MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-036B17
Chromosome	7 (Build37)
Map Location	10,961,134 - 11,135,926
singlet/doublet	doublet
Overlap gene	Nlrp4d, LOC100042214, V1re10, Zik1, EG628580
Upstream gene	LOC100042848, LOC100042096, LOC100042870, LOC100042105, LOC100042859, LOC100042113, LOC100042120, LOC100042126, LOC100042139, LOC100042894, Vmn2r47, 2810047C21Rik, LOC665625, LOC545911, EG625580, LOC100042163, LOC625605, EG434117, EG628152, LOC100042921, Vmn2r52, LOC665663, V1re11, LOC628521, LOC628525, LOC100042206
Downstream gene	V1re9, V1rl1, EG628596, Nlrp4b, LOC333184, V1re13, BQ559217, LOC637237, LOC236479, EG665879, Zscan4b, LOC665793, EG665798, Gm397, Zscan4-ps1, LOC635187, LOC100042997, LOC100042293, Zscan4d, LOC628737, LOC676750, LOC672893, LOC546931, LOC675762, Zscan4e, LOC665857, LOC665861, Zscan4f, LOC673742, LOC665887, LOC637541, LOC100042361, Zscan4-ps2, LOC675782, LOC100042386
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 21 Proteins

name	LOC100042096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins pseudo : _no_value

name	LOC100042113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC100042120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100042126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	LOC100042139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	Vmn2r47 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 4 ESTs, 13 Proteins

name	2810047C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72716 MGI:1919966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC665625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC545911 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545911
definition	note : ring finger protein 127 pseudogene pseudo : _no_value

name	EG625580 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625580 MGI:3647749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins

name	LOC100042163 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC625605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 31 Proteins

name	EG434117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434117 MGI:3643086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins

name	EG628152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628152 MGI:3646739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 34 Proteins

name	Vmn2r52 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	LOC665663 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1re11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171264 MGI:2159633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC628525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042206 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Nlrp4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384752 MGI:3056574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1re10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171263 MGI:2159632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zik1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22775 MGI:108070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628580 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628580 MGI:3648262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 Proteins

name	V1re9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252904 MGI:2182253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171262 MGI:2159699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628596 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628596 MGI:3645052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 351 ESTs, 7 Proteins

name	Nlrp4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210045 MGI:3056570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC333184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:333184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins pseudo : _no_value

name	V1re13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252910 MGI:2182255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BQ559217 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434555 MGI:3574103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein

name	LOC637237 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC236479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 46 Proteins pseudo : _no_value

name	EG665879 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665879 MGI:3646728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zscan4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665780 MGI:3645447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC665793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG665798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins pseudo : _no_value

name	Gm397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs

name	LOC635187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC100042997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins pseudo : _no_value

name	LOC100042293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zscan4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC628737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins pseudo : _no_value

name	LOC676750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC672893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC675762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Zscan4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC665857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins pseudo : _no_value

name	Zscan4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs

name	LOC673742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC637541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Zscan4-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs

name	LOC675782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100042386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256292 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479301.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256294 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479307.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256290 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479298.1

name	LOC100042870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256300 GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479319.1

name	LOC100042105 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256123 GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477579.1

name	LOC100042120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256126 GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 14 transcript_id : XM_001477597.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256313 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479362.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256311 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479351.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256315 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479369.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256305 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 9 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 1 transcript_id : XM_001479327.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256307 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 7 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 2 transcript_id : XM_001479336.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256309 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 3 transcript_id : XM_001479343.1

name	2810047C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256319 GeneID:72716 MGI:1919966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 2810047C21 gene, transcript variant 2 transcript_id : XM_899317.3

name	EG625580 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256321 GeneID:625580 MGI:3647749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins product : predicted gene, EG625580, transcript variant 1 transcript_id : XM_890962.3

name	LOC625605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379400 GeneID:625605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 27 Proteins product : similar to putative pheromone receptor, transcript variant 1 transcript_id : XM_890970.2

name	EG434117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379391 GeneID:434117 MGI:3643086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins product : predicted gene, EG434117 transcript_id : XM_485858.3

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256325 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479416.1

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256323 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479408.1

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256327 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479422.1

name	Vmn2r52 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903126 GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : vomeronasal receptor Vmn2r52, transcript variant 2 transcript_id : XM_899367.1

name	Vmn2r52 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903128 GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins product : vomeronasal receptor Vmn2r52, transcript variant 1 transcript_id : XM_891019.1

name	V1re11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098144 GeneID:171264 MGI:2159633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E11 transcript_id : NM_134230.2

name	Nlrp4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256128 GeneID:384752 MGI:3056574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : NLR family, pyrin domain containing 4D transcript_id : XM_001481310.1

name	V1re10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717774 GeneID:171263 MGI:2159632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E10 transcript_id : NM_134229.1

name	Zik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374193 GeneID:22775 MGI:108070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein interacting with K protein 1 transcript_id : NM_009577.3

name	EG628580 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903388 GeneID:628580 MGI:3648262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 Proteins product : predicted gene, EG628580 transcript_id : XM_893341.1

name	V1re9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560757 GeneID:252904 MGI:2182253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E9 transcript_id : NM_145842.2

name	V1rl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717764 GeneID:171262 MGI:2159699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, L1 transcript_id : NM_134228.1

name	EG628596 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379401 GeneID:628596 MGI:3645052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 351 ESTs, 7 Proteins product : predicted gene, EG628596 transcript_id : XM_893358.2

name	Nlrp4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350253 GeneID:210045 MGI:3056570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4B transcript_id : NM_172481.2

name	V1re13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543929 GeneID:252910 MGI:2182255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E13 transcript_id : NM_145848.2

name	Zscan4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256349 GeneID:665780 MGI:3645447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : zinc finger and SCAN domain containing 4B transcript_id : XM_979403.2

name	Gm397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131157 GeneID:245109 MGI:2685243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 397, (NCBI) transcript_id : NM_001013765.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379416 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 2 transcript_id : XM_891198.2

name	Zscan4-ps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379414 GeneID:545912 MGI:3645953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 1, transcript variant 3 transcript_id : XM_983203.1

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379420 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 4 transcript_id : XM_899474.2

name	Zscan4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379421 GeneID:545913 MGI:3645954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4D, transcript variant 1 transcript_id : XM_620418.3

name	Zscan4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256374 GeneID:665848 MGI:3643613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : zinc finger and SCAN domain containing 4E transcript_id : XM_979850.2

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256381 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : zinc finger and SCAN domain containing 4F transcript_id : XM_001479557.1

name	Zscan4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379425 GeneID:665902 MGI:3708485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4F, transcript variant 2 transcript_id : XM_983435.1

name	LOC100042361 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256132 GeneID:100042361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001478041.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256390 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 1 transcript_id : XM_001479576.1

name	Zscan4-ps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256392 GeneID:665913 MGI:3708487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs product : zinc finger and SCAN domain containing 4, pseudogene 2, transcript variant 2 transcript_id : XM_001479587.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256291 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479348.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256293 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479351.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256295 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479357.1

name	LOC100042870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256301 GeneID:100042870
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479369.1

name	LOC100042105 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256124 GeneID:100042105
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477629.1

name	LOC100042120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256127 GeneID:100042120
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 protein_id : XP_001477647.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256314 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479412.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256312 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479401.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256316 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479419.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256308 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479386.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256306 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479377.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256310 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479393.1

name	2810047C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256320 GeneID:72716 MGI:1919966
definition	codon_start : 1 product : hypothetical protein LOC72716 isoform 2 protein_id : XP_904410.3

name	EG625580 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256322 GeneID:625580 MGI:3647749
definition	codon_start : 1 product : similar to putative pheromone receptor isoform 1 protein_id : XP_896055.3

name	LOC625605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903123 GeneID:625605
definition	codon_start : 1 product : similar to putative pheromone receptor isoform 1 protein_id : XP_896063.1

name	EG434117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51742862 GeneID:434117 MGI:3643086
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_485858.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256326 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479466.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256324 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479458.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256328 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479472.1

name	Vmn2r52 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903127 GeneID:384534
definition	codon_start : 1 product : similar to predicted gene, EG665255 isoform 2 protein_id : XP_904460.1

name	Vmn2r52 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903129 GeneID:384534
definition	codon_start : 1 product : similar to predicted gene, EG665255 isoform 1 protein_id : XP_896112.1

name	V1re11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098145 CCDS:CCDS20790.1 GeneID:171264 MGI:2159633
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 E3 product : vomeronasal 1 receptor, E11 protein_id : NP_598991.2

name	Nlrp4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256129 GeneID:384752 MGI:3056574
definition	codon_start : 1 note : overriding stop codons product : NLR family, pyrin domain containing 4D protein_id : XP_001481360.1 transl_except : (pos:complement(10967341..10967343),aa:OTHER) transl_except : (pos:complement(10967335..10967337),aa:OTHER) transl_except : (pos:complement(10967314..10967316),aa:OTHER) transl_except : (pos:complement(10967266..10967268),aa:OTHER) transl_except : (pos:complement(10967239..10967241),aa:OTHER) transl_except : (pos:complement(10967236..10967238),aa:OTHER) transl_except : (pos:complement(10967233..10967235),aa:OTHER) transl_except : (pos:complement(10967221..10967223),aa:OTHER) transl_except : (pos:complement(10967203..10967205),aa:OTHER) transl_except : (pos:complement(10967146..10967148),aa:OTHER) transl_except : (pos:complement(10967122..10967124),aa:OTHER) transl_except : (pos:complement(10966789..10966791),aa:OTHER) transl_except : (pos:complement(10966756..10966758),aa:OTHER) transl_except : (pos:complement(10966747..10966749),aa:OTHER) transl_except : (pos:complement(10966723..10966725),aa:OTHER) transl_except : (pos:complement(10966663..10966665),aa:OTHER) transl_except : (pos:complement(10966600..10966602),aa:OTHER) transl_except : (pos:complement(10966570..10966572),aa:OTHER) transl_except : (pos:complement(10966564..10966566),aa:OTHER) transl_except : (pos:complement(10966543..10966545),aa:OTHER) transl_except : (pos:complement(10966489..10966491),aa:OTHER) transl_except : (pos:complement(10966477..10966479),aa:OTHER) transl_except : (pos:complement(10966450..10966452),aa:OTHER) transl_except : (pos:complement(10966408..10966410),aa:OTHER) transl_except : (pos:complement(10966390..10966392),aa:OTHER) transl_except : (pos:complement(10966357..10966359),aa:OTHER) transl_except : (pos:complement(10966354..10966356),aa:OTHER) transl_except : (pos:complement(10963708..10963710),aa:OTHER) transl_except : (pos:complement(10963657..10963659),aa:OTHER) transl_except : (pos:complement(10963201..10963203),aa:OTHER) transl_except : (pos:complement(10963192..10963194),aa:OTHER) transl_except : (pos:complement(10963156..10963158),aa:OTHER) transl_except : (pos:complement(10963138..10963140),aa:OTHER) transl_except : (pos:complement(10963129..10963131),aa:OTHER) transl_except : (pos:complement(10963093..10963095),aa:OTHER) transl_except : (pos:complement(10963075..10963077),aa:OTHER) transl_except : (pos:complement(10960385..10960387),aa:OTHER) transl_except : (pos:complement(10960373..10960375),aa:OTHER) transl_except : (pos:complement(10960370..10960372),aa:OTHER) transl_except : (pos:complement(10960316..10960318),aa:OTHER) transl_except : (pos:complement(10957517..10957519),aa:OTHER) transl_except : (pos:complement(10957493..10957495),aa:OTHER) transl_except : (pos:complement(10957484..10957486),aa:OTHER) transl_except : (pos:complement(10957442..10957444),aa:OTHER) transl_except : (pos:complement(10957430..10957432),aa:OTHER) transl_except : (pos:complement(10957409..10957411),aa:OTHER) transl_except : (pos:complement(10957360..10957362),aa:OTHER) transl_except : (pos:complement(10957345..10957347),aa:OTHER) transl_except : (pos:complement(10949606..10949608),aa:OTHER) transl_except : (pos:complement(10949585..10949587),aa:OTHER) transl_except : (pos:complement(10949534..10949536),aa:OTHER) transl_except : (pos:complement(10949528..10949530),aa:OTHER) transl_except : (pos:complement(10949501..10949503),aa:OTHER) transl_except : (pos:complement(10948291..10948293),aa:OTHER) transl_except : (pos:complement(10948285..10948287),aa:OTHER) transl_except : (pos:complement(10948264..10948266),aa:OTHER) transl_except : (pos:complement(10948234..10948236),aa:OTHER) transl_except : (pos:complement(10948216..10948218),aa:OTHER) transl_except : (pos:complement(10948195..10948197),aa:OTHER) transl_except : (pos:complement(10948186..10948188),aa:OTHER) transl_except : (pos:complement(10948171..10948173),aa:OTHER)

name	V1re10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717775 GeneID:171263 MGI:2159632
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : vomeronasal 1 receptor, E10 protein_id : NP_598990.1

name	Zik1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544067 CCDS:CCDS20792.1 GeneID:22775 MGI:108070
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein interacting with K protein 1 protein_id : NP_033603.2

name	EG628580 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903389 GeneID:628580 MGI:3648262
definition	codon_start : 1 product : similar to vomeronasal receptor 1 E6 protein_id : XP_898434.1

name	V1re9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003898 CCDS:CCDS20793.1 GeneID:252904 MGI:2182253
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, E9 protein_id : NP_665841.1

name	V1rl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717765 CCDS:CCDS20794.1 GeneID:171262 MGI:2159699
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 D2 product : vomeronasal 1 receptor, L1 protein_id : NP_598989.1

name	EG628596 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903391 GeneID:628596 MGI:3645052
definition	codon_start : 1 product : similar to isolog of yeast sui1 and rice gos2; putative protein_id : XP_898451.1

name	Nlrp4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369660 CCDS:CCDS20795.1 GeneID:210045 MGI:3056570
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NACHT/LRR/pyrin domain-containing protein 4b product : NACHT, leucine rich repeat and PYD containing 4B protein_id : NP_766069.1

name	V1re13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003900 CCDS:CCDS20796.1 GeneID:252910 MGI:2182255
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, E13 protein_id : NP_665847.1

name	Zscan4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379403 GeneID:665780 MGI:3645447
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) protein_id : XP_984497.1

name	Gm397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000642 GeneID:245109 MGI:2685243
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245109 protein_id : NP_001013787.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903136 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 2 protein_id : XP_896291.1

name	Zscan4-ps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379415 GeneID:545912 MGI:3645953
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 3 protein_id : XP_988297.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555372 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 1 protein_id : XP_620418.1

name	Zscan4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903148 GeneID:545913 MGI:3645954
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) isoform 4 protein_id : XP_904567.1

name	Zscan4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379413 GeneID:665848 MGI:3643613
definition	codon_start : 1 product : similar to Gene model 397, (NCBI) protein_id : XP_984944.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256382 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479607.1

name	Zscan4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379426 GeneID:665902 MGI:3708485
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_988529.1

name	LOC100042361 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256133 GeneID:100042361
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001478091.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256391 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001479626.1

name	Zscan4-ps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256393 GeneID:665913 MGI:3708487
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001479637.1

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 1 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 2 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 3 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 4 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 5 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 7 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 5 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 4 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 3 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 2 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 1 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 13 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 12 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 11 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 10 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 9 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 8 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 7 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 6 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 5 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 4 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 3 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 2 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 1 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 8 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 7 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 6 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 5 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 4 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 3 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 2 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 1 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 6 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 5 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 4 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 3 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 2 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 1 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 7 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 6 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 5 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 4 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 3 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 2 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 1 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 6 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 5 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 4 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 3 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 2 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 1 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 3 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 2 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 1 pseudo : _no_value

name	LOC628525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628525
definition	number : 1 pseudo : _no_value

name	LOC100042206 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042206
definition	number : 1 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 4 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 3 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 2 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 1 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 1 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 2 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 3 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 4 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 5 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 6 pseudo : _no_value

name	LOC637237 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637237
definition	number : 7 pseudo : _no_value

name	EG665879 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665879
definition	number : 2 pseudo : _no_value

name	EG665879 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665879
definition	number : 1 pseudo : _no_value

name	LOC665793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665793
definition	number : 1 pseudo : _no_value

name	LOC665793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665793
definition	number : 2 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 1 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 2 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 3 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 4 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 5 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 6 pseudo : _no_value

name	LOC635187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635187
definition	number : 7 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 3 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 2 pseudo : _no_value

name	LOC100042293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042293
definition	number : 1 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 3 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 2 pseudo : _no_value

name	LOC676750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676750
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 1 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 2 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 3 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 4 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 5 pseudo : _no_value

name	LOC672893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672893
definition	number : 6 pseudo : _no_value

name	LOC546931 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546931
definition	number : 1 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 3 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 2 pseudo : _no_value

name	LOC675762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675762
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 1 pseudo : _no_value

name	LOC665857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665857
definition	number : 2 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 1 pseudo : _no_value

name	LOC673742 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673742
definition	number : 2 pseudo : _no_value

name	LOC100042386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042386
definition	number : 1 pseudo : _no_value

name	LOC100042859 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256296 GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_034147.1

name	LOC100042113 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256125 GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15 pseudo : _no_value transcript_id : XR_033289.1

name	LOC333184 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256130 GeneID:333184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins product : similar to Mitochondrial methionyl-tRNA formyltransferase pseudo : _no_value transcript_id : XR_033395.1

name	BQ559217 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256343 GeneID:434555 MGI:3574103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein product : expresssed sequence BQ559217 transcript_id : XR_034223.1

name	LOC236479 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256346 GeneID:236479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 46 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034228.1

name	EG665798 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256351 GeneID:665798 MGI:3648689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins product : predicted gene, EG665798 pseudo : _no_value transcript_id : XR_002295.2

name	LOC100042997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256358 GeneID:100042997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 47 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034250.1

name	LOC628737 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256365 GeneID:628737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 18 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_034260.1

name	LOC665861 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256378 GeneID:665861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : similar to serine/threonine kinase AIE1 pseudo : _no_value transcript_id : XR_034271.1

name	LOC665887 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256385 GeneID:665887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : similar to tropomyosin pseudo : _no_value transcript_id : XR_034281.1

name	LOC637541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256131 GeneID:637541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033505.1

name	LOC675782 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256135 GeneID:675782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to aurora kinase C pseudo : _no_value transcript_id : XR_033520.1

clone name	MSMg01-367O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461G18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363F20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371O03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517B24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525F21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-096O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-036B17.b	B6Ng01-036B17.g
ACC	DH864391	DH864392
length	1,046	1,062
definition	DH864391\|Mus musculus domesticus DNA, BAC clone: B6Ng01-036B17, 5' end.	DH864392\|Mus musculus domesticus DNA, BAC clone: B6Ng01-036B17, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(10,961,134 - 10,962,199)	(11,134,845 - 11,135,926)
sequence	gaattctagcaggactttatcaagacaccacaccctgcctacatacttct gatggatgaaccaaagcaacttgtttgctcatgctatttgcagaaattat ttttttgctactgaatctacatttacctaggacccaatatgtacaccctg ttcttcatcgcaggacaggaggtcagggtttccctctgactgcatcagtg aagattccctcatcaatctgctagatgtgtgcactcttcgatatgatgta atctttagttttctatctcattgggtgatcttagactactctgatgatgt gtgagtttgatgataatttgctaactatctgtggctactttctgttactt attacttggtattttcttgctatataactcaataaacttaatcattcgaa accagaagcataattatcatacaaccatacagaaaaattgtttctgtggc tggaaaacaggataaaagtgcataaattaagaactgtagttctacatatt cgttcctgcctcccttttctgtcactaactgctaaccaggaaccactttc cttgcctctaataccacagtcctgcccataaatgaacttgatatgtgaag cacgtgacaccttttgaatcaaagtcatgacacctacaatatctgagatt catctagacacgatcaatagctacatgtatctacccagctaagtgacagt cagaatttcaaattttcaaatatgaacatctaccatgattggttcaggag gcactcattttttagccaatggagtcaaataggcatagccttacatcaca gtaggagttctaagttctaaggtaggtcagagctatgaaatctaaactta agccatgattccaaaatggaataacctaatctagaaattacattttacag tccataatcagttaaatttagtaaatttaaattagacatgcattttattt acatgtgagagttcactgtggtatctgtgtaccacatgcatactcatctt gtagatgtcgagatgtaagagccttggactaggttacagacaccgg	gaattcaccttttcaatagctacatgaaataagggttctgtctttcttca caagctacaagtatttgtttttattcataaaaaaattagaccagaaaaat agccatgggcatattctcaaggaatgtgtatagaatcacacaatggactt tttgaatctggccatcagaatcatttgtttaccagaaactacaattggaa ctctgggaaatgtcactcttatttcttctatctaatcctttactacagac aatgcacgataaaacccacagatttgattcccatgtacataataatgcac atacttatgcagccaatgctgtgattattctctcttcaggagtgccccac acaatgtcagcttttgggaggaaacagttcttgaattcttttgtatgcaa gctcctattgtatattcatggttttaggaggagtatatccattggcacca gctgctttttgagtgttttccagaccatgacaatcagccccagggaatcc tgtttggaagaatcaaaatgacaaagctggggaagtatattggctgcccc attatcattctatggggtcttctacatgtttgataaatttcatatcctct ctcaacacacttaacaattggaaaaaccaaacatgtgaacaagaaaaaca agattttggaatactgtttctattgtagggcaaaataaaattagtgaagt tcctctttggcagcattggtagtatgccctggagtcttattttctgtcct gatatcctatccagagggttcatgattgcccttctgctctgcacaatcag agtgttacacatctgtagttctatggtcctagagaaactctggggatccg aaaccaccagaatttcctggcccttcctcttttataactcctcacatact atgaagctggcattgcatttaatagtatactggtgactggtaaacatcaa tctcttcattctctgtgttttcactgtgggccttttcctatgaacctctc catttgtccagctgctaaaaataaaaagtagctaatgcagttttcaatga catgttgtgggt
quality values	Open. Hide. 47 42 18 27 61 47 53 40 43 47 35 50 61 31 37 61 61 61 49 47 38 36 47 55 61 61 29 38 40 26 41 25 27 28 28 37 52 52 55 55 52 59 37 59 49 59 52 59 52 59 59 59 59 59 59 59 59 59 61 59 59 59 52 49 59 52 59 59 59 61 59 59 61 44 59 52 59 52 52 59 52 59 61 59 55 59 59 59 59 59 59 59 52 61 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 59 59 61 59 59 59 59 52 59 59 61 55 55 61 61 61 61 59 59 61 59 61 61 61 59 52 59 59 59 59 59 52 59 59 61 61 61 59 61 59 61 61 59 59 61 52 59 59 49 59 59 52 61 59 61 59 59 61 61 59 61 59 61 59 59 61 61 59 61 61 61 61 59 59 61 59 61 61 61 59 61 59 59 61 59 59 52 59 61 61 61 59 61 59 59 61 59 59 59 59 52 59 59 59 59 61 61 59 61 59 59 59 44 61 59 59 59 59 59 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 59 52 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 59 61 59 59 59 59 61 59 59 61 61 59 61 61 61 59 59 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 59 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 52 55 55 55 55 55 61 55 55 55 61 61 55 61 61 61 52 61 61 61 61 61 43 52 55 52 49 52 52 55 55 55 55 55 52 55 52 52 52 52 55 52 55 55 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 47 61 61 61 61 61 50 61 61 61 61 61 61 61 55 61 61 61 50 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 47 53 61 61 61 61 35 61 47 61 61 61 61 61 61 61 61 61 61 50 61 61 61 50 61 61 45 61 50 53 47 32 61 61 61 53 50 52 50 43 47 32 42 27 39 61 47 45 53 42 50 61 61 53 61 53 43 61 53 50 47 53 53 45 20 57 50 50 43 50 42 53 52 53 53 47 24 36 53 50 57 53 38 53 53 57 47 45 50 57 53 45 50 57 53 53 36 30 38 50 38 50 43 32 42 50 25 17 10 15 21 24 45 32 28 42 14 47 57 53 38 34 47 45 45 21 57 52 35 38 52 35 38 53 37 23 23 33 57 42 42 45 24 28 45 45 45 53 45 28 53 13 37 33 37 41 23 33 40 26 22 22 38 38 25 40 22 27 19 47 26 19 34 28 13 27 40 33 52 17 38 42 25 30 36 50 42 23 18 57 31 21 25 40 33 22 52 19 39 36 24 33 18 36 42 38 21 25 53 37 23 57 31 33 25 53 25 10 57 57 45 52 25 41 25 22 29 20 21 28 25 29 17 26 38 27 14 14 29 23 27 30 24 13 14 29 27 22 35 25 12 11 16 30 8 29 12 22 28 29 15 7 5 5 5 8 10 24 29 29 30 27 17 24 24 29 30 30 18 11 19 20 32 23 29 9 10 6 31 14 23 24 18 24 18 45 47 24 25 44 29 27 18 31 47 15 11 25 12 9 14 10 10 19 27 25 27 32 19 33 14 33 10 17 11 14 26 8 22 36 21 9 23 17 5 27 15 29 25 16 28 18 34 31 34 14 33 22 34 41 27 14 13 46 20 20 20 26 32 14 27 26 21 34 43 19 32 24 26 39 23 8 23 12 10 5 6 6 7 15 23 19 8 7 10 23 21 16 12 10 41 29 13 16 39 7 7 26 36 43 27 17 28 16 8 12 28 33 6 16 12 29 16 35 23 14 24 15 20 30 16 31 41 9 36 11 9 19 36 28 7 41 27 9 30 12 25 21 19 10 25 23 13 31 29 21 14 36 51 38 28 15 28 38 30 17 13 9 20 13 8 7 14 6 18 13 38 17 12 8 44 8 18 9 5 15 9 20 23 17 9 10 5 4 5 15 30 21 8 10 7 28 31 26 14 20 27 10 22 21 25 35 24 23 9 24 13 8 8 26 13 17 9 13 5 14 5 16 6 11 13 28 11 6 21 6 25 16 14 18 6 7 29 9 11 6 4 4 4 14 13 9 5 10 29 10 30 5 21 13 5	Open. Hide. 50 61 37 47 55 43 14 31 31 19 19 23 31 32 22 22 34 37 52 55 55 55 61 49 61 55 61 55 61 55 55 52 50 55 61 59 59 61 59 59 59 61 61 61 61 61 59 59 59 59 59 52 59 52 59 55 59 59 52 59 55 59 59 61 59 55 59 59 59 61 61 61 61 59 55 55 59 59 59 61 59 61 61 61 61 61 61 61 59 61 61 61 59 52 61 59 59 61 59 59 59 52 59 59 59 61 61 61 61 59 61 61 61 61 61 61 59 61 59 59 59 61 61 59 59 61 59 61 59 59 59 59 52 59 59 61 61 59 61 59 61 59 59 59 61 59 61 59 59 61 61 61 59 59 61 61 61 61 61 59 61 59 61 59 61 61 59 49 61 59 59 59 59 59 59 59 59 59 59 59 59 61 61 61 52 61 61 59 61 61 61 61 59 59 59 59 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 59 61 61 61 61 59 59 61 59 59 61 59 52 61 59 59 59 59 61 59 59 59 50 61 59 59 59 61 59 59 61 61 59 59 52 36 59 59 59 55 43 59 59 59 61 61 61 59 61 61 59 59 61 52 59 52 59 59 59 59 59 59 59 59 59 52 59 52 59 59 59 59 59 61 59 59 52 61 61 59 59 59 61 59 59 55 52 52 47 47 55 55 61 61 61 61 61 61 61 55 55 61 52 41 61 61 55 61 61 61 61 61 61 55 61 61 61 55 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 55 55 61 61 61 55 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 38 43 61 61 61 41 61 61 61 61 61 61 61 61 61 61 61 50 61 55 61 47 61 47 43 55 61 61 43 61 61 43 55 55 61 61 25 61 61 43 61 50 53 45 53 53 47 50 61 53 61 47 61 35 37 61 43 52 61 61 61 61 47 61 61 61 61 33 61 39 53 61 19 61 61 61 61 53 52 27 53 31 50 42 52 47 61 50 43 33 37 47 39 35 53 42 61 50 38 61 61 61 61 61 28 53 61 50 61 13 47 14 53 35 53 39 24 53 46 29 38 26 38 42 47 32 43 32 28 11 47 42 27 50 42 27 47 47 11 11 15 16 14 17 16 19 18 14 19 10 8 18 21 10 47 57 25 24 14 9 32 20 29 20 17 15 20 9 20 24 31 57 57 34 19 38 45 10 30 17 30 38 21 22 28 13 50 16 33 33 18 19 24 19 13 10 12 33 23 19 32 17 25 17 8 20 20 19 10 14 10 9 13 8 11 12 11 8 9 12 12 14 14 13 19 30 27 24 16 42 17 19 7 5 14 16 27 19 12 8 8 9 12 10 14 23 12 8 13 13 15 8 11 21 10 13 14 10 8 22 13 28 32 27 24 27 14 19 8 13 11 7 14 6 32 6 19 14 16 17 7 9 9 32 6 10 11 5 12 5 8 7 4 5 10 10 9 16 13 30 12 11 16 8 9 12 22 41 7 13 14 15 8 8 16 16 8 11 15 7 19 17 29 22 18 10 17 27 12 12 10 7 9 11 28 10 8 15 5 24 5 12 16 26 19 11 30 40 53 15 11 8 19 12 20 24 24 23 9 11 12 20 17 27 11 16 20 13 20 11 8 24 24 47 11 9 8 18 13 13 21 29 23 6 7 8 22 26 23 14 7 5 7 19 11 9 5 8 7 9 13 12 26 11 9 12 10 18 7 12 27 23 9 8 7 7 14 7 11 7 7 11 14 14 11 9 12 14 12 12 8 14 20 21 10 5 5 8 5 9 11 24 20 16 9 9 15 6 8 7 5 5 6 9 17 10 8 16 25 10 21 21 5 31 23 15 6 14 32 9 5 9 10 19 8 20 12 17 27 23 12 11 11 19 7 8 8 20 30 26 5 5 21 7 9 5 10 10 5 7 9 14 6 13 8 7 8 6 10 10 8 6 30 14 16 17 6 18 12 17 6 14 14 15 25 31 20 13 12 6 33 15 28 5 5 19 15 18 32 23 5 8 19 11 14 26 39 9 29 51 28 19 11 10 27 30 20 9 19 7 15 10 8 18 12 31 29 17 5 9 6 5 5 5 15 33 35 7 8 8 8 4 4 10 16 20 6 10 28 14 18 5 4 5 8 5 13 8 6 16 30 11 13 15 5 8 8 10 5 9 18 18 8 5 3 9 16 12 10 5 7 5 4 9 9 9 20 20 5 14 12 29 21 12 8 6 11 9 6 9 6 6 7 5 8 5 5 6 7 9 6 10 13 14 14 11 9 5 4 4 4 5 13 17 6 16 9 18 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_10961134_10962199
seq2: B6Ng01-036B17.b_42_1087

seq1  GAATTCTAGCAGGACTTTATCAAGACACCACACCCTGCCTACATACTTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAGCAGGACTTTATCAAGACACCACACCCTGCCTACATACTTCT  50

seq1  GATGGATGAACCAAAGCAACTTGTTTGCTCATGCTATTTGCAGAAATTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGATGAACCAAAGCAACTTGTTTGCTCATGCTATTTGCAGAAATTAT  100

seq1  TTTTTTGCTACTGAATCTACATTTACCTAGGACCCAATATGTACACCCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTGCTACTGAATCTACATTTACCTAGGACCCAATATGTACACCCTG  150

seq1  TTCTTCATCGCAGGACAGGAGGTCAGGGTTTCCCTCTGACTGCATCAGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCATCGCAGGACAGGAGGTCAGGGTTTCCCTCTGACTGCATCAGTG  200

seq1  AAGATTCCCTCATCAATCTGCTAGATGTGTGCACTCTTCGATATGATGTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATTCCCTCATCAATCTGCTAGATGTGTGCACTCTTCGATATGATGTA  250

seq1  ATCTTTAGTTTTCTATCTCATTGGGTGATCTTAGACTACTCTGATGATGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTAGTTTTCTATCTCATTGGGTGATCTTAGACTACTCTGATGATGT  300

seq1  GTGAGTTTGATGATAATTTGCTAACTATCTGTGGCTACTTTCTGTTACTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGTTTGATGATAATTTGCTAACTATCTGTGGCTACTTTCTGTTACTT  350

seq1  ATTACTTGGTATTTTCTTGCTATATAACTCAATAAACTTAATCATTCGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACTTGGTATTTTCTTGCTATATAACTCAATAAACTTAATCATTCGAA  400

seq1  ACCAGAAGCATAATTATCATACAACCATACAGAAAAATTGTTTCTGTGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGAAGCATAATTATCATACAACCATACAGAAAAATTGTTTCTGTGGC  450

seq1  TGGAAAACAGGATAAAAGTGCATAAATTAAGAACTGTAGTTCTACATATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAAACAGGATAAAAGTGCATAAATTAAGAACTGTAGTTCTACATATT  500

seq1  CGTTCCTGCCTCCCTTTTCTGTCACTAACTGCTAACCAGGAACCACTTTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTCCTGCCTCCCTTTTCTGTCACTAACTGCTAACCAGGAACCACTTTC  550

seq1  CTTGCCTCTAATACCACAGTCCTGCCCATAAATGAACTTGATATGTGAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCTCTAATACCACAGTCCTGCCCATAAATGAACTTGATATGTGAAG  600

seq1  CACGTGACACCTTTTGAATCAAAGTCATGACACCTACAATATCTGAGATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGTGACACCTTTTGAATCAAAGTCATGACACCTACAATATCTGAGATT  650

seq1  CATCTAGACACGATCAATAGCTACATGTATCTACCCAGCTAAGTGACAGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTAGACACGATCAATAGCTACATGTATCTACCCAGCTAAGTGACAGT  700

seq1  CAGAATTTCAAATTTTCAAATATGAACATCTACCATGATTGGTTCAGGAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATTTCAAATTTTCAAATATGAACATCTACCATGATTGGTTCAGGAG  750

seq1  GCACTCATGTTTTAGCCAATGGAGTCAAATAGCCATAGCCTTTACAATCA  800
      |||||||| ||||||||||||||||||||||| ||||||| |||| ||||
seq2  GCACTCATTTTTTAGCCAATGGAGTCAAATAGGCATAGCC-TTAC-ATCA  798

seq1  CAAGTAAGAGTTCTAAGTTCTAAGGTAGGTCAGAAGCTATGAAATCTAAA  850
      | |||| |||||||||||||||||||||||||| ||||||||||||||||
seq2  C-AGTAGGAGTTCTAAGTTCTAAGGTAGGTCAG-AGCTATGAAATCTAAA  846

seq1  CTTAAGCCATGATTTCCAAAATGGATATACCT-ATCTAGAAATTAACATT  899
      |||||||||||| ||||||||||||   |||| ||||||||||| |||||
seq2  CTTAAGCCATGA-TTCCAAAATGGAATAACCTAATCTAGAAATT-ACATT  894

seq1  TTACAGTCCATAATCAGTTAAATTTAAGTAAAATTTAAATTAGACATGCA  949
      ||||||||||||||||||||||||| ||| ||||||||||||||||||||
seq2  TTACAGTCCATAATCAGTTAAATTT-AGT-AAATTTAAATTAGACATGCA  942

seq1  TTTTTATTTTACATGTGAGAGTTTCACCTGTGTGTATCTGTGTACCACAT  999
      ||||   |||||||||||||| |||| ||||| |||||||||||||||||
seq2  TTTT--ATTTACATGTGAGAG-TTCA-CTGTG-GTATCTGTGTACCACAT  987

seq1  GCATAACTCATTCTTGTAGATGTCAGAAGATGTAAGAGCCTTTGGAACTA  1049
      |||| ||||| |||||||||||||   |||||||||||||||  | ||||
seq2  GCAT-ACTCA-TCTTGTAGATGTC--GAGATGTAAGAGCCTT--GGACTA  1031

seq1  GAGTTACAGACAACCGG  1066
      | ||||||||| |||||
seq2  G-GTTACAGAC-ACCGG  1046

seq1: chr7_11134845_11135926
seq2: B6Ng01-036B17.g_69_1130 (reverse)

seq1  ACCCAAAACATGTCATTGAAAAACTTGACATAAGACTACATTTTTATTTC  50
      ||||| |||||||||||| ||||||   ||| || |||| ||||||||| 
seq2  ACCCACAACATGTCATTG-AAAACT--GCATTAG-CTAC-TTTTTATTTT  45

seq1  TGATGCAGACTGGACAAAATGGAAGAAGGTTTCATAGGACAAAGGGCACA  100
      |   |||| |||||| |||||| |||  | ||||||||| || |  ||| 
seq2  T--AGCAG-CTGGAC-AAATGG-AGA--GGTTCATAGGAAAAGGCCCAC-  87

seq1  AAAGATGGAAAACACAGAGAAATGAAGAGATTGATGTTTACCAGTCACCA  150
          |  |||||||||||| ||||||||||||||||||||||||||||||
seq2  ----AGTGAAAACACAGAG-AATGAAGAGATTGATGTTTACCAGTCACCA  132

seq1  GTTATAACTTATAAAATGCAATG-CAGCCTCATAAGATAGTAGAGAGATT  199
      | ||||   ||| |||||||||| |||| |||||  || || |||   ||
seq2  G-TATA--CTATTAAATGCAATGCCAGCTTCATAGTAT-GT-GAGGAGTT  177

seq1  ATAAAAAGATGGAAGGGCCAGGATATTCTGGGTGGTTCTGGACTCACAGG  249
      || |||||| ||||||||||||| ||||| |||||||  ||| || |  |
seq2  AT-AAAAGA-GGAAGGGCCAGGAAATTCT-GGTGGTTTCGGA-TCCCCAG  223

seq1  AGTTTCTACTAGAACCATAAGAGCTACAGATGTGTGAACACTCTGATTGT  299
      ||||||| |||| ||||| ||| |||||||||||| ||||||||||||||
seq2  AGTTTCT-CTAGGACCAT-AGAACTACAGATGTGT-AACACTCTGATTGT  270

seq1  GTCAGAGCAGAAGGACAATCATGAACCCTCTGGAATAGGATATCAGGACA  349
      | |||||||||||| |||||||||||||||||| ||||||||||||||||
seq2  G-CAGAGCAGAAGGGCAATCATGAACCCTCTGG-ATAGGATATCAGGACA  318

seq1  GAAAATAAGACTTCAGGGCATACTACCAATGCTG-CATAGAGAAAC-TCA  397
      |||||||||||| ||||||||||||||||||||| || |||| ||| |||
seq2  GAAAATAAGACTCCAGGGCATACTACCAATGCTGCCAAAGAGGAACTTCA  368

seq1  CTAATTTCATTGTGCCCTACAATAG-AACAGTA-TCCAAAATCTTG-TTC  444
      ||||||| ||| ||||||||||||| ||||||| |||||||||||| || 
seq2  CTAATTTTATTTTGCCCTACAATAGAAACAGTATTCCAAAATCTTGTTTT  418

seq1  TCTTG-TCACATGTTT-GCTTTTCCAATTGTTAAGTGTGTTGAGAGAGGA  492
      ||||| |||||||||| | |||||||||||||||||||||||||||||||
seq2  TCTTGTTCACATGTTTGGTTTTTCCAATTGTTAAGTGTGTTGAGAGAGGA  468

seq1  TATGAAATTTATC-AACATGTAGAAGA-CCCATAGAATGATAATGGGGCA  540
      ||||||||||||| ||||||||||||| ||||||||||||||||||||||
seq2  TATGAAATTTATCAAACATGTAGAAGACCCCATAGAATGATAATGGGGCA  518

seq1  GCCAATATACTT-CCCAGCTTTGTCATTTTGATTCTTCC-AACAGGATTC  588
      |||||||||||| |||||||||||||||||||||||||| ||||||||||
seq2  GCCAATATACTTCCCCAGCTTTGTCATTTTGATTCTTCCAAACAGGATTC  568

seq1  CCTGGGGCTGATTGTCATGGTCTGGAAAACACTCAAAAAGCAGCTGGTGC  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGGGCTGATTGTCATGGTCTGGAAAACACTCAAAAAGCAGCTGGTGC  618

seq1  CAATGGATATACTCCTCCTAAAACCATGAATATACAATAGGAGCTTGCAT  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGGATATACTCCTCCTAAAACCATGAATATACAATAGGAGCTTGCAT  668

seq1  ACAAAAGAATTCAAGAACTGTTTCCTCCCAAAAGCTGACATTGTGTGGGG  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAGAATTCAAGAACTGTTTCCTCCCAAAAGCTGACATTGTGTGGGG  718

seq1  CACTCCTGAAGAGAGAATAATCACAGCATTGGCTGCATAAGTATGTGCAT  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTGAAGAGAGAATAATCACAGCATTGGCTGCATAAGTATGTGCAT  768

seq1  TATTATGTACATGGGAATCAAATCTGTGGGTTTTATCGTGCATTGTCTGT  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTATGTACATGGGAATCAAATCTGTGGGTTTTATCGTGCATTGTCTGT  818

seq1  AGTAAAGGATTAGATAGAAGAAATAAGAGTGACATTTCCCAGAGTTCCAA  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAAGGATTAGATAGAAGAAATAAGAGTGACATTTCCCAGAGTTCCAA  868

seq1  TTGTAGTTTCTGGTAAACAAATGATTCTGATGGCCAGATTCAAAAAGTCC  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAGTTTCTGGTAAACAAATGATTCTGATGGCCAGATTCAAAAAGTCC  918

seq1  ATTGTGTGATTCTATACACATTCCTTGAGAATATGCCCATGGCTATTTTT  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTGTGATTCTATACACATTCCTTGAGAATATGCCCATGGCTATTTTT  968

seq1  CTGGTCTAATTTTTTTATGAATAAAAACAAATACTTGTAGCTTGTGAAGA  1038
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTCTAATTTTTTTATGAATAAAAACAAATACTTGTAGCTTGTGAAGA  1018

seq1  AAGACAGAACCCTTATTTCATGTAGCTATTGAAAAGGTGAATTC  1082
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGAACCCTTATTTCATGTAGCTATTGAAAAGGTGAATTC  1062

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information