MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-027F03
Chromosome	7 (Build37)
Map Location	55,182,656 - 55,183,204
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Uevld, C86187, LOC384623, ENSMUSG00000056509, Spty2d1, LOC100040174, Tmem86a, Ptpn5, LOC100041710, Mrgpra6, EG668725, Gm660, Mrgpra1, LOC668846, LOC100040217, LOC668727, Mrgpra2, LOC638950, Mrgprc4-ps, LOC677457, EG668729, Mrgpra3, Mrgprc1-ps, LOC100040314, Mrgprc3-ps, EG435977, EG619792, Mrgprc7-ps, Mrgpra18-ps, EG435978
Downstream gene	Mrgprc2-ps, Mrgpra4, Mrgprx1, Mrgprb7-ps, Mrgprb12-ps, EG270335, Mrgprb5, Mrgprb4, Mrgprb13, Mrgprb8, Mrgprb1, Mrgprx2, Mrgprb2, Mrgprb9-ps, Mrgprb3, EG639116, Zdhhc13, Csrp3, E2f8, LOC100040465
Link	Open Mouse BAC browser

Click to get alignment info.

name	Uevld (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C86187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs

name	LOC384623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins pseudo : _no_value

name	ENSMUSG00000056509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Spty2d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101685 MGI:2142062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tmem86a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67893 MGI:1915143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19259 MGI:97807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041710 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Mrgpra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668725 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins

name	Mrgpra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233221 MGI:3033095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC100040217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins

name	Mrgpra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235712 MGI:3033098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins

name	Mrgprc4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404257 MGI:3033197
definition	gene_synonym : MrgC4 note : MAS-related GPR, member C4, pseudogene pseudo : _no_value

name	LOC677457 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	EG668729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668729 MGI:3644993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Mrgpra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233222 MGI:2684085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprc1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269921 MGI:3033136
definition	gene_synonym : MrgC1 note : MAS-related GPR, member C1, pseudogene pseudo : _no_value

name	LOC100040314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Mrgprc3-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404256 MGI:3033196
definition	gene_synonym : MrgC3 note : MAS-related GPR, member C3, pseudogene pseudo : _no_value

name	EG435977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435977 MGI:3642992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	EG619792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619792 MGI:3647950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Mrgprc7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404255 MGI:3033141
definition	gene_synonym : MrgC7 note : MAS-related GPR, member C7, pseudogene pseudo : _no_value

name	Mrgpra18-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404262 MGI:3033177
definition	gene_synonym : MrgA18 note : MAS-related GPR, member A18, pseudogene pseudo : _no_value

name	EG435978 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435978 MGI:3647104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Mrgprc2-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404254 MGI:3033137
definition	gene_synonym : MrgC2 note : MAS-related GPR, member C2, pseudogene pseudo : _no_value

name	Mrgpra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235854 MGI:3033100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404242 MGI:3033139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404252 MGI:3033123
definition	gene_synonym : MrgB7 note : MAS-related GPR, member B7, pseudogene pseudo : _no_value

name	Mrgprb12-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404264 MGI:3033192
definition	gene_synonym : MrgB12 note : MAS-related GPR, member B12, pseudogene pseudo : _no_value

name	EG270335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270335 MGI:3644283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein

name	Mrgprb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404239 MGI:3033121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233230 MGI:3033119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620137 MGI:3033193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	Mrgprb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404240 MGI:3033134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233231 MGI:3033115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243978 MGI:3588270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243979 MGI:2441674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb9-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404253 MGI:3033133
definition	gene_synonym : MrgB9 note : MAS-related GPR, member B9, pseudogene pseudo : _no_value

name	Mrgprb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404238 MGI:3033117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG639116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639116 MGI:3646194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins

name	Zdhhc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243983 MGI:1919227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csrp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13009 MGI:1330824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108961 MGI:1922038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Uevld (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:104294889 GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UEV and lactate/malate dehyrogenase domains transcript_id : NM_001040695.1

name	C86187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257310 GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs product : expressed sequence C86187 transcript_id : XM_001477244.1

name	ENSMUSG00000056509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257312 GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : predicted gene, ENSMUSG00000056509 transcript_id : XM_001477255.1

name	Spty2d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592079 GeneID:101685 MGI:2142062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) transcript_id : NM_175318.3

name	LOC100040174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257260 GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040174 transcript_id : XM_001474210.1

name	Tmem86a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803294 GeneID:67893 MGI:1915143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 86A transcript_id : NM_026436.2

name	Ptpn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305424 GeneID:19259 MGI:97807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 5 transcript_id : NM_013643.1

name	LOC100041710 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257314 GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041710 transcript_id : XM_001477303.1

name	Mrgpra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517721 GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A6 transcript_id : NM_205821.2

name	EG668725 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257187 GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668725 transcript_id : XM_001471922.1

name	Gm660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257316 GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins product : gene model 660, (NCBI) transcript_id : XM_195647.6

name	Mrgpra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346520 GeneID:233221 MGI:3033095
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A1 transcript_id : NM_153095.1

name	LOC668727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94380441 GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins product : similar to Mrgpra2 protein transcript_id : XM_001003345.1

name	Mrgpra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802843 GeneID:235712 MGI:3033098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A2 transcript_id : NM_153101.2

name	LOC638950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257262 GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins product : similar to MRGA G protein-coupled receptor transcript_id : XM_001474357.1

name	LOC677457 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257264 GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474409.1

name	Mrgpra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346466 GeneID:233222 MGI:2684085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A3 transcript_id : NM_153067.1

name	LOC100040314 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257266 GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474490.1

name	EG435977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257268 GeneID:435977 MGI:3642992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG435977 transcript_id : XM_488036.4

name	EG435978 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257273 GeneID:435978 MGI:3647104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG435978 transcript_id : XM_884240.3

name	Mrgpra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943788 GeneID:235854 MGI:3033100
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A4 transcript_id : NM_153524.1

name	Mrgprx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351339 GeneID:404242 MGI:3033139
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member X1 transcript_id : NM_207540.2

name	EG270335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257319 GeneID:270335 MGI:3644283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein product : predicted gene, EG270335, transcript variant 1 transcript_id : XM_194527.7

name	Mrgprb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430531 GeneID:404239 MGI:3033121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B5 transcript_id : NM_207538.1

name	Mrgprb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45429987 GeneID:233230 MGI:3033119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B4 transcript_id : NM_205795.1

name	Mrgprb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82906020 GeneID:620137 MGI:3033193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins product : MAS-related GPR, member B13 transcript_id : XM_884524.1

name	Mrgprb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430533 GeneID:404240 MGI:3033134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B8 transcript_id : NM_207539.1

name	Mrgprb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356046 GeneID:233231 MGI:3033115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B1 transcript_id : NM_205810.3

name	Mrgprx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802509 GeneID:243978 MGI:3588270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member X2 transcript_id : NM_001034868.2

name	Mrgprb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801044 GeneID:243979 MGI:2441674
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B2 transcript_id : NM_175531.3

name	Mrgprb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430529 GeneID:404238 MGI:3033117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B3 transcript_id : NM_207537.1

name	EG639116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257275 GeneID:639116 MGI:3646194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins product : predicted gene, EG639116 transcript_id : XM_001474703.1

name	Zdhhc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354488 GeneID:243983 MGI:1919227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 13 transcript_id : NM_028031.2

name	Csrp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476047 GeneID:13009 MGI:1330824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and glycine-rich protein 3 transcript_id : NM_013808.3

name	E2f8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380194 GeneID:108961 MGI:1922038
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 8 transcript_id : NM_001013368.4

name	LOC100040465 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257277 GeneID:100040465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100040465 transcript_id : XM_001474722.1

name	Uevld (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:104294890 GeneID:54122 MGI:1860490
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006096 - glycolysis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : signaling molecule ATTP protein_id : NP_001035785.1

name	C86187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257311 GeneID:97402 MGI:2142361
definition	codon_start : 1 product : hypothetical protein LOC97402 protein_id : XP_001477294.1

name	ENSMUSG00000056509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257313 GeneID:629141 MGI:3642801
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477305.1

name	Spty2d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592080 CCDS:CCDS21293.1 GeneID:101685 MGI:2142062
definition	codon_start : 1 note : P16H6 product : SPT2, Suppressor of Ty, domain containing 1 protein_id : NP_780527.2

name	LOC100040174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257261 GeneID:100040174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474260.1

name	Tmem86a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312738 GeneID:67893 MGI:1915143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67893 protein_id : NP_080712.1

name	Ptpn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305425 CCDS:CCDS21294.1 GeneID:19259 MGI:97807
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein tyrosine phosphatase, non-receptor type 5 protein_id : NP_038671.1

name	LOC100041710 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257315 GeneID:100041710
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477353.1

name	Mrgpra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517722 GeneID:381886 MGI:3033107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MrgA6 G protein-coupled receptor product : MAS-related GPR, member A6 protein_id : NP_991390.2

name	EG668725 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257188 GeneID:668725 MGI:3644999
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471972.1

name	Gm660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257317 GeneID:269919 MGI:2685506
definition	codon_start : 1 product : similar to G-protein coupled adenine receptor protein_id : XP_195647.6

name	Mrgpra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346521 CCDS:CCDS21295.1 GeneID:233221 MGI:3033095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RF-amide G protein-coupled receptor product : MAS-related GPR, member A1 protein_id : NP_694735.1

name	LOC668727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94380442 GeneID:668727
definition	codon_start : 1 product : similar to Mrgpra2 protein protein_id : XP_001003345.1

name	Mrgpra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346531 CCDS:CCDS21296.1 GeneID:235712 MGI:3033098
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Mas-related gene A2; G protein-coupled receptor MrgA2 product : MAS-related GPR, member A2 protein_id : NP_694741.1

name	LOC638950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257263 GeneID:638950
definition	codon_start : 1 product : similar to MRGA G protein-coupled receptor protein_id : XP_001474407.1

name	LOC677457 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257265 GeneID:677457
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474459.1

name	Mrgpra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346467 CCDS:CCDS21297.1 GeneID:233222 MGI:2684085
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor; Mas-related gene A3 product : G protein-coupled receptor MRGA3 protein_id : NP_694707.1

name	LOC100040314 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257267 GeneID:100040314
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474540.1

name	EG435977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257269 GeneID:435977 MGI:3642992
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_488036.4

name	EG435978 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257274 GeneID:435978 MGI:3647104
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_889333.3

name	Mrgpra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943789 CCDS:CCDS21298.1 GeneID:235854 MGI:3033100
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MrgA4 RF-amide G protein-coupled receptor product : MAS-related GPR, member A4 protein_id : NP_705744.1

name	Mrgprx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430536 CCDS:CCDS21299.1 GeneID:404242 MGI:3033139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member C11 protein_id : NP_997423.1

name	EG270335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906029 GeneID:270335 MGI:3644283
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_194527.5

name	Mrgprb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430532 CCDS:CCDS21300.1 GeneID:404239 MGI:3033121
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member B5 protein_id : NP_997421.1

name	Mrgprb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45429988 CCDS:CCDS21301.1 GeneID:233230 MGI:3033119
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MrgB4 G protein-coupled receptor product : MAS-related GPR, member B4 protein_id : NP_991364.1

name	Mrgprb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906021 GeneID:620137 MGI:3033193
definition	codon_start : 1 product : similar to MRGB8 protein_id : XP_889617.1

name	Mrgprb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430534 CCDS:CCDS21302.1 GeneID:404240 MGI:3033134
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member B8 protein_id : NP_997422.1

name	Mrgprb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370266 GeneID:233231 MGI:3033115
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MrgB1 G protein-coupled receptor product : MAS-related GPR, member B1 protein_id : NP_991379.2

name	Mrgprx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781696 GeneID:243978 MGI:3588270
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAS-related GPR, member B10 protein_id : NP_001030040.1

name	Mrgprb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425306 CCDS:CCDS21303.1 GeneID:243979 MGI:2441674
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAS-related GPR, member B2 protein_id : NP_780740.1

name	Mrgprb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430530 CCDS:CCDS21304.1 GeneID:404238 MGI:3033117
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member B3 protein_id : NP_997420.1

name	EG639116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257276 GeneID:639116 MGI:3646194
definition	codon_start : 1 product : similar to MrgB2 G protein-coupled receptor protein_id : XP_001474753.1

name	Zdhhc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229145 GeneID:243983 MGI:1919227
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : HIP14-related protein product : zinc finger, DHHC domain containing 13 protein_id : NP_082307.1

name	Csrp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304987 CCDS:CCDS21305.1 GeneID:13009 MGI:1330824
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IGI]; GO:0002026 - cardiac inotropy [Evidence IGI]; GO:0048738 - cardiac muscle development [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IEA] codon_start : 1 note : cysteine-rich protein 3; muscle LIM protein; cardiac LIM protein product : cysteine and glycine-rich protein 3 protein_id : NP_038836.1

name	E2f8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972650 GeneID:108961 MGI:1922038
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2f family member 8 protein_id : NP_001013386.2

name	LOC100040465 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257278 GeneID:100040465
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474772.1

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 2 pseudo : _no_value

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 1 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 2 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 1 pseudo : _no_value

name	EG619792 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619792
definition	number : 2 pseudo : _no_value

name	EG619792 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619792
definition	number : 1 pseudo : _no_value

name	LOC384623 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257309 GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_033136.1

name	LOC668846 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257318 GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to 1300018J18Rik protein pseudo : _no_value transcript_id : XR_033182.1

clone name	MSMg01-481K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-134H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410M11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-167K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-027F03.b	B6Ng01-027F03.g
ACC	DH858095	DH858096
length	543	1,232
definition	DH858095\|Mus musculus domesticus DNA, BAC clone: B6Ng01-027F03, 5' end.	DH858096\|Mus musculus domesticus DNA, BAC clone: B6Ng01-027F03, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	tctacctttaccaataaatacattatccagggaaagtactaagtaataaa ctttagagttaaactatcccttatatcaaagagactttacatatagagaa tattccctgtgatagctgtggagtacacatgcttctctaagagagataac aatttagatgacccatgaagtctccatgacacgattgcttaagcaggacc tcataatgacaacaacatttggcataccagtgcagatgggggaagtctca caagctgcatctcatgtacaagattctctttctctaagaggcctgtgatc ttctgctcttgcacagtgaggaagcccttgtattgtgtttgtgaatcatc ctactaggtaagagacataaactcctgggcacaaaaaaataaaaaaagaa gagagaatatgttttcttaagggctaattcctctgacagattgtgcaatc ccaagtcatcagctctaaacacatatccaatcaagcaacactaaatgatc tcaggatgatgtaagtatgtgtgtgtgtgtgtgtgtgtgtgtg	gaattccttctggtggctccagccaacttggcaggcactagcacacccag gatcttgggatcacagagaccagtctacacaggagagcacgtgagcagca gaagcaacagagcaccttggccaaggtaactttgggcctatatccacaga caggaggcagagctgagtcttacaaccctgggcaccttccttgccagagg agagtaggccatcaaggaggtggatctgagctccagacttctgggcaact tccctgcaagaaaagagcttacctacagagcctgctatgaccactgggac tcagcagagagttggacacccagaagtggtgacagaggctaacagaatca caggaggaacaagctccagtcagagacagctagaacatctaacaccacat attactagatggtgaaaggaaaacataagactcttactaacagaaagcaa gaccacaaggcatcaccaaaacctagtactcccaccaggggagtcctgga tactgcaacacaccagaaaagcaagactcggatttaaaataatatctcat gttggtggtagagaattttaagaagggcattaataacacacttaaagaaa tacaggagaacactgctaaaaagttagaagtccttacagaattatagaaa tcactgctaaacaggtataaagaatcacaaagcaaaaaggccaccaacag attgggaaaggatttttaccaattctaaatcagacagggcattaatatcc aatatatacaaagaactcaagaagctagactccagaaaacaaaataaccc cgtttaaaaaaatggggcacagagctaaacaagaattctcaactgaggaa tactgaatggctgagaagcacctgaaacatgttcaaaatccttaatcatc tgggaaatgcaatcaaacaccctgagattccacctcacaccagtcagaat gactagatcaaattcagtgacagctatgctgacaagatgtggagtagaga cactccttgatagctgtgggattgcagcttgacacccttgggaatcagtc tggcagtccctcaaaatgaatatgatataccggaggatccagccataccg cctttggcctataccgagaaattcattgaatgaacactgctccttgtctt gcaccctcttataaccgagctgaaacgagttctacaggagtagaagtgga cttcactggagctctcactctttacacagtat
quality values	Open. Hide. 59 61 61 61 61 61 61 61 61 61 61 38 38 61 61 61 61 61 61 31 34 20 32 23 24 32 26 20 23 27 59 55 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 44 59 61 61 61 61 61 61 59 59 59 44 44 44 44 44 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 55 61 61 61 61 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 57 57 57 57 57 57 57 57 57 57 57 57 53 57 57 57 57 53 57 41 42 57 46 36 57 57 57 57 57 57 57 53 57 47 53 57 53 57 57 53 57 57 57 52 52 52 57 57 57 53 57 53 57 50 36 20 19	Open. Hide. 61 47 55 49 61 28 28 16 20 20 22 28 28 22 43 59 59 61 61 61 35 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 55 61 61 61 61 61 61 61 59 55 59 49 49 44 35 43 59 52 61 61 61 59 61 61 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 55 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 55 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 53 61 53 53 61 50 50 53 53 61 61 53 53 61 61 61 61 50 53 61 61 61 61 61 61 52 61 61 61 61 61 53 61 61 61 61 53 61 61 47 35 61 61 61 61 61 61 61 50 52 61 53 53 53 53 57 42 35 57 42 36 57 57 53 53 53 57 57 53 51 53 53 53 53 53 57 39 47 53 42 39 57 57 42 57 57 57 50 53 40 38 57 57 53 53 53 50 57 28 17 57 46 30 47 42 42 45 57 53 45 57 57 52 53 53 57 57 52 52 57 47 53 57 57 50 52 50 53 52 46 47 41 20 57 47 53 45 47 53 57 53 53 28 57 47 53 57 50 53 50 50 37 46 41 26 50 42 45 31 57 42 52 36 45 57 37 45 43 52 50 42 42 53 57 53 41 45 37 38 52 53 47 41 31 57 52 38 27 47 52 34 38 50 38 57 57 38 47 34 32 48 36 52 34 46 46 33 50 33 46 57 57 31 17 46 23 53 30 37 46 22 39 53 30 41 33 21 52 46 46 30 35 29 21 20 40 25 14 57 57 57 53 36 43 24 7 30 37 52 37 36 45 41 35 37 37 21 30 40 36 27 44 37 39 32 20 25 46 35 40 36 28 37 29 44 20 31 30 27 37 31 48 34 53 24 57 28 32 36 30 33 37 33 29 29 30 40 33 27 30 30 25 30 29 23 29 27 40 24 19 46 47 44 30 20 16 45 45 24 18 22 22 22 32 39 46 34 39 51 30 34 51 51 51 46 46 29 30 41 51 46 29 28 30 26 29 27 43 17 28 39 16 45 32 29 37 29 23 30 12 19 29 31 35 36 28 28 27 29 29 31 25 21 28 29 29 29 29 25 29 18 30 21 43 18 10 19 28 32 7 30 30 14 19 19 21 26 29 35 36 41 29 22 14 21 29 28 28 34 31 46 39 23 28 31 27 27 34 25 23 25 28 23 33 20 29 36 39 19 28 41 18 17 27 13 32 27 28 29 27 25 13 13 12 20 38 23 29 34 35 14 22 12 15 39 15 6 22 15 28 18 9 19 14 14 46 15 23 21 31 19 21 7 33 16 28 27 23 16 36 11 20 17 25 35 51 26 6 23 30 6 7 7 22 20 17 19 20 21 12 8 7 20 23 20 30 28 22 19 5 6 6 14 22 21 23 24 18 14 9 30 7 8 13 8 6 5 15 29 19 30 14 18 33 8 8 15 10 9 7 23 4 7 25 28 23 13 13 19 11 30 11 26 19 8 9 3 4 12 12 12 7 5 5 4 17 7 23 22 9 9 7 5 5 6 8 31 18 7 7 9 24 6 10 14 14 5 13 28 30 22 6 7 4 8 7 10 7 8 18 8 26 9 9 13 7 8 5 8 14 13 16 10 22 11 8 8 7 9 18 4 5 8 6 7 8 23 4 8 8 17 26 8 7 5 5 5 5 19 14 7 11 7 5 11 6 4 4 9 17 4 2 2 3 3 1 2 5 6 5 3 4 5 12 3 5 6 3 5 6 3 4 3 5 6 11 4 4 12 19 11 4 13 12 6 6 4 9 5 5 7 3 12 6 5 4 12 3 3 6 6 1 4 5 4 6 14 7 4 3 2 2 9 10 3 2 2 3 8 9 7 9 10 3 2 3 21 15 4 4 3 7 18 4 7 6 2 2 3 2 5 6 3 5 3 10 7 3 4 3 4 2 1 2 2 1 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_55182656_55183204
seq2: B6Ng01-027F03.b_45_593

seq1  GAATTCTCTACCTTTACCAATAAATACATTATCCAGGGAAAGTACTAAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTACCTTTACCAATAAATACATTATCCAGGGAAAGTACTAAGT  50

seq1  AATAAACTTTAGAGTTAAACTATCCCTTATATCAAAGAGACTTTACATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAACTTTAGAGTTAAACTATCCCTTATATCAAAGAGACTTTACATAT  100

seq1  AGAGAATATTCCCTGTGATAGCTGTGGAGTACACATGCTTCTCTAAGAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAATATTCCCTGTGATAGCTGTGGAGTACACATGCTTCTCTAAGAGA  150

seq1  GATAACAATTTAGATGACCCATGAAGTCTCCATGACACGATTGCTTAAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAACAATTTAGATGACCCATGAAGTCTCCATGACACGATTGCTTAAGC  200

seq1  AGGACCTCATAATGACAACAACATTTGGCATACCAGTGCAGATGGGGGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACCTCATAATGACAACAACATTTGGCATACCAGTGCAGATGGGGGAA  250

seq1  GTCTCACAAGCTGCATCTCATGTACAAGATTCTCTTTCTCTAAGAGGCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCACAAGCTGCATCTCATGTACAAGATTCTCTTTCTCTAAGAGGCCT  300

seq1  GTGATCTTCTGCTCTTGCACAGTGAGGAAGCCCTTGTATTGTGTTTGTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATCTTCTGCTCTTGCACAGTGAGGAAGCCCTTGTATTGTGTTTGTGA  350

seq1  ATCATCCTACTAGGTAAGAGACATAAACTCCTGGGCACAAAAAAATAAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCCTACTAGGTAAGAGACATAAACTCCTGGGCACAAAAAAATAAAA  400

seq1  AAAGAAGAGAGAATATGTTTTCTTAAGGGCTAATTCCTCTGACAGATTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAGAGAGAATATGTTTTCTTAAGGGCTAATTCCTCTGACAGATTGT  450

seq1  GCAATCCCAAGTCATCAGCTCTAAACACATATCCAATCAAGCAACACTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATCCCAAGTCATCAGCTCTAAACACATATCCAATCAAGCAACACTAA  500

seq1  ATGATCTCAGGATGATGTAAGTATGTGTGTGTGTGTGTGTGTGTGTGTG  549
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATCTCAGGATGATGTAAGTATGTGTGTGTGTGTGTGTGTGTGTGTG  549

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information