MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-089A05
Chromosome	7 (Build37)
Map Location	127,092,606 - 127,093,708
singlet/doublet	singlet
Overlap gene	Dnahc3
Upstream gene	Iqck, Gprc5b, Gpr139, LOC100042871, Gp2, Umod, 1700007B13Rik, C730027J19Rik, Acsm2, Acsm1, BC048390, Thumpd1, EG434233, Acsm3, Exod1, 2610020H08Rik, Dcun1d3, LOC100043399, LOC100043396, Lyrm1
Downstream gene	Tmem159, Zp2, Anks4b, Crym, Abca14, Abca15, Abca16, LOC668429, LOC546994, LOC100042914, E130201H02Rik, LOC637957, Uqcrc2, 4930408O21Rik, BC030336, E030013G06Rik, EG436008, LOC100043426, Eef2k, Polr3e
Link	Open Mouse BAC browser

Click to get alignment info.

name	Iqck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434232 MGI:3612188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprc5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64297 MGI:1927596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209776 MGI:2685341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042871 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Gp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67133 MGI:1914383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Umod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22242 MGI:102674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71830 MGI:1919080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 7 Proteins

name	C730027J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272428 MGI:2444086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acsm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233799 MGI:2385289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acsm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117147 MGI:2152200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233801 MGI:2681844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thumpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233802 MGI:2444479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434233 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434233 MGI:3647492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 297 ESTs, 99 Proteins

name	Acsm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20216 MGI:99538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Exod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71151 MGI:1918401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610020H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434234 MGI:1919402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dcun1d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233805 MGI:2679003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043399 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Lyrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73919 MGI:1921169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381917 MGI:2683040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 16 Proteins

name	Tmem159 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233806 MGI:1925752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22787 MGI:99214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72074 MGI:1919324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crym (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12971 MGI:102675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67928 MGI:2388708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320631 MGI:2388709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233810 MGI:2388711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 4 Proteins pseudo : _no_value

name	LOC546994 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	LOC100042914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	E130201H02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78552 MGI:1925802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 13 Proteins

name	LOC637957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Uqcrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67003 MGI:1914253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930408O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67983 MGI:1915233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC030336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233812 MGI:2446240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 68 ESTs, 2 Proteins

name	E030013G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233813 MGI:3041229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436008 MGI:3645276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043426 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Eef2k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13631 MGI:1195261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26939 MGI:1349452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517719 GeneID:434232 MGI:3612188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing K transcript_id : NM_001081446.1

name	Gprc5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956117 GeneID:64297 MGI:1927596
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 5, member B transcript_id : NM_022420.1

name	Gpr139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66571296 GeneID:209776 MGI:2685341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 139 transcript_id : NM_001024138.1

name	Gp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366873 GeneID:67133 MGI:1914383
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein 2 (zymogen granule membrane) transcript_id : NM_025989.2

name	Umod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981927 GeneID:22242 MGI:102674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uromodulin transcript_id : NM_009470.2

name	1700007B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380998 GeneID:71830 MGI:1919080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 7 Proteins product : RIKEN cDNA 1700007B13 gene transcript_id : XM_133805.4

name	C730027J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249087 GeneID:272428 MGI:2444086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027J19 gene transcript_id : NM_178758.3

name	Acsm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802373 GeneID:233799 MGI:2385289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase medium-chain family member 2 transcript_id : NM_146197.3

name	Acsm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19745154 GeneID:117147 MGI:2152200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase medium-chain family member 1 transcript_id : NM_054094.4

name	BC048390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341508 GeneID:233801 MGI:2681844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048390 transcript_id : NM_178414.2

name	Thumpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704175 GeneID:233802 MGI:2444479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THUMP domain containing 1 transcript_id : NM_145585.1

name	Acsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85810989 GeneID:20216 MGI:99538
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase medium-chain family member 3 transcript_id : NM_016870.3

name	Acsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85810991 GeneID:20216 MGI:99538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase medium-chain family member 3 transcript_id : NM_212442.2

name	Acsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85810987 GeneID:20216 MGI:99538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase medium-chain family member 3 transcript_id : NM_212441.2

name	Exod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098179 GeneID:71151 MGI:1918401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exonuclease domain containing 1 transcript_id : NM_027698.3

name	2610020H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130436 GeneID:434234 MGI:1919402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020H08 gene transcript_id : NM_028129.2

name	2610020H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921366 GeneID:434234 MGI:1919402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020H08 gene transcript_id : NM_001004187.1

name	Dcun1d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802226 GeneID:233805 MGI:2679003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae) transcript_id : NM_173408.2

name	LOC100043399 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257767 GeneID:100043399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043399 transcript_id : XM_001479787.1

name	LOC100043396 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257765 GeneID:100043396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043396 transcript_id : XM_001479781.1

name	Lyrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377746 GeneID:73919 MGI:1921169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LYR motif containing 1 transcript_id : NM_029610.2

name	Dnahc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380999 GeneID:381917 MGI:2683040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 16 Proteins product : dynein, axonemal, heavy chain 3 transcript_id : XM_355934.5

name	Tmem159 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704177 GeneID:233806 MGI:1925752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 159 transcript_id : NM_145586.1

name	Zp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357661 GeneID:22787 MGI:99214
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida glycoprotein 2 transcript_id : NM_011775.5

name	Anks4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312471 GeneID:72074 MGI:1919324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and sterile alpha motif domain containing 4B transcript_id : NM_028085.1

name	Crym (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710011 GeneID:12971 MGI:102675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, mu transcript_id : NM_016669.1

name	Abca14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745125 GeneID:67928 MGI:2388708
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 14 transcript_id : NM_026458.3

name	Abca15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358377 GeneID:320631 MGI:2388709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 15 transcript_id : NM_177213.3

name	Abca16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369472 GeneID:233810 MGI:2388711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 16 transcript_id : NM_207130.1

name	LOC546994 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257697 GeneID:546994
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to Ankyrin repeat domain-containing protein 26 transcript_id : XM_001479054.1

name	E130201H02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257699 GeneID:78552 MGI:1925802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 13 Proteins product : RIKEN cDNA E130201H02 gene transcript_id : XM_001479067.1

name	LOC637957 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257701 GeneID:637957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Ankyrin repeat domain-containing protein 26 transcript_id : XM_913790.3

name	Uqcrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373414 GeneID:67003 MGI:1914253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol cytochrome c reductase core protein 2 transcript_id : NM_025899.2

name	4930408O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803541 GeneID:67983 MGI:1915233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930408O21 gene transcript_id : NM_001040136.2

name	4930408O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922700 GeneID:67983 MGI:1915233
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930408O21 gene transcript_id : NM_001040137.2

name	BC030336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380955 GeneID:233812 MGI:2446240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 68 ESTs, 2 Proteins product : cDNA sequence BC030336, transcript variant 1 transcript_id : XM_133786.9

name	E030013G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117320532 GeneID:233813 MGI:3041229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E030013G06 gene transcript_id : NM_177697.3

name	EG436008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257703 GeneID:436008 MGI:3645276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG436008 transcript_id : XM_488079.5

name	LOC100043426 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257770 GeneID:100043426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043426 transcript_id : XM_001479877.1

name	Eef2k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131082 GeneID:13631 MGI:1195261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic elongation factor-2 kinase transcript_id : NM_007908.3

name	Polr3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981263 GeneID:26939 MGI:1349452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide E transcript_id : NM_025298.2

name	Iqck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517720 GeneID:434232 MGI:3612188
definition	codon_start : 1 product : IQ motif containing K protein_id : NP_001074915.1

name	Gprc5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956118 CCDS:CCDS21777.1 GeneID:64297 MGI:1927596
definition	GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor, family C, group 5, member B protein_id : NP_071865.1

name	Gpr139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571297 CCDS:CCDS21778.1 GeneID:209776 MGI:2685341
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001620 - class A orphan receptor activity [Evidence ISS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008188 - neuropeptide receptor activity [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor PGR3; orphan G protein-coupled receptor TRHRL2 product : G protein-coupled receptor 139 protein_id : NP_001019309.1

name	Gp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229028 CCDS:CCDS21779.1 GeneID:67133 MGI:1914383
definition	GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : zymogen granule membrane glycoprotein 2 protein_id : NP_080265.2

name	Umod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128623 CCDS:CCDS21780.1 GeneID:22242 MGI:102674
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 note : Tamm-Horsfall glycoprotein; Tamm-Horsfall protein product : uromodulin protein_id : NP_033496.1

name	1700007B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51761889 GeneID:71830 MGI:1919080
definition	codon_start : 1 product : protein disulfide isomerase-like protein of the testis protein_id : XP_133805.2

name	C730027J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520215 GeneID:272428 MGI:2444086
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC272428 protein_id : NP_848873.1

name	Acsm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122743 CCDS:CCDS21782.1 GeneID:233799 MGI:2385289
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-CoA synthetase medium-chain family member 2 protein_id : NP_666309.1

name	Acsm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905127 CCDS:CCDS21783.1 GeneID:117147 MGI:2152200
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA] [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003996 - acyl-CoA ligase activity [Evidence ISS]; GO:0047760 - butyrate-CoA ligase activity [Evidence ISS] [Evidence IEA]; GO:0015645 - fatty-acid ligase activity [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0018874 - benzoate metabolism [Evidence ISS]; GO:0019605 - butyrate metabolism [Evidence ISS]; GO:0015980 - energy derivation by oxidation of organic compounds [Evidence ISS]; GO:0006633 - fatty acid biosynthesis [Evidence IDA]; GO:0019395 - fatty acid oxidation [Evidence ISS] codon_start : 1 note : acetyl-Coenzyme A synthetase 3 product : butyryl Coenzyme A synthetase 1 protein_id : NP_473435.1

name	BC048390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410742 CCDS:CCDS21784.1 GeneID:233801 MGI:2681844
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004321 - fatty-acyl-CoA synthase activity [Evidence ISS] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein MGC56918 protein_id : NP_848501.1

name	Thumpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704176 CCDS:CCDS21785.1 GeneID:233802 MGI:2444479
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : THUMP domain containing 1 protein_id : NP_663560.1

name	Acsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85810990 CCDS:CCDS21786.1 GeneID:20216 MGI:99538
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0015645 - fatty-acid ligase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : SA hypertension-associated homolog protein_id : NP_058566.3

name	Acsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85810988 CCDS:CCDS21786.1 GeneID:20216 MGI:99538
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0015645 - fatty-acid ligase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : SA hypertension-associated homolog protein_id : NP_997606.2

name	Acsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85810992 CCDS:CCDS21786.1 GeneID:20216 MGI:99538
definition	GO_component : GO:0005759 - mitochondrial matrix [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0015645 - fatty-acid ligase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : SA hypertension-associated homolog protein_id : NP_997607.2

name	Exod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098180 GeneID:71151 MGI:1918401
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : exonuclease domain containing 1 protein_id : NP_081974.3

name	2610020H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921367 CCDS:CCDS21787.1 GeneID:434234 MGI:1919402
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; exonuclease NEF-sp product : exonuclease NEF-sp isoform 1 protein_id : NP_001004187.1

name	2610020H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53292637 CCDS:CCDS21788.1 GeneID:434234 MGI:1919402
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; exonuclease NEF-sp product : exonuclease NEF-sp isoform 2 protein_id : NP_082405.1

name	Dcun1d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734156 CCDS:CCDS21789.1 GeneID:233805 MGI:2679003
definition	codon_start : 1 product : DCN1, defective in cullin neddylation 1, domain containing 3 protein_id : NP_775584.1

name	LOC100043399 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257768 GeneID:100043399
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479837.1

name	LOC100043396 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257766 GeneID:100043396
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479831.1

name	Lyrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313200 CCDS:CCDS21790.1 GeneID:73919 MGI:1921169
definition	codon_start : 1 product : LYR motif containing 1 protein_id : NP_083886.1

name	Dnahc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381000 GeneID:381917 MGI:2683040
definition	codon_start : 1 note : overriding stop codons product : similar to axonemal heavy chain dynein type 3 protein_id : XP_355934.5 transl_except : (pos:complement(127221285..127221287),aa:OTHER)

name	Tmem159 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704178 CCDS:CCDS21791.1 GeneID:233806 MGI:1925752
definition	codon_start : 1 product : promethin protein_id : NP_663561.1

name	Zp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756081 CCDS:CCDS21792.1 GeneID:22787 MGI:99214
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IDA]; GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA] codon_start : 1 product : zona pellucida glycoprotein 2 protein_id : NP_035905.1

name	Anks4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312472 CCDS:CCDS21793.1 GeneID:72074 MGI:1919324
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : harmonin-interacting ankyrin-repeat containing protein_id : NP_082361.1

name	Crym (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710012 CCDS:CCDS21794.1 GeneID:12971 MGI:102675
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 product : crystallin, mu protein_id : NP_057878.1

name	Abca14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745126 GeneID:67928 MGI:2388708
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATP-binding cassette transporter sub-family A member 14 product : ATP-binding cassette, sub-family A (ABC1), member 14 protein_id : NP_080734.2

name	Abca15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358378 GeneID:320631 MGI:2388709
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP-binding cassette transporter sub-family A member 15 protein_id : NP_796187.2

name	Abca16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369473 GeneID:233810 MGI:2388711
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ATP-binding cassette transporter sub-family A member 16 protein_id : NP_997013.1

name	LOC546994 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257698 GeneID:546994
definition	codon_start : 1 product : similar to Ankyrin repeat domain-containing protein 26 protein_id : XP_001479104.1

name	E130201H02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257700 GeneID:78552 MGI:1925802
definition	codon_start : 1 product : hypothetical protein LOC78552 protein_id : XP_001479117.1

name	LOC637957 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257702 GeneID:637957
definition	codon_start : 1 product : similar to Ankyrin repeat domain-containing protein 26 protein_id : XP_918883.3

name	Uqcrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267442 CCDS:CCDS21795.1 GeneID:67003 MGI:1914253
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008121 - ubiquinol-cytochrome-c reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol cytochrome c reductase core protein 2 protein_id : NP_080175.1

name	4930408O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373388 GeneID:67983 MGI:1915233
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC67983 isoform 1 protein_id : NP_001035226.1

name	4930408O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373125 GeneID:67983 MGI:1915233
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC67983 isoform 2 protein_id : NP_001035227.1

name	BC030336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907481 GeneID:233812 MGI:2446240
definition	codon_start : 1 product : hypothetical protein LOC233812 isoform 1 protein_id : XP_133786.6

name	E030013G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117320533 GeneID:233813 MGI:3041229
definition	codon_start : 1 product : hypothetical protein LOC233813 protein_id : NP_808365.2

name	EG436008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257704 GeneID:436008 MGI:3645276
definition	codon_start : 1 product : similar to NAD(P) dependent steroid dehydrogenase-like protein_id : XP_488079.5

name	LOC100043426 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257771 GeneID:100043426
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479927.1

name	Eef2k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681275 CCDS:CCDS21796.1 GeneID:13631 MGI:1195261
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : eukaryotic elongation factor-2 kinase protein_id : NP_031934.1

name	Polr3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981264 CCDS:CCDS21797.1 GeneID:26939 MGI:1349452
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : sex-lethal interactor homolog protein_id : NP_079574.2

name	LOC100042871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042871
definition	number : 5 pseudo : _no_value

name	LOC100042871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042871
definition	number : 4 pseudo : _no_value

name	LOC100042871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042871
definition	number : 3 pseudo : _no_value

name	LOC100042871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042871
definition	number : 2 pseudo : _no_value

name	LOC100042871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042871
definition	number : 1 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 1 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 2 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 3 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 4 pseudo : _no_value

name	LOC100042914 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042914
definition	number : 5 pseudo : _no_value

name	EG434233 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380945 GeneID:434233 MGI:3647492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 294 ESTs, 99 Proteins product : predicted gene, EG434233, transcript variant 8 transcript_id : XR_002363.1

name	LOC668429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257769 GeneID:668429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 4 Proteins product : similar to SEC14 and spectrin domains 1 pseudo : _no_value transcript_id : XR_034414.1

clone name	MSMg01-175C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410L23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-089A05.b	B6Ng01-089A05.g
ACC	DH901709	DH901710
length	1,106	1,257
definition	DH901709\|Mus musculus domesticus DNA, BAC clone: B6Ng01-089A05, 5' end.	DH901710\|Mus musculus domesticus DNA, BAC clone: B6Ng01-089A05, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagagatggaaaatttaaccatttaaaactgttgataactttttc cttatagtacagtaagggtgggttgtggaaatagctgtgagtaaaacact tgccacacacacatgaggaactgaacctcttataaagctggatggtatgc tgtgtgtctgtaattcaaggctcctatggagagaaggaatcagagataag aggatgcacagaggctggcctaacacccagactcgaataaacagtggtga agaagagagcctgtctaaatgggaagtggtgacagctttagtccaggcac tcgagagacagaggcaggcagatctctaggttcaaagccaacctgaactt acagagtgagtaagtctacagagtgagctccagaacagccatggttacac agagaacaccctgtcttaatcaaacaaaacaaaaagaccctgtctgaaac aaggtggatgtccctctgacccctgaccccacccccttcatacacacaca cacacacacacacacacacacacacacacacacacacatttctttttaat atgataggagccaagcccaggatgacattagctctgagtttatcatcttc ttcttgaaccattattttatctattacatgtcaaattttttctaatttaa tctttttgcttatttcttacattccagattttatttccctcctggcccac cctccaactgtttcacatacctcctccccaccccaccccacccccccccc ccccgtctccactaaggatgttcctaccacccaccccacccagacttcta aactccctggggccttcagtctccttgagacatctttctctgactgaacc cagacctggcagtcctctgctgtattatgtgctgggggtctcatatcaac ttgtgtatgctgcctgtttggtggcccaatgtttgaaagatctcaggggt caggtaattgagactcctggtcctcttacaggtcaccctcctcctcagct tctccagtttttccttaactgaaccttaggggctgtaccttctgtccttt gtttgggtgagagtgccatcatccacctgggaagggagaaagaaagaaat cacaag	gaattcaagtccaagtggatcaaagacctcaacgtaaaatcagatacact gaacctgatagaagagaaagtggggaatagccttgaacacattagcatag tagatgactttctgagcaaaaccccattaagcataagcataaagatcaaa aatcaataaatggggccttatgaaacttgaaaagctaaagaactcaagaa acaggatatcaaaaaccaaaataatcctacttaaaaaacaggttacaaaa ttaaacagaattatccatagaggaatttcaaatggctgtgaaacaaagaa atgttgaacattcttagccatcagggaaatgcaaactaaaacgactttga gattccatcttacacctgtcagaatggctaagatcagtaacatacctcat gctggtgggtacgtggaataaggggagcccattgctggtgggagtgtaaa ctagtacagccactatggaaatcagatggaaatcagtatggtggttcctc aagatctatctcaaaattctactatttccacttagacatatatatacaaa gaatacactattcttaatggaactagaagaaattctgagggaggtaacat agacccagacagagaaatatggtatatactcacttgtaagcagatactag ctatatataaataatgatcaagctacagtttcatagacctagaaggttag gttaagagaagggatctaggggctctccctgggagggagaaataaaatag attttcacaggcaggtggagatgtagtgaagagaaagagtgcagggagag actgttggatttgggatgcatttgggagatggtgtggaaacttagtgcag tagaaacttcctggaatctatgagggcgatcctaatgattacacctaata aaagaggatactgagtctcagatttccatctcttgaaaccaggcaaagtt gccagtggcagcctaggtttaaattcagttgttttgttggcaagggcgtc ctatggaagccccaaacaacctatgctatatgctaagacaaatgattaca ctctgcagaatacagcagggctcattctgaagaagtcttcaagagaggag ttaaactggcacggtgtggggccttaaccctatgtttcagtcgctttggg acgagagttgcttccaggcgtgctaataaaatgtgcaaccaccagtcaaa ctcttgcctcaactggcttgtcttcaaacacttgggccatgggtatacac aaacaat
quality values	Open. Hide. 57 33 26 32 57 31 16 28 61 61 17 17 61 61 61 61 61 36 36 61 61 61 61 61 47 35 10 12 10 11 16 12 10 8 7 14 14 20 28 36 36 55 55 55 55 55 61 61 61 61 61 61 61 59 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 41 37 36 21 26 26 22 28 26 44 36 36 59 59 59 61 61 59 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 59 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 52 61 61 59 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 59 59 61 61 61 59 61 61 61 61 59 59 36 55 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 55 55 59 61 55 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 52 55 52 52 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 52 52 52 50 50 50 61 61 55 61 55 61 55 61 55 61 50 55 55 55 50 55 61 50 43 47 41 47 43 47 49 50 50 55 50 50 49 50 50 61 61 43 61 18 22 13 16 16 27 50 61 55 61 61 55 61 61 55 55 61 61 61 61 52 47 53 47 34 61 61 52 53 61 61 61 52 61 61 61 61 53 61 31 61 61 31 47 50 50 43 61 53 61 61 45 50 61 61 53 61 61 61 53 39 61 42 61 61 53 40 61 61 47 61 61 61 47 50 50 50 50 50 36 39 61 50 61 50 61 61 45 61 61 61 61 61 61 47 47 53 43 61 47 53 61 35 42 39 38 34 31 30 61 61 50 53 53 53 61 61 61 61 61 61 45 45 61 47 46 53 40 39 41 27 53 53 46 52 31 47 53 45 53 53 45 50 53 45 43 52 32 47 47 42 43 42 42 47 45 39 31 36 40 53 53 28 43 50 36 27 15 12 13 20 23 45 47 20 50 43 30 47 42 36 45 30 34 16 28 28 5 19 23 19 11 12 21 32 30 39 21 29 26 34 38 37 31 27 29 31 25 8 14 20 22 13 12 22 27 13 26 17 36 14 41 38 30 35 36 31 18 18 30 10 27 31 27 8 18 42 38 34 22 10 42 10 10 5 27 18 16 17 23 32 21 46 35 31 37 16 20 17 11 21 18 46 41 24 21 10 9 13 11 21 42 39 17 17 24 10 8 5 31 18 50 26 24 28 18 24 37 24 34 21 27 17 15 15 12 28 28 31 30 18 24 31 25 5 34 5 29 18 17 11 11 5 8 15 17 11 17 19 24 25 10 24 11 10 12 13 21 21 24 23 28 29 33 25 36 39 39 36 31 9 20 20 31 27 17 17 20 7 9 5 9 4 6 13 15 14 9 35 29 12 16 32 29 19 21 28 14 10 53 19 10 30 6 21 14 8 17 29 19 31 27 20 14 27 31 14 15 13 31 6 14 18 28 36 34 13 9 24 24 18 12 30 14 15 6 33 17 47 46 10 15 29 10 30 7 13 27 29 24 32 25 10 27 26 29 23 11 29 28 28 23 38 43 18 23 14 24 30 20 12 47 12 9 13 18 12 15 8 16 15 21 14 7 11 10 14 10 9 14 15 22 22 16 10 24 13 8 24 34 13 9 8 13 14 15 14 8 7 10 24 26 7 7 5 4 5 8 29 7 11 30 29 13 9 9 12 11 24 7 32 13 38 12 27 15 28 30 14 11 8 8 15 14 11 7 17 25 18 8 9 7 11 11 8 13 5 7 16 30 20 7 9 10 6 19 12 12 11 9 13 16 14 5 19 38 7 5 20 17 15 5 5 5 6 8 5 5	Open. Hide. 55 49 52 49 61 14 17 14 11 8 8 5 7 7 9 9 30 28 40 59 49 45 59 59 59 61 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 44 36 21 24 28 26 26 28 30 29 29 43 44 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 49 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 47 43 61 61 61 53 61 50 61 61 61 47 61 61 61 52 61 43 61 61 61 53 61 61 61 39 61 50 61 61 61 61 39 43 25 35 38 45 61 61 53 42 39 40 30 33 61 33 53 47 53 53 50 61 61 61 50 61 61 43 61 61 61 57 57 53 40 57 57 47 32 57 45 45 47 42 35 50 57 53 53 42 42 45 27 24 47 43 47 46 57 43 53 57 47 50 52 37 53 31 23 43 47 43 53 50 46 52 53 50 52 53 53 57 40 36 57 30 53 36 43 57 34 34 53 52 53 52 57 57 50 53 52 52 50 47 30 57 46 47 39 50 42 52 39 45 48 40 46 50 57 53 33 52 42 32 18 57 23 36 40 50 38 50 45 36 23 18 31 28 26 37 7 17 8 17 26 27 57 23 43 17 43 22 53 42 42 53 30 57 57 27 23 38 22 29 50 53 53 52 24 37 42 39 25 53 46 47 52 37 53 41 14 57 17 24 14 14 12 22 22 40 57 57 40 42 42 36 40 25 57 53 53 33 17 38 18 12 57 29 37 40 53 28 22 37 52 23 31 23 39 37 37 25 40 34 27 52 28 53 12 29 52 44 35 53 28 37 40 29 21 5 39 44 23 22 44 19 29 23 20 48 28 25 26 20 37 33 57 40 53 57 16 36 24 37 37 25 37 45 35 32 57 18 23 9 32 20 26 31 15 48 24 30 30 45 45 12 9 26 25 23 29 33 41 18 19 17 21 24 9 25 29 27 22 35 29 24 40 30 30 20 29 24 12 23 13 9 10 23 46 5 39 23 14 27 34 31 21 29 23 29 22 16 37 31 39 16 24 31 13 45 29 31 25 46 21 25 51 39 26 11 26 21 24 25 22 23 29 28 35 28 17 23 13 12 21 16 15 30 14 27 23 23 29 9 27 28 21 24 21 25 29 23 41 20 19 28 7 18 20 20 5 32 8 26 7 38 29 9 31 14 13 11 21 26 20 9 14 9 18 18 17 29 28 19 51 31 28 51 32 21 39 20 10 27 33 9 18 19 51 51 34 38 20 24 21 14 23 8 22 16 46 27 26 25 31 25 24 28 15 21 20 28 23 26 15 29 28 26 36 14 28 29 15 12 25 19 19 13 20 9 19 17 25 16 19 11 11 18 28 12 24 20 19 34 19 19 51 19 14 17 35 28 8 9 14 8 7 15 14 21 29 31 13 5 15 9 9 6 8 9 10 10 6 10 44 8 7 7 17 4 6 7 7 12 13 11 7 17 6 9 5 8 11 3 8 9 6 6 7 13 4 12 4 5 17 5 4 5 4 6 12 6 6 7 11 6 10 3 3 6 19 6 4 7 6 5 6 5 5 7 8 3 4 4 9 18 5 4 3 6 11 27 6 6 7 4 8 5 5 5 7 27 8 17 3 3 2 6 4 5 5 16 7 6 22 6 21 8 7 6 23 6 23 10 6 9 4 4 4 6 3 9 9 17 11 8 18 6 9 8 10 9 6 4 6 3 2 1 4 1 2 1 5 1 1 3 8 4 6 18 9 3 3 3 5 3 5 5 14 6 11 5 3 7 9 18 5 4 11 13 6 20 13 14 4 3 8 3 2 8 16 18 8 4 3 3 3 3 3 5 4 8 8 6 9 9 3 5 11 6 9 4 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_127092606_127093708
seq2: B6Ng01-089A05.b_45_1150 (reverse)

seq1  CTTGTGATTTCTTTC-TTCTCCCTCCCAAGTGGGATTGAGGCATCCTCA-  48
      ||||||||||||||| |||||||| || ||  ||||   ||||  |||| 
seq2  CTTGTGATTTCTTTCTTTCTCCCTTCCCAGGTGGATGATGGCACTCTCAC  50

seq1  CCAACCAATGGACAGAAGCTACTGACCCTATGGTTCAGTTAGGGAAAAGC  98
      |||| ||| ||||||||| ||| | ||||| |||||||||| |||||| |
seq2  CCAAACAAAGGACAGAAGGTACAGCCCCTAAGGTTCAGTTAAGGAAAAAC  100

seq1  TGGAAGAAGCTGAGGAGGAGGGTGACCCTGTAAGAGGACCAGGAGTCTCA  148
      ||| ||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TGG-AGAAGCTGAGGAGGAGGGTGA-CCTGTAAGAGGACCAGGAGTCTCA  148

seq1  ATTAACCTGGACCCCTGAGATCTCTCAAACATTGGACCACCAAACAGGCA  198
      ||| |||| |||||||||||||| ||||||||||| ||||||||||||||
seq2  ATT-ACCT-GACCCCTGAGATCTTTCAAACATTGGGCCACCAAACAGGCA  196

seq1  GCATACACCAGCTGATATGAGACCCCCAGCACAT-ATACAGCAGAGGACT  247
      |||||||| || |||||||||||||||||||||| |||||||||||||||
seq2  GCATACACAAGTTGATATGAGACCCCCAGCACATAATACAGCAGAGGACT  246

seq1  GCCAGGTCTGGGTTCAGTCAGAG-AAGATGTCTC-AGGAGACTGGAGGCC  295
      ||||||||||||||||||||||| |||||||||| ||||||||| |||||
seq2  GCCAGGTCTGGGTTCAGTCAGAGAAAGATGTCTCAAGGAGACTGAAGGCC  296

seq1  CCAGGGAGTTTAGAAGTCT-GGTGGGGTGGGTGGTAGGAACATCC-TAGT  343
      ||||||||||||||||||| ||||||||||||||||||||||||| ||||
seq2  CCAGGGAGTTTAGAAGTCTGGGTGGGGTGGGTGGTAGGAACATCCTTAGT  346

seq1  GGAGACGGGGGGGGGGGGGGGTGGGGTGGGGTGGGGAGGAGGTATGTGAA  393
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAC-GGGGGGGGGGGGGGTGGGGTGGGGTGGGGAGGAGGTATGTGAA  395

seq1  ACAGTTGGAGGGTGGGCCAGGAGGGAAATAAAATCTGGAATGTAAGAAAT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTTGGAGGGTGGGCCAGGAGGGAAATAAAATCTGGAATGTAAGAAAT  445

seq1  AAGC-AAAAGATTAAATTAGAAAAAATTTGACATGTAATAGATAAAATAA  492
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAAAAGATTAAATTAGAAAAAATTTGACATGTAATAGATAAAATAA  495

seq1  TGGTTCAAGAAGAAGATGATAAACTCAGAGCTAATGTCATCCTGGGCTTG  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTCAAGAAGAAGATGATAAACTCAGAGCTAATGTCATCCTGGGCTTG  545

seq1  GCTCCTATCATATTAAAAAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCTATCATATTAAAAAGAAATGTGTGTGTGTGTGTGTGTGTGTGTGT  595

seq1  GTGTGTGTGTGTGTGTGTGTATGAAGGGGGTGGGGTCAGGGGTCAGAGGG  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGTGTATGAAGGGGGTGGGGTCAGGGGTCAGAGGG  645

seq1  ACATCCACCTTGTTTCAGACAGGGTCTTTTTGTTTTGTTTGATTAAGACA  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCACCTTGTTTCAGACAGGGTCTTTTTGTTTTGTTTGATTAAGACA  695

seq1  GGGTGTTCTCTGTGTAACCATGGCTGTTCTGGAGCTCACTCTGTAGACTT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGTTCTCTGTGTAACCATGGCTGTTCTGGAGCTCACTCTGTAGACTT  745

seq1  ACTCACTCTGTAAGTTCAGGTTGGCTTTGAACCTAGAGATCTGCCTGCCT  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCACTCTGTAAGTTCAGGTTGGCTTTGAACCTAGAGATCTGCCTGCCT  795

seq1  CTGTCTCTCGAGTGCCTGGACTAAAGCTGTCACCACTTCCCATTTAGACA  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTCTCGAGTGCCTGGACTAAAGCTGTCACCACTTCCCATTTAGACA  845

seq1  GGCTCTCTTCTTCACCACTGTTTATTCGAGTCTGGGTGTTAGGCCAGCCT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCTCTTCTTCACCACTGTTTATTCGAGTCTGGGTGTTAGGCCAGCCT  895

seq1  CTGTGCATCCTCTTATCTCTGATTCCTTCTCTCCATAGGAGCCTTGAATT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCATCCTCTTATCTCTGATTCCTTCTCTCCATAGGAGCCTTGAATT  945

seq1  ACAGACACACAGCATACCATCCAGCTTTATAAGAGGTTCAGTTCCTCATG  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGACACACAGCATACCATCCAGCTTTATAAGAGGTTCAGTTCCTCATG  995

seq1  TGTGTGTGGCAAGTGTTTTACTCACAGCTATTTCCACAACCCACCCTTAC  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGGCAAGTGTTTTACTCACAGCTATTTCCACAACCCACCCTTAC  1045

seq1  TGTACTATAAGGAAAAAGTTATCAACAGTTTTAAATGGTTAAATTTTCCA  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACTATAAGGAAAAAGTTATCAACAGTTTTAAATGGTTAAATTTTCCA  1095

seq1  TCTCTGAATTC  1103
      |||||||||||
seq2  TCTCTGAATTC  1106

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information