MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-096E16
Chromosome	7 (Build37)
Map Location	16,013,526 - 16,014,382
singlet/doublet	singlet
Overlap gene	none
Upstream gene	2810007J24Rik, EG638251, B430211C08Rik, EG194588, LOC666352, EG666312, LOC666365, LOC671978, LOC100042677, LOC100042685, EG666381, LOC100042691, LOC100042702, LOC100042707, LOC100042711, LOC100042714, LOC100042717, LOC100042721, LOC100042728, LOC100042731, LOC100042735, LOC100042739, LOC100042742, LOC235841, EG666407, LOC666337, Obox2
Downstream gene	LOC100042753, LOC100042756, LOC100042758, EG545921, LOC100042762, Obox1, LOC100042765, Obox3, LOC100042771, Obox5, EG638338, Obox6, Crx, Crxos1, Sepw1, Gltscr2, Ehd2, Gltscr1, Zfp541, Napa, Kptn, Slc8a2, Mrg2, Dhx34, Gpr77, C5ar1, 2610014I16Rik, Ccdc9, Bbc3, Sae1, BC057627
Link	Open Mouse BAC browser

Click to get alignment info.

name	2810007J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	B430211C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627280 MGI:3612342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG194588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194588 MGI:3646231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 8 Proteins

name	LOC666365 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	LOC671978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	EG666381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins

name	LOC100042691 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC235841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG666407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins

name	LOC666337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 7 Proteins

name	Obox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246792 MGI:2149033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100042753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042756 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG545921 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 7 Proteins

name	LOC100042762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Obox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71468 MGI:1918718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Obox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246791 MGI:2149032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Obox5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252829 MGI:2149035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638338 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638338 MGI:3646889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Obox6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252830 MGI:2149036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12951 MGI:1194883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crxos1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546024 MGI:2451355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sepw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20364 MGI:1100878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gltscr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68077 MGI:2154441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259300 MGI:2154274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gltscr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243842 MGI:2154263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666528 MGI:3647699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	Napa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108124 MGI:104563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kptn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70394 MGI:1890380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc8a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110891 MGI:107996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17537 MGI:108519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71723 MGI:1918973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319430 MGI:2442013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C5ar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12273 MGI:88232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610014I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66300 MGI:1913550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs

name	Ccdc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243846 MGI:1921443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bbc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170770 MGI:2181667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sae1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56459 MGI:1929264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330474 MGI:2682314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810007J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801867 GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810007J24 gene transcript_id : NM_175250.4

name	EG638251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256189 GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG638251 transcript_id : XM_983034.2

name	B430211C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702339 GeneID:627280 MGI:3612342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B430211C08 gene transcript_id : NM_001039146.1

name	EG194588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579822 GeneID:194588 MGI:3646231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG194588 transcript_id : NM_001038676.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379457 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 2 transcript_id : XM_986100.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256477 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 1 transcript_id : XM_986068.2

name	LOC671978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256195 GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to G protein-binding protein CRFG transcript_id : XM_001478621.1

name	LOC100042677 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256197 GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478628.1

name	EG666381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256485 GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : predicted gene, EG666381 transcript_id : XM_983494.2

name	LOC100042691 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256212 GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478641.1

name	LOC100042702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256220 GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478649.1

name	LOC100042707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256228 GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478653.1

name	LOC100042711 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256230 GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478659.1

name	LOC100042714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256232 GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478665.1

name	LOC100042717 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256234 GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478673.1

name	LOC100042721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256236 GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478688.1

name	LOC100042728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256244 GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478696.1

name	LOC100042731 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256246 GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478707.1

name	LOC100042735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256248 GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478714.1

name	LOC100042739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256250 GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478722.1

name	LOC100042742 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256252 GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478731.1

name	LOC235841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256254 GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478739.1

name	EG666407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379475 GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins product : predicted gene, EG666407 transcript_id : XM_983633.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379466 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 2 transcript_id : XM_986171.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256492 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 1 transcript_id : XM_986137.2

name	LOC100042753 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256256 GeneID:100042753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478746.1

name	LOC100042756 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256259 GeneID:100042756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478756.1

name	EG545921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379469 GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 7 Proteins product : predicted gene, EG545921, transcript variant 2 transcript_id : XM_900102.2

name	EG545921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379468 GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 7 Proteins product : predicted gene, EG545921, transcript variant 1 transcript_id : XM_620426.3

name	LOC100042762 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256261 GeneID:100042762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to OBOX4 transcript_id : XM_001478771.1

name	Obox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130390 GeneID:71468 MGI:1918718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 1 transcript_id : NM_027802.2

name	Obox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560755 GeneID:246791 MGI:2149032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 3 transcript_id : NM_145707.2

name	LOC100042771 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256265 GeneID:100042771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478786.1

name	Obox5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490389 GeneID:252829 MGI:2149035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 5 transcript_id : NM_145709.2

name	EG638338 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379478 GeneID:638338 MGI:3646889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG638338 transcript_id : XM_984229.1

name	Obox6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517671 GeneID:252830 MGI:2149036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 6 transcript_id : NM_145710.2

name	Crx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801104 GeneID:12951 MGI:1194883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cone-rod homeobox containing gene transcript_id : NM_007770.3

name	Crxos1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370317 GeneID:546024 MGI:2451355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Crx opposite strand transcript 1 transcript_id : NM_001033638.1

name	Sepw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735412 GeneID:20364 MGI:1100878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenoprotein W, muscle 1 transcript_id : NM_009156.2

name	Gltscr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381259 GeneID:68077 MGI:2154441
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glioma tumor suppressor candidate region gene 2 transcript_id : NM_133831.2

name	Ehd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362471 GeneID:259300 MGI:2154274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 2 transcript_id : NM_153068.3

name	Gltscr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487236 GeneID:243842 MGI:2154263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glioma tumor suppressor candidate region gene 1 transcript_id : NM_001081418.1

name	Zfp541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379480 GeneID:666528 MGI:3647699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : zinc finger protein 541 transcript_id : XM_984387.1

name	Napa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385903 GeneID:108124 MGI:104563
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-ethylmaleimide sensitive fusion protein attachment protein alpha transcript_id : NM_025898.2

name	Kptn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526915 GeneID:70394 MGI:1890380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kaptin transcript_id : NM_133727.1

name	Slc8a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254192 GeneID:110891 MGI:107996
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 8 (sodium/calcium exchanger), member 2 transcript_id : NM_148946.2

name	Mrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116642899 GeneID:17537 MGI:108519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid ecotropic viral integration site-related gene 2 transcript_id : NM_008627.2

name	Dhx34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345419 GeneID:71723 MGI:1918973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 34 transcript_id : NM_027883.2

name	Gpr77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802432 GeneID:319430 MGI:2442013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 77 transcript_id : NM_176912.3

name	C5ar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76096368 GeneID:12273 MGI:88232
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 5a receptor 1 transcript_id : NM_007577.3

name	2610014I16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256503 GeneID:66300 MGI:1913550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs product : RIKEN cDNA 2610014I16 gene transcript_id : XM_001480001.1

name	Ccdc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986618 GeneID:243846 MGI:1921443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 9 transcript_id : NM_172297.1

name	Bbc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875397 GeneID:170770 MGI:2181667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl-2 binding component 3 transcript_id : NM_133234.1

name	Sae1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892402 GeneID:56459 MGI:1929264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO1 activating enzyme subunit 1 transcript_id : NM_019748.2

name	BC057627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348503 GeneID:330474 MGI:2682314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057627 transcript_id : NM_198631.1

name	EG638251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256190 GeneID:638251 MGI:3645246
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_988128.2

name	B430211C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702340 GeneID:627280 MGI:3612342
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC627280 protein_id : NP_001034235.1

name	EG194588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579823 GeneID:194588 MGI:3646231
definition	codon_start : 1 product : hypothetical protein LOC194588 protein_id : NP_001033765.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379456 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991162.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379458 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991194.1

name	LOC671978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256196 GeneID:671978
definition	codon_start : 1 product : similar to G protein-binding protein CRFG protein_id : XP_001478671.1

name	LOC100042677 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256198 GeneID:100042677
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478678.1

name	EG666381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256486 GeneID:666381 MGI:3643193
definition	codon_start : 1 product : similar to OBOX3 protein_id : XP_988588.2

name	LOC100042691 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256213 GeneID:100042691
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478691.1

name	LOC100042702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256221 GeneID:100042702
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478699.1

name	LOC100042707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256229 GeneID:100042707
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478703.1

name	LOC100042711 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256231 GeneID:100042711
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478709.1

name	LOC100042714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256233 GeneID:100042714
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478715.1

name	LOC100042717 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256235 GeneID:100042717
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478723.1

name	LOC100042721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256237 GeneID:100042721
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478738.1

name	LOC100042728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256245 GeneID:100042728
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478746.1

name	LOC100042731 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256247 GeneID:100042731
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478757.1

name	LOC100042735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256249 GeneID:100042735
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478764.1

name	LOC100042739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256251 GeneID:100042739
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478772.1

name	LOC100042742 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256253 GeneID:100042742
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478781.1

name	LOC235841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256255 GeneID:235841
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478789.1

name	EG666407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379476 GeneID:666407 MGI:3645947
definition	codon_start : 1 product : similar to p116Rip protein_id : XP_988727.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379465 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991231.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379467 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991265.1

name	LOC100042753 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256257 GeneID:100042753
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478796.1

name	LOC100042756 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256260 GeneID:100042756
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478806.1

name	EG545921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555570 GeneID:545921 MGI:3704111
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_620426.1

name	EG545921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903194 GeneID:545921 MGI:3704111
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_905195.1

name	LOC100042762 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256262 GeneID:100042762
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478821.1

name	Obox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841037 CCDS:CCDS20837.1 GeneID:71468 MGI:1918718
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : oocyte specific homeobox 1 protein_id : NP_082078.1

name	Obox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560756 CCDS:CCDS20838.1 GeneID:246791 MGI:2149032
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : oocyte specific homeobox 3 protein_id : NP_663753.2

name	LOC100042771 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256266 GeneID:100042771
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478836.1

name	Obox5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490390 GeneID:252829 MGI:2149035
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : oocyte specific homeobox 5 protein_id : NP_663755.2

name	EG638338 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379479 GeneID:638338 MGI:3646889
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_989323.1

name	Obox6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517672 CCDS:CCDS20839.1 GeneID:252830 MGI:2149036
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : oocyte specific homeobox 6 protein_id : NP_663756.2

name	Crx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681029 CCDS:CCDS20840.1 GeneID:12951 MGI:1194883
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cone-rod homeobox containing protein_id : NP_031796.1

name	Crxos1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370318 CCDS:CCDS20841.1 GeneID:546024 MGI:2451355
definition	codon_start : 1 product : Crx opposite strand transcript 1 protein_id : NP_001028810.1

name	Sepw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677917 GeneID:20364 MGI:1100878
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0016491 - oxidoreductase activity [Evidence TAS] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein W, 1 protein_id : NP_033182.1 transl_except : (pos:complement(16505813..16505815),aa:Sec)

name	Gltscr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539653 GeneID:68077 MGI:2154441
definition	codon_start : 1 exception : mismatches in translation product : glioma tumor suppressor candidate region gene 2 protein_id : NP_598592.1

name	Ehd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742711 CCDS:CCDS20842.1 GeneID:259300 MGI:2154274
definition	GO_component : GO:0016020 - membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0006897 - endocytosis [Evidence IDA] codon_start : 1 product : EH-domain containing 2 protein_id : NP_694708.2

name	Gltscr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487237 GeneID:243842 MGI:2154263
definition	codon_start : 1 product : glioma tumor suppressor candidate region gene 1 protein_id : NP_001074887.1

name	Zfp541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379481 GeneID:666528 MGI:3647699
definition	codon_start : 1 product : zinc finger protein 541 protein_id : XP_989481.1

name	Napa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385392 CCDS:CCDS20843.1 GeneID:108124 MGI:104563
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005478 - intracellular transporter activity [Evidence IEA]; GO:0019905 - syntaxin binding [Evidence IDA] GO_process : GO:0045176 - apical protein localization [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : hydrocephaly with hop gait product : N-ethylmaleimide sensitive fusion protein attachment protein alpha protein_id : NP_080174.1

name	Kptn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526916 CCDS:CCDS20844.1 GeneID:70394 MGI:1890380
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : actin-binding protein product : kaptin protein_id : NP_598488.1

name	Slc8a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507355 CCDS:CCDS20845.1 GeneID:110891 MGI:107996
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 8 (sodium/calcium exchanger), member 2 protein_id : NP_683748.1

name	Mrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116642900 GeneID:17537 MGI:108519
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myeloid ecotropic viral integration site-related gene 2 protein_id : NP_032653.2

name	Dhx34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345420 GeneID:71723 MGI:1918973
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DEAH (Asp-Glu-Ala-His) box polypeptide 34 protein_id : NP_082159.2

name	Gpr77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892701 GeneID:319430 MGI:2442013
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 77 protein_id : NP_795886.1

name	C5ar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59814327 CCDS:CCDS20846.1 GeneID:12273 MGI:88232
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006956 - complement activation [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : C5a anaphylatoxin receptor; C5a ligand product : complement component 5, receptor 1 protein_id : NP_031603.2

name	2610014I16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256504 GeneID:66300 MGI:1913550
definition	codon_start : 1 product : hypothetical protein LOC66300 protein_id : XP_001480051.1

name	Ccdc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986619 GeneID:243846 MGI:1921443
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : coiled-coil domain containing 9 protein_id : NP_758501.1

name	Bbc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875398 CCDS:CCDS20847.1 GeneID:170770 MGI:2181667
definition	GO_component : GO:0005740 - mitochondrial envelope [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0006919 - caspase activation [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045926 - negative regulation of growth [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0001836 - release of cytochrome c from mitochondria [Evidence ISS] codon_start : 1 note : BH3-only product : Bcl-2 binding component 3 protein_id : NP_573497.1

name	Sae1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790247 CCDS:CCDS20848.1 GeneID:56459 MGI:1929264
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004839 - ubiquitin activating enzyme activity [Evidence ISS] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : SUMO-1 activating enzyme subunit 1; ubiquitin-like (sentrin) activating enzyme E1A; ubiquitin-like 1 (sentrin) activating enzyme E1A product : ubiquitin-like 1 (sentrin) activating enzyme subunit 1 protein_id : NP_062722.1

name	BC057627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348504 GeneID:330474 MGI:2682314
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330474 protein_id : NP_941033.1

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 3 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 2 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 1 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 1 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 2 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 3 pseudo : _no_value

name	LOC666365 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256478 GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to oocyte specific homeobox 3 pseudo : _no_value transcript_id : XR_034428.1

name	LOC100042685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256205 GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 pseudo : _no_value transcript_id : XR_033800.1

name	Obox2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:118200339 GeneID:246792 MGI:2149033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 2 pseudo : _no_value transcript_id : NR_003269.1

name	LOC100042765 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256263 GeneID:100042765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to oocyte specific homeobox 5 pseudo : _no_value transcript_id : XR_033880.1

clone name	MSMg01-305O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-345K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159O22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-180N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079D08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-210O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522G18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-311C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085A02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-096E16.b	B6Ng01-096E16.g
ACC	DH906991	DH906992
length	1,110	1,246
definition	DH906991\|Mus musculus domesticus DNA, BAC clone: B6Ng01-096E16, 5' end.	DH906992\|Mus musculus domesticus DNA, BAC clone: B6Ng01-096E16, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaccatggtgatctaaagttttactacagagtaattgtgttaaaa actgcatggtactggtatagggacagacaagtagaccaatggaacagaat tgaagacccagaaatgaaaccacacacctatggtcacttgatctttgaca agggagcaaaaaacatccagtggaaaaaagacagcattttcaacaaatgg tgctggcacacctggcggttatcatatagaagaatgtgaattgatccatt tctatctccttgtactaaggtcaaatctaagtggattaaagaattccaca taaaaccagacatagtgaaacatatggaggagaaagtagggaaaagcctc gaagatattggtacagggggaaaaaaatcctgaatagatcagcaatggtt tgtgctgttaagatcgagaatcgacaaatgagaccgcatgaaattgcaaa gcttctgcaaggcaaaagacacagtcaataagacaaaaaaggccaccaac agattgagaaaggatctttacctatcctaaatcagagaggggactgatat ccaatatatataaagaaatcaagaaggtgaactaccgaaaatcaaataat cccattaaaagattgggctcagagctaaaaaagaaatctcacctgaagaa tacccaatggctgagaagctcctgaaaaaatgttcaacatccttaatcat caggaaatgcaaatcaaaacaaccctgagattccacctcacaccagtcag aatggataagagcgtgctcttgtagtatgatgggtatacatgtgaataag agcgtggggaggagaaagattatgattacataaatatttcatctctctag atgcatatttgtaattttgaggttgttttattctgtgtagctctatttgt cctgtaaagttgtatatagaaaaaggcggtttagaagtcacgagatgacc tgcctctgactctgagtactttgaattaaagtataccgccagcaagctga tgcaatgtattgtagaagtttttccctaaatagccaggaatttgtttttt aggagaactagagctttatagactggaggacaactttcttgcatgacgac ctgacttaca	gaattcctgatctttccaagacttttatcctgaatgggtgttggattttt caaatgctttctctgcatttatggctaagataaaaaattcaggggacagc agatgctggggaggatgtggagaaagaggaactctcctccattgttggtg ggcttacatgcttgtacaaacactctagaaatcagtctggcggttcctca gaaaattggacacagtactactggaggatcctgcaatacctctcctgggc atatatccagaagatgttccagccagtaagaaacacacatgctccactat gttcatagcagccttatttttaatagccagaagctggaaagaacccagat gtccctcaacaggggaatgtatacagaaaatgtggtacatttacagaatg gagtactactcagatactaaagaccatgaattgaagaaattcttaggcaa atggatggatctggaggatatcatcctgagtgagacaatgcaatcacaaa agaacacatatggtatacactcattgataaggggatactagcccaggaat tgagaatacccacgatacaacttgcaaaacatatgaaactcaagaagaag gaagaccaaagtgtggatacttagctccttcttataattttaaacaaaat acccatggattgattcacagtgacaaagttcagagcagatcttgaaggaa tgaccatccagagactgccctactgggggatacacgccataaaccactac caaacccagacactaggcagatgccaccaagaacctgctgacaggagcct atatagctgtttccagtgaggctgtgccagtgcctggcaaatacagaagt ggatgctcacagttatccactggactgagcacaagttccccaattaagga gccaaagaaatacccaaggagctgaaggggactgagtccccatagaagaa acaacaatatgaactaattagtactctcagagctccttggaccttgtctt catcaggtttctatctgtcacagacatcatgaccagaaactagtgggtag gacagggtttattcggctaacactttcataactgctgtttatcaccaaag gaagtcaggcctggacctcaaacagggcaagaaggcagggactgatgcaa gaggcatggaagggatgttcttactggctgctctcccttggctgtctcag aaccagaactgacgacgcccacagaatgatggttacatctcatact
quality values	Open. Hide. 61 47 43 37 61 38 22 61 47 38 61 61 61 55 55 37 49 61 61 61 61 55 59 61 61 59 39 28 43 38 21 23 13 18 30 26 31 59 59 61 61 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 37 37 59 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 59 61 61 61 59 61 61 61 61 59 61 61 59 59 61 61 59 61 61 61 61 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 53 61 61 61 43 47 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 45 57 57 53 53 57 57 57 57 52 57 57 38 47 47 34 30 32 57 57 53 57 57 57 57 47 53 57 57 38 57 57 57 53 57 53 57 57 57 53 53 57 53 53 52 53 53 57 53 50 57 57 47 57 57 42 57 57 38 47 53 53 53 45 38 57 57 57 57 53 27 57 32 38 45 52 47 46 40 53 45 57 41 43 57 53 57 21 57 53 34 52 53 53 53 50 53 57 57 57 57 57 46 45 53 53 52 42 52 41 48 39 53 57 46 53 47 45 45 42 52 38 46 47 42 38 37 50 57 37 37 52 33 19 27 27 37 52 27 57 57 39 52 31 53 40 57 53 50 52 43 28 42 33 37 38 53 25 38 38 50 48 36 52 27 39 39 27 35 44 42 37 30 57 29 31 57 37 31 36 30 53 24 44 18 52 37 32 52 36 37 48 40 27 53 21 40 25 21 24 32 41 41 28 53 57 53 27 34 37 37 47 24 40 53 40 48 39 41 33 29 53 28 45 19 41 44 32 44 51 46 47 48 30 31 39 27 32 46 32 27 48 26 48 39 28 31 48 33 41 29 47 23 29 31 51 30 29 31 16 46 5 17 23 44 35 35 36 39 29 29 37 18 30 23 29 29 20 27 29 29 51 28 41 22 20 31 24 51 51 34 29 30 23 38 18 27 36 33 51 51 29 34 29 33 29 18 24 21 40 24 28 22 29 29 28 26 14 36 51 29 30 26 43 29 28 43 20 25 51 29 21 12 7 51 15 25 26 17 28 30 26 43 41 38 41 20 21 24 7 8 17 19 41 20 9 6 32 43 13 29 33 31 11 26 6 5 16 13 23 29 13 23 24 26 28 13 20 33 30 25 20 15 26 51 14 28 29 17 29 28 33 25 51 15 31 33 24 19 38 9 51 16 38 22 9 9 19 29 24 30 17 33 23 22 38 28 13 19 11 6 13 23 9 34 23 13 17 13 8 5 16 24 16 19 6 13 15 32 39 27 24 44 39 34 23 25 37 23 28 30 20 10 6 6 18 22 28 6 12 21 11 4 11 37 7 20 30 28 30 15 17 14 20 30 20 12 5 10 22 11 15 18 4 1 3 3 3 7 13 19 12 9 5 7 12 19 6 3 3 3 8 16 11 6 14 16 9 26 11 23 7 8 10 8 2 2 2 3 5 4 6 14 14 5 8 22 19 9 18 5 4 3	Open. Hide. 59 61 59 61 61 59 59 33 35 23 24 33 35 59 52 61 37 35 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 61 37 55 50 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 61 55 55 61 55 61 61 61 55 61 55 55 61 55 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 53 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 47 45 61 61 61 61 61 61 61 61 61 61 57 57 47 47 57 57 57 45 57 53 53 53 57 57 53 45 57 53 57 53 53 53 53 53 57 57 57 57 53 53 57 57 57 53 52 53 53 57 57 57 57 47 53 53 53 47 53 52 57 53 50 57 43 19 57 50 57 50 53 28 53 50 57 57 50 53 57 45 57 52 53 47 50 52 57 47 47 53 53 53 47 47 46 52 52 50 47 53 52 45 47 39 57 57 50 50 57 53 50 40 57 57 57 53 50 53 57 38 31 53 53 57 53 53 53 53 32 33 57 41 45 52 53 57 50 57 37 40 37 46 57 32 50 53 52 41 15 43 27 47 37 33 50 50 50 50 53 50 40 37 18 34 47 34 38 42 33 27 30 28 52 40 53 34 38 57 27 38 32 44 52 33 47 53 37 42 36 33 37 57 57 41 33 52 21 33 38 32 40 31 52 39 35 48 36 53 34 40 48 40 33 40 37 26 22 13 46 29 37 53 52 32 30 35 27 25 41 40 34 12 57 35 41 31 41 33 37 40 37 20 26 44 33 38 30 53 33 28 39 33 41 30 41 35 25 19 29 28 53 38 21 29 47 30 31 39 31 43 21 30 30 32 40 30 45 36 48 26 17 31 30 33 32 30 34 12 32 32 27 29 20 46 21 29 29 29 19 29 34 29 30 29 32 51 27 27 24 29 21 17 48 38 18 20 36 29 31 20 29 29 36 33 31 29 21 28 27 47 28 29 34 34 25 29 27 29 24 29 17 28 38 35 21 29 25 30 24 29 28 27 14 12 30 29 18 14 21 20 43 18 16 10 18 29 24 32 25 17 30 25 23 41 46 20 22 21 29 36 32 13 20 13 22 28 15 29 34 12 21 19 23 46 41 27 26 21 25 33 34 15 29 31 31 29 31 15 27 24 17 36 28 9 30 42 15 27 12 29 28 8 21 27 14 15 34 30 19 28 31 27 29 28 28 25 18 21 22 20 25 28 28 20 12 7 32 17 28 28 9 30 11 11 26 14 33 22 23 14 14 28 20 31 22 19 28 25 33 31 5 10 18 14 51 19 28 25 12 32 9 19 29 10 15 14 23 13 15 20 14 14 26 22 27 23 14 14 19 15 24 10 30 39 15 15 28 34 8 4 9 35 34 23 24 17 11 24 12 19 24 33 11 11 42 13 12 16 15 12 10 13 11 9 8 5 6 5 16 7 31 9 16 5 9 7 6 5 4 3 8 8 5 5 33 15 8 6 7 6 16 8 6 12 12 8 5 8 14 11 13 17 23 17 12 7 17 14 19 9 5 4 9 23 15 16 9 7 7 6 13 15 13 5 10 5 17 7 13 8 6 10 5 10 10 5 4 3 6 8 5 9 5 7 4 4 4 15 9 7 12 8 5 5 9 7 15 19 29 10 16 4 2 3 3 5 6 17 6 9 3 12 3 3 2 2 5 6 5 8 14 13 6 10 4 3 21 10 6 4 4 6 5 6 5 4 8 13 9 14 11 3 8 5 4 11 7 8 8 6 10 8 4 6 24 3 2 3 11 7 7 7 4 4 5 3 4 8 6 5 4 17 1 1 2 1 3 5 5 4 3 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_16013526_16014382
seq2: B6Ng01-096E16.b_306_1154

seq1  GTACTAAGGTCAAATCTAAGTGGATTAAAGAATTCCACATAAAACCAGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTAAGGTCAAATCTAAGTGGATTAAAGAATTCCACATAAAACCAGAC  50

seq1  ATAGTGAAACATATGGAGGAGAAAGTAGGGAAAAGCCTCGAAGATATTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTGAAACATATGGAGGAGAAAGTAGGGAAAAGCCTCGAAGATATTGG  100

seq1  TACAGGGGGAAAAAAATCCTGAATAGATCAGCAATGGTTTGTGCTGTTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGGGGGAAAAAAATCCTGAATAGATCAGCAATGGTTTGTGCTGTTAA  150

seq1  GATCGAGAATCGACAAATGAGACCGCATGAAATTGCAAAGCTTCTGCAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCGAGAATCGACAAATGAGACCGCATGAAATTGCAAAGCTTCTGCAAG  200

seq1  GCAAAAGACACAGTCAATAAGACAAAAAAGGCCACCAACAGATTGAGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAAGACACAGTCAATAAGACAAAAAAGGCCACCAACAGATTGAGAAA  250

seq1  GGATCTTTACCTATCCTAAATCAGAGAGGGGACTGATATCCAATATATAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCTTTACCTATCCTAAATCAGAGAGGGGACTGATATCCAATATATAT  300

seq1  AAAGAAATCAAGAAGGTGAACTACCGAAAATCAAATAATCCCATTAAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAATCAAGAAGGTGAACTACCGAAAATCAAATAATCCCATTAAAAG  350

seq1  ATTGGGCTCAGAGCTAAAAAAGAAATCTCACCTGAAGAATACCCAATGGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGGCTCAGAGCTAAAAAAGAAATCTCACCTGAAGAATACCCAATGGC  400

seq1  TGAGAAGCTCCTGAAAAAATGTTCAACATCCTTAATCATCAGGAAATGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAAGCTCCTGAAAAAATGTTCAACATCCTTAATCATCAGGAAATGCA  450

seq1  AATCAAAACAACCCTGAGATTCCACCTCACACCAGTCAGAATGGATAAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAAAACAACCCTGAGATTCCACCTCACACCAGTCAGAATGGATAAGA  500

seq1  GCGTGCTCTTGTAGTATGATGGGTATACATGTGAATAAGAGCGTGGGGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGTGCTCTTGTAGTATGATGGGTATACATGTGAATAAGAGCGTGGGGAG  550

seq1  GAGAAAGATTATGATTACATAAATA-TTCATCTCTCTAGATGCATATTTG  599
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  GAGAAAGATTATGATTACATAAATATTTCATCTCTCTAGATGCATATTTG  600

seq1  TAATTTTGAGGTTGTTTTATTCTGTGTAGCTCTATTTGTCCTGTAAAGTG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TAATTTTGAGGTTGTTTTATTCTGTGTAGCTCTATTTGTCCTGTAAAGTT  650

seq1  GTATATAGAAAAAGGCGGTTTAGAAGTCACGGAGATGACCTGCCTCTGAC  699
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  GTATATAGAAAAAGGCGGTTTAGAAGTCAC-GAGATGACCTGCCTCTGAC  699

seq1  TCCTGAGTACTTTGAATTAAGGTATACCGCCAGCAAGGCTGATGCAATGT  749
      | |||||||||||||||||| ||||||||||||||| |||||||||||||
seq2  T-CTGAGTACTTTGAATTAAAGTATACCGCCAGCAA-GCTGATGCAATGT  747

seq1  ATTGTAGAAAGTTTTTCCCTAAATAGCCAGGAATTTGTTTTTTAAGGAGA  799
      ||||||| ||||||||||||||||||||||||||||||||||| ||||||
seq2  ATTGTAG-AAGTTTTTCCCTAAATAGCCAGGAATTTGTTTTTT-AGGAGA  795

seq1  ACTAGACACCTTATAGACTGTGAAGACAAC-TTCCTGCAGTGACAGACCC  848
      ||||||  | |||||||||| || |||||| ||| |||| |||| || ||
seq2  ACTAGA-GCTTTATAGACTG-GAGGACAACTTTCTTGCA-TGAC-GA-CC  840

seq1  TGACTTACA  857
      |||||||||
seq2  TGACTTACA  849

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information