGAAAGTC  750

seq1  TCTTAACCTTGGCTTGGCCTTTCTATGACCAGCTCCCCTCCTGATGCTGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAACCTTGGCTTGGCCTTTCTATGACCAGCTCCCCTCCTGATGCTGC  800

seq1  TTAGAGGTTGCATTAGGATATGCCACCAGCAGAGAAAGATACCCTTATCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAGGTTGCATTAGGATATGCCACCAGCAGAGAAAGATACCCTTATCA  850

seq1  TTTTGAAAAATTACAAGGATTCTAGGAGATATATGTCTGAAAATAGCAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGAAAAATTACAAGGATTCTAGGAGATATATGTCTGAAAATAGCAAT  900

seq1  GGAGATTAATATGTATGCACATATGTAAATACATGCTGTGCTCAAGGGAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGATTAATATGTATGCACATATGTAAATACATGCTGTGCTCAAGGGAC  950

seq1  ATAATAAAGCTCTGCTTCATGGAGAAGACTGATGGTTATCTGAAGGAAAC  1000
      |||||||||||||||||||||||| |||||||||||||||||   |||||
seq2  ATAATAAAGCTCTGCTTCATGGAG-AGACTGATGGTTATCTG--TGAAAC  997

seq1  GCACCAGAAAGGGCATCAGAACCCCTGGAACTGGAGTTAACAAATAGTTC  1050
      |||||||||| ||||||||||||||||||||||||||| |||||||||||
seq2  GCACCAGAAA-GGCATCAGAACCCCTGGAACTGGAGTT-ACAAATAGTTC  1045

seq1  TTAGTACCCATGGA-GGTGCTGAGAGTCAAACCTCAGTCCTCTGGAAGAA  1099
       ||||||||||||| |||||||||||||||  |||||| |||||| ||||
seq2  -TAGTACCCATGGAGGGTGCTGAGAGTCAA--CTCAGT-CTCTGG-AGAA  1090

seq1  CAGCCAGTG-CTCTTAACTGGTGAGCTTTCTTCTCAGCCCCCCTGACCCC  1148
      ||||||||| |||| |||||| |||| ||||||||||||||||||| |||
seq2  CAGCCAGTGCCTCTAAACTGGGGAGC-TTCTTCTCAGCCCCCCTGAACCC  1139

seq1  TCTAAGACTAGGTCTTATTTTGAATTTCAGGCTGACTTGAAACTGGTGGT  1198
      ||| |||||| |||||| ||  ||||||  ||  |||   ||||||||  
seq2  TCT-AGACTA-GTCTTA-TTGAAATTTCCAGCGAACT--GAACTGGTGAA  1184

seq1  GAGCT--GCTTCCTGGCATTCTATGGTTATAGGCT  1231
      |||||  || | |||||| |||||||||| |||||
seq2  GAGCTCGGCCT-CTGGCA-TCTATGGTTA-AGGCT  1216

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information