MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-103D16
Chromosome	7 (Build37)
Map Location	7,648,624 - 7,793,443
singlet/doublet	doublet
Overlap gene	LOC665485, EG625353
Upstream gene	Zim1, Peg3, Usp29, LOC627961, Aurkc, LOC628030, LOC100041822, 5730403M16Rik, 2810409K11Rik, Vmn2r-ps35, Zfp418, BC023179, 6430701C03Rik, Clcn4-2, V2r15, LOC100041866, LOC100042577, Vmn2r31, Vmn2r-ps36, V2r5, LOC100041883, EG628117, Vmn2r33, LOC665470, EG665474, EG628368, LOC100042636
Downstream gene	Vmn2r-ps40, Vmn2r36, LOC638170, LOC100042662, LOC100041942, LOC100042673, LOC100041949, LOC100042681, LOC100042688, LOC100042695, LOC100041956, LOC100041961, LOC100042703, LOC100041967, LOC100042724, LOC100041977, LOC100041983, LOC100041989, LOC100041998
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22776 MGI:1341879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Aurkc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20871 MGI:1321119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC628030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 41 Proteins pseudo : _no_value

name	LOC100041822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	5730403M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232853 MGI:1917764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810409K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76373 MGI:1923623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 2 Proteins

name	Vmn2r-ps35 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232854 MGI:2444763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC023179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232855 MGI:2385265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430701C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76229 MGI:1923479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Clcn4-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12727 MGI:104571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V2r15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22306 MGI:1316729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Vmn2r31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 Proteins

name	Vmn2r-ps36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins pseudo : _no_value

name	V2r5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22311 MGI:1316696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 14 Proteins

name	LOC100041883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG628117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Vmn2r33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC665470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	EG665474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665474 MGI:3643732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG628368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628368 MGI:3646850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100042636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 12 Proteins

name	LOC665485 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	EG625353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins

name	Vmn2r-ps40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Vmn2r36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 22 Proteins

name	LOC638170 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042662 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 Proteins pseudo : _no_value

name	LOC100041942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100042673 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 21 Proteins

name	LOC100041949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 4 ESTs, 20 Proteins

name	LOC100042695 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	LOC100041956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	LOC100041967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 22 Proteins

name	LOC100041977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100041983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC100041989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	Zim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734480 GeneID:22776 MGI:1341879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, imprinted 1 transcript_id : NM_011769.3

name	Peg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331165 GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paternally expressed 3 transcript_id : NM_008817.2

name	Usp29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145572 GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 29 transcript_id : NM_021323.2

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378051 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_001080966.1

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378043 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_020572.2

name	Aurkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378045 GeneID:20871 MGI:1321119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aurora kinase C transcript_id : NM_001080965.1

name	5730403M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349528 GeneID:232853 MGI:1917764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730403M16 gene transcript_id : NM_172738.2

name	2810409K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256156 GeneID:76373 MGI:1923623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 2 Proteins product : RIKEN cDNA 2810409K11 gene transcript_id : XM_001478656.1

name	Zfp418 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124339856 GeneID:232854 MGI:2444763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 418 transcript_id : NM_146179.2

name	BC023179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625909 GeneID:232855 MGI:2385265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023179 transcript_id : NM_145577.2

name	Clcn4-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625939 GeneID:12727 MGI:104571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 4-2 transcript_id : NM_011334.3

name	V2r15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126507093 GeneID:22306 MGI:1316729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 15 transcript_id : NM_009490.2

name	LOC100041866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256105 GeneID:100041866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477141.1

name	LOC100042577 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256162 GeneID:100042577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001478744.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256166 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 2 transcript_id : XM_001478759.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256168 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 3 transcript_id : XM_001478768.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256164 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 1 transcript_id : XM_001478750.1

name	Vmn2r31 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256170 GeneID:100042591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : vomeronasal receptor Vmn2r31, transcript variant 4 transcript_id : XM_001478775.1

name	V2r5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379365 GeneID:22311 MGI:1316696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 10 Proteins product : vomeronasal 2, receptor, 5, transcript variant 1 transcript_id : XM_620407.3

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379371 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 1 transcript_id : XM_620409.3

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903082 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 2 transcript_id : XM_899013.1

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256174 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 3 transcript_id : XM_899030.3

name	EG628368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379360 GeneID:628368 MGI:3646850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG628368 transcript_id : XM_893101.2

name	LOC100042636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256175 GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 8 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001478838.1

name	LOC100042636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256177 GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001478846.1

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379374 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 Proteins product : predicted gene, EG625353, transcript variant 1 transcript_id : XM_890819.2

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903106 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG625353, transcript variant 2 transcript_id : XM_899240.1

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256181 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG625353, transcript variant 3 transcript_id : XM_899254.3

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256185 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 2 transcript_id : XM_001478895.1

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256187 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 3 transcript_id : XM_001478904.1

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256183 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 1 transcript_id : XM_001478890.1

name	LOC100042673 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256193 GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001478928.1

name	LOC100042673 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256191 GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001478919.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256201 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478937.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256199 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478933.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256203 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478952.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256206 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478969.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256208 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 10 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478976.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256210 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 6 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478984.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256214 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478989.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256216 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478996.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256218 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479004.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256222 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479014.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256224 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479020.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256226 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479025.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256240 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479046.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256242 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479051.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256238 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479040.1

name	LOC100041983 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256110 GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477335.1

name	Peg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331166 CCDS:CCDS20783.1 GeneID:18616 MGI:104748
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : granule cell antiserum positive 4; paternally expressed gene 3 product : paternally expressed 3 protein_id : NP_032843.2

name	Usp29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145573 CCDS:CCDS20784.1 GeneID:57775 MGI:1888998
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ossification center-associated transcript product : ubiquitin specific protease 29 protein_id : NP_067298.2

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378046 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform a protein_id : NP_001074434.1

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378052 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform b protein_id : NP_001074435.1

name	Aurkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378044 GeneID:20871 MGI:1321119
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; serine/threonine kinase 13 (aurora/IPL-like); aurora B product : aurora kinase C isoform b protein_id : NP_065597.2

name	5730403M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370086 GeneID:232853 MGI:1917764
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC232853 protein_id : NP_766326.1

name	2810409K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256157 GeneID:76373 MGI:1923623
definition	codon_start : 1 product : hypothetical protein LOC76373 protein_id : XP_001478706.1

name	Zfp418 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124339857 GeneID:232854 MGI:2444763
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 418 protein_id : NP_666291.2

name	BC023179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625910 CCDS:CCDS20785.1 GeneID:232855 MGI:2385265
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232855 protein_id : NP_663552.2

name	Clcn4-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625940 CCDS:CCDS20786.1 GeneID:12727 MGI:104571
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : voltage-gated chloride channel ClC-4A product : chloride channel 4 protein_id : NP_035464.3

name	V2r15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126507094 GeneID:22306 MGI:1316729
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 15 product : vomeronasal 2, receptor, 15 protein_id : NP_033516.2

name	LOC100041866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256106 GeneID:100041866
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477191.1

name	LOC100042577 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256163 GeneID:100042577
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001478794.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256169 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001478818.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256165 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478800.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256167 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478809.1

name	Vmn2r31 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256171 GeneID:100042591
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 4 protein_id : XP_001478825.1

name	V2r5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555322 GeneID:22311 MGI:1316696
definition	codon_start : 1 product : vomeronasal 2, receptor, 5 isoform 1 protein_id : XP_620407.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903083 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904106.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903087 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904123.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903085 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_620409.2

name	EG628368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379361 GeneID:628368 MGI:3646850
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_898194.2

name	LOC100042636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256178 GeneID:100042636
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001478896.1

name	LOC100042636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256176 GeneID:100042636
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001478888.1

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903107 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904333.1

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256182 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904347.3

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256180 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_895912.3

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256186 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478945.1

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256184 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478940.1

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256188 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001478954.1

name	LOC100042673 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256194 GeneID:100042673
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001478978.1

name	LOC100042673 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256192 GeneID:100042673
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001478969.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256202 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478987.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256200 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478983.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256204 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479002.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256207 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479019.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256209 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479026.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256211 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479034.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256215 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479039.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256217 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479046.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256219 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479054.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256223 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479064.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256225 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479070.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256227 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479075.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256239 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479090.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256241 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479096.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256243 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479101.1

name	LOC100041983 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256111 GeneID:100041983
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477385.1

name	LOC627961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627961
definition	number : 1 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 5 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 4 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 3 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 2 pseudo : _no_value

name	LOC100041822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041822
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps35 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628048
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps36 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665442
definition	number : 1 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 7 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 6 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 5 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 4 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 3 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 2 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 1 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 6 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 5 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 4 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 3 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 2 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 1 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 6 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 5 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 4 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 3 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 2 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 1 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 6 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 5 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 4 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 3 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 2 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 1 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 7 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 6 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 5 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 4 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 3 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 2 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 1 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 6 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 5 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 4 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 3 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 2 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 1 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 1 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 2 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 3 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 4 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 5 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 6 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 1 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 2 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 3 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 1 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 2 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 3 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 5 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 1 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 2 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 3 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 4 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 5 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 1 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 2 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 3 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 4 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 5 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 6 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 8 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 9 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 10 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 11 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 12 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 13 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 1 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 2 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 3 pseudo : _no_value

name	LOC628030 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256102 GeneID:628030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 41 Proteins product : similar to Arp2 pseudo : _no_value transcript_id : XR_033042.1

name	6430701C03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256074 GeneID:76229 MGI:1923479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430701C03 gene pseudo : _no_value transcript_id : XR_035717.1

name	EG628117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256107 GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG628117 pseudo : _no_value transcript_id : XR_033094.1

name	LOC665470 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256108 GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_033101.1

name	LOC665485 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256179 GeneID:665485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_033937.1

clone name	MSMg01-327C01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-103D16.b	B6Ng01-103D16.g
ACC	DH911887	DH911888
length	1,130	850
definition	DH911887\|Mus musculus domesticus DNA, BAC clone: B6Ng01-103D16, 5' end.	DH911888\|Mus musculus domesticus DNA, BAC clone: B6Ng01-103D16, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(7,792,289 - 7,793,443)	(7,648,624 - 7,649,486)
sequence	gaattcttgagatcagtggtgaaaggatacttgattccaaatatgtcctt tctttcttcttctgtggtaatttcccgagttttctttgcaagaagacctg tcaagtatcattcccacaaagacctataacctgttgggtcttaatttcaa ggcaaaaatgttgaactaaagtgtccattaacatatcaaactgtgcagtg gactcagcatccctctgtctctactgcacataggtccctggctggcatgc ctccctccctgcagccacccccccaaaaaaaaataactccccagtccagg tgatcccctgggctttactcgttccagctcctctgacacctatataactc agccacttttagctgtgctagtctcttggctcaggtggtccctcttggtt ggagtcccctctttctcttttcagatctcctctcctcacatggcccagtt tagggtcatgtttactctgttaggtttcctgtatggtctgaaactcactg tgacaagctactctctaatcccaaacatcaacttgcctctgccagcagtt ctggaatttaggagtgtttcagcaagccgggcttttggagctcaaggaaa tactgacacatctataatcacaacactctccctaacagattgagtgtaag gctccatctggggaggtgtgtccacttcctggcgcttgatcacaccacac aactgaactacattgtccagaagacattgcaccgagaatagccaattaaa ataggcgcattagtgacaacaaaaggactctgggcgggactttcgacttt gcatgcaggaggttctttgaaactttttttttttttttattcagcttcac agaaaactggttttatcagtattggtcatggcagaaaacgctagagttga ggcatttttcctccgtcacggagacggagctgaggttttcgaaagcccgt gtgatctaatccaagcttcgaggaggatgtcacgtcccatggcgcttgcc agtgagcccatgtgattgtgagactgcagtagagccctgccagtgagtgc tgtgatctcccacctactgagttctagagcctggatcagtcaggagcaac agtagactcattcccgactgtaaggcactg	gaattcatatcagctggtgtgtgctggctggttggtattccggtgtcaga gagaactcggaggttcaggttaattgagactactgggcgtcctacaatgt tgctctcctcctcctcatcttcctggttttccataattgaaactcagtgt tcagcagcttcagtctactggttgggggcaaatatctgtatctgactcag ctgcttgttggatttttcagagggcagtcacgatatgccccatttttgtg agtgctccatagcctcaataatagtgccaggccttaggacctccccttga gctggatccaacactgggcctgtggctggatctcattttagacaaggtcc tctccatttctattgctgcagttctttcagcaggaacaattatgggtcag cgttttgaatgtggcatggaaatctcctccctcgttttttgtttgtttgt ttgtttgtttgtttttaaagacaaaactgaagaaaattcagttgtgggat tgaatgtcctctcagtggatgaaggtttgctgtataatcataaggacctt agttgtgaaccctcacactgtttgacatgccatcattacttattcctaga aatggctgtactggtacacactatttaattaggctggtcttgggcacaaa ctctgtttccttacttatttagtccggggatcaatgatgtttgccaacaa ttctgtagggaaactgtttttgtgtatgcctggctttaattgattagaca attttctcttggtatccatttgttcttcatgaaacataactttgtcgtag gtagtatttgtaaacaatgtcctagaacacatgtgtatatatatatatat
quality values	Open. Hide. 61 47 35 38 61 61 61 61 47 61 61 36 36 49 38 49 49 61 47 59 61 61 61 61 61 31 23 15 12 29 24 28 26 22 22 43 59 59 49 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 52 59 44 37 36 30 35 44 61 59 59 61 59 61 59 55 55 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 59 61 59 59 59 59 61 61 61 61 55 59 59 59 61 61 61 59 59 59 61 59 44 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 53 61 61 61 61 46 57 57 57 57 53 57 57 57 57 53 57 57 57 57 57 47 57 53 53 57 57 52 57 57 57 57 57 57 53 53 57 57 57 53 53 50 53 47 57 57 57 53 53 52 57 50 57 53 53 45 57 57 53 53 57 57 57 53 57 57 53 53 53 45 53 50 52 50 57 53 53 52 57 52 31 53 53 38 46 28 52 45 47 32 53 57 57 57 57 57 53 52 35 52 30 53 53 57 45 52 52 42 38 53 52 50 57 52 57 52 38 34 52 53 52 57 42 50 50 40 50 37 37 41 36 53 40 40 52 53 50 53 52 52 39 37 42 41 53 42 47 57 57 40 53 52 35 40 57 57 24 53 21 36 41 57 53 37 33 38 57 40 40 29 53 42 33 44 24 45 39 36 53 36 48 29 57 57 44 36 41 17 53 41 36 47 34 40 34 37 37 48 41 37 33 31 53 37 30 57 57 44 18 35 30 17 47 44 31 51 51 31 30 32 46 31 30 23 32 51 29 28 24 30 36 28 51 41 36 32 12 30 32 24 15 13 7 30 24 47 16 29 41 35 51 34 30 38 51 31 30 39 51 51 51 51 51 51 51 51 51 51 51 51 51 34 29 41 16 33 25 28 33 23 11 23 18 28 21 12 22 46 39 29 17 29 43 43 28 51 51 29 21 18 35 20 24 28 21 29 20 21 26 28 29 25 29 29 43 24 24 15 51 51 51 29 29 13 27 31 28 17 30 26 30 29 28 34 23 29 13 20 41 46 51 51 39 27 27 34 27 29 22 21 25 17 20 17 21 29 15 23 14 19 22 26 17 28 31 14 30 5 31 13 51 51 33 28 14 38 51 22 27 27 34 30 23 22 35 28 28 16 13 28 33 23 22 28 25 25 15 19 31 33 27 28 26 12 32 24 8 20 26 33 12 14 31 21 39 12 22 19 34 20 44 16 21 26 30 9 5 5 7 6 9 26 5 5 26 17 13 19 4 5 8 31 6 17 8 17 4 7 20 16 9 22 10 31 16 8 31 22 29 29 18 16 30 12 23 9 15 10 15 34 12 28 5 14 10 8 29 5 12 7 4 8 13 27 14 3 5 16 24 12 6 10 10 30 7 10 8 19 9 9 23 7 10 12 3 5 8 11 8 7 4 2 2 2 4 5 5 4 4 11 10 11 24 7 4 2 7 7 12 4 13 3 4 5 4 12 3 3 4 5 9 12 20 7 7 3 13 27 20 9 19 12 8 16 8 8 4 13 13 5 8 6 4 9	Open. Hide. 55 47 49 59 59 20 14 28 22 21 24 12 8 19 29 59 59 61 61 61 61 59 59 61 61 61 61 59 59 59 61 59 61 61 59 59 61 61 61 61 61 55 59 61 61 61 61 59 52 59 36 55 28 44 37 44 59 59 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 55 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 55 59 61 59 61 61 61 61 61 59 61 59 59 49 59 59 59 59 61 61 61 61 61 59 61 59 59 59 41 52 59 59 59 59 59 44 59 61 59 59 61 61 61 61 61 61 59 59 49 55 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 55 55 61 59 61 61 61 59 55 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 55 50 55 55 55 55 61 61 55 61 61 61 61 61 61 55 55 49 55 61 61 55 61 61 55 61 39 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 43 61 61 61 61 61 52 61 50 61 61 61 61 52 50 53 47 61 47 61 53 61 61 61 61 61 61 40 61 61 61 61 47 61 61 61 53 61 61 61 61 61 61 61 61 53 61 50 61 61 61 53 61 61 61 61 61 45 61 61 61 61 53 61 61 45 61 61 47 53 47 47 53 45 53 53 53 50 47 50 53 53 53 50 57 47 47 57 57 45 50 53 53 53 53 53 50 57 45 53 53 52 47 53 53 53 47 53 52 50 53 47 30 47 45 53 57 53 43 53 45 53 53 53 57 50 50 27 7 47 34 47 53 53 57 47 52 28 33 30 27 32 33 42 50 39 53 42 34 53 53 45 45 47 47 47 34 57 53 57 30 17 35 20 46 35 53 52 38 32 30 57 53 38 42 53 27 32 45 29 42 25 18 32 41 45 45 42 40 57 53 52 57 53 30 38 41 25 57 57 57 51 29 24 35 24 30 31 40 38 53 36 52 37 29 53 53 37 42 17 8 25 37 37 37 35 41 30 53 37 25 23 22 57 57 38 37 34 37 23 43 52 31 32 35 36 37 32 32 47 57 30 33 39 37 30 30 12 24 19 35 37 41 57 40 35 32 27 16 53 23 16 53 32 53 29 46 31 24 48 20 27 11 33 30 24 29 35 47 30 46 19 46 51 21 29 29 29 32 47 19 8 19 30 29 20 45 30 32 27 29 27 20 29 11 25 10 17 21 20 25 19 24 7 7 15 30 22 13 7 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_7792289_7793443
seq2: B6Ng01-103D16.b_48_1177 (reverse)

seq1  CAGTGCCCTACAGTCGGGGACATGGAGTCTACCCTGTTGGCTCCTGACCC  50
      ||||||| ||||||||||   |  |||||||  ||||| ||||||||  |
seq2  CAGTGCCTTACAGTCGGG---AATGAGTCTA--CTGTT-GCTCCTGA--C  42

seq1  TGATCTCAGCGCTCTAGAACTCAGGTAGGTGGGAGATCACAAGGCACTCA  100
      ||||| ||| ||||||||||||| |||||||||||||||||  |||||||
seq2  TGATC-CAG-GCTCTAGAACTCA-GTAGGTGGGAGATCACA--GCACTCA  87

seq1  CCTGGGGCAGGGCTCTACCTGCAGTCTCCACAATCACCATTGGGCTCCAC  150
      |    |||||||||||| ||||||||| |||||||||   |||||| |||
seq2  C---TGGCAGGGCTCTA-CTGCAGTCT-CACAATCAC--ATGGGCT-CAC  129

seq1  TTGCCAGGCGGCCATGGGACGTGGACATCCCTCCTCGAAGCTTGGATTAG  200
      | || ||   |||||||||||| ||||| |||||||||||||||||||||
seq2  TGGCAAG--CGCCATGGGACGT-GACAT-CCTCCTCGAAGCTTGGATTAG  175

seq1  ATCACACGGGCTTTCGAAAACCTCAGCTCCGTCTCCGTGACGGAGGAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACACGGGCTTTCGAAAACCTCAGCTCCGTCTCCGTGACGGAGGAAAA  225

seq1  ATGCCTCAACTCTAGCGTTTTTCTGCCATGACCAATACTGATAAAACCAG  300
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  ATGCCTCAACTCTAGCG-TTTTCTGCCATGACCAATACTGATAAAACCAG  274

seq1  TTTTCTGTGAAGCTGAAT-AAAAAAAAAAAAAAGTTTCAAAGAACCTCCT  349
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  TTTTCTGTGAAGCTGAATAAAAAAAAAAAAAAAGTTTCAAAGAACCTCCT  324

seq1  GCATGCAAAGTCGAAAGTCCCGCCCAGAGTCCTTTTGTTGTCACTAATGC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCAAAGTCGAAAGTCCCGCCCAGAGTCCTTTTGTTGTCACTAATGC  374

seq1  GCCTATTTTAATTGGCTATTCTCGGTGCAATGTCTTCTGGACAATGTAGT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTATTTTAATTGGCTATTCTCGGTGCAATGTCTTCTGGACAATGTAGT  424

seq1  TCAGTTGTGTGGTGTGATCAAGCGCCAGGAAGTGGACACACCTCCCCAGA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTGTGTGGTGTGATCAAGCGCCAGGAAGTGGACACACCTCCCCAGA  474

seq1  TGGAGCCTTACACTCAATCTGTTAGGGAGAGTGTTGTGATTATAGATGTG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCCTTACACTCAATCTGTTAGGGAGAGTGTTGTGATTATAGATGTG  524

seq1  TCAGTATTTCCTTGAGCTCCAAAAGCCCGGCTTGCTGAAACACTCCTAAA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTATTTCCTTGAGCTCCAAAAGCCCGGCTTGCTGAAACACTCCTAAA  574

seq1  TTCCAGAACTGCTGGCAGAGGCAAGTTGATGTTTGGGATTAGAGAGTAGC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGAACTGCTGGCAGAGGCAAGTTGATGTTTGGGATTAGAGAGTAGC  624

seq1  TTGTCACAGTGAGTTTCAGACCATACAGGAAACCTAACAGAGTAAACATG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCACAGTGAGTTTCAGACCATACAGGAAACCTAACAGAGTAAACATG  674

seq1  ACCCTAAACTGGGCCATGTGAGGAGAGGAGATCTGAAAAGAGAAAGAGGG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTAAACTGGGCCATGTGAGGAGAGGAGATCTGAAAAGAGAAAGAGGG  724

seq1  GACTCCAACCAAGAGGGACCACCTGAGCCAAGAGACTAGCACAGCTAAAA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCAACCAAGAGGGACCACCTGAGCCAAGAGACTAGCACAGCTAAAA  774

seq1  GTGGCTGAGTTATATAGGTGTCAGAGGAGCTGGAACGAGTAAAGCCCAGG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCTGAGTTATATAGGTGTCAGAGGAGCTGGAACGAGTAAAGCCCAGG  824

seq1  GGATCACCTGGACTGGGGAGTTATTTTTTTTTGGGGGGGTGGCTGCAGGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCACCTGGACTGGGGAGTTATTTTTTTTTGGGGGGGTGGCTGCAGGG  874

seq1  AGGGAGGCATGCCAGCCAGGGACCTATGTGCAGTAGAGACAGAGGGATGC  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGCATGCCAGCCAGGGACCTATGTGCAGTAGAGACAGAGGGATGC  924

seq1  TGAGTCCACTGCACAGTTTGATATGTTAATGGACACTTTAGTTCAACATT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTCCACTGCACAGTTTGATATGTTAATGGACACTTTAGTTCAACATT  974

seq1  TTTGCCTTGAAATTAAGACCCAACAGGTTATAGGTCTTTGTGGGAATGAT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCCTTGAAATTAAGACCCAACAGGTTATAGGTCTTTGTGGGAATGAT  1024

seq1  ACTTGACAGGTCTTCTTGCAAAGAAAACTCGGGAAATTACCACAGAAGAA  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGACAGGTCTTCTTGCAAAGAAAACTCGGGAAATTACCACAGAAGAA  1074

seq1  GAAAGAAAGGACATATTTGGAATCAAGTATCCTTTCACCACTGATCTCAA  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAAAGGACATATTTGGAATCAAGTATCCTTTCACCACTGATCTCAA  1124

seq1  GAATTC  1155
      ||||||
seq2  GAATTC  1130

seq1: chr7_7648624_7649486
seq2: B6Ng01-103D16.g_68_917

seq1  GAATTCATATCAGCTGGTGTGTGCTGGCTGGTTGGTATTCCGGTGTCAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATATCAGCTGGTGTGTGCTGGCTGGTTGGTATTCCGGTGTCAGA  50

seq1  GAGAACTCGGAGGTTCAGGTTAATTGAGACTACTGGGCGTCCTACAATGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACTCGGAGGTTCAGGTTAATTGAGACTACTGGGCGTCCTACAATGT  100

seq1  TGCTCTCCTCCTCCTCATCTTCCTGGTTTTCCATAATTGAAACTCAGTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTCCTCCTCCTCATCTTCCTGGTTTTCCATAATTGAAACTCAGTGT  150

seq1  TCAGCAGCTTCAGTCTACTGGTTGGGGGCAAATATCTGTATCTGACTCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGCTTCAGTCTACTGGTTGGGGGCAAATATCTGTATCTGACTCAG  200

seq1  CTGCTTGTTGGATTTTTCAGAGGGCAGTCACGATATGCCCCGTTTTTGTG  250
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  CTGCTTGTTGGATTTTTCAGAGGGCAGTCACGATATGCCCCATTTTTGTG  250

seq1  AGTGCTCCACAGCCTCAATAATAGTGTCAGGCCTTAGGACCTCCCCTTGA  300
      ||||||||| |||||||||||||||| |||||||||||||||||||||||
seq2  AGTGCTCCATAGCCTCAATAATAGTGCCAGGCCTTAGGACCTCCCCTTGA  300

seq1  GCTGGATCCAACACTGGGCCTGTGGCTGGATCTCATTTTAGACAGGGTCC  350
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GCTGGATCCAACACTGGGCCTGTGGCTGGATCTCATTTTAGACAAGGTCC  350

seq1  TCTCCATTTCTATTGCTGCAGTTCTTTCAGCAGGAACAATTATGGGTCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATTTCTATTGCTGCAGTTCTTTCAGCAGGAACAATTATGGGTCAG  400

seq1  TGTTTTGAATGTGGCATGGAAATCTCCTCCCTCGTTTTTTTGTTTGTTTG  450
       ||||||||||||||||||||||||||||||||||||             
seq2  CGTTTTGAATGTGGCATGGAAATCTCCTCCCTCGTTT-------------  437

seq1  TTTGTTTGTTTGTTTGTTTGTTTGTTTTTAAAGACAAAACTGAAGAAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTGTTTGTTTGTTTGTTTGTTTTTAAAGACAAAACTGAAGAAAAT  487

seq1  TCAGTTGTGGGATTGAATGTCCTCTCAGTGGATGAAGGTTTGCTGTATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTGTGGGATTGAATGTCCTCTCAGTGGATGAAGGTTTGCTGTATAA  537

seq1  TCATAAGGACCTTAGTTGTGAACCCTCACACTGTTTGACATGCCATCATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAAGGACCTTAGTTGTGAACCCTCACACTGTTTGACATGCCATCATT  587

seq1  ACTTATTCCTAGAAATGGCTGTACTGGTACACACTATTTAATTAGGCTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTATTCCTAGAAATGGCTGTACTGGTACACACTATTTAATTAGGCTGG  637

seq1  TCTTGGGCACAAACTCTGTTTCCTTACTTATTTAGTCCGGGGATCAATGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGGGCACAAACTCTGTTTCCTTACTTATTTAGTCCGGGGATCAATGA  687

seq1  TGTTTGCCAACAATTCTGTAGGGAAACTGTTTTTGTGTATGCCTGGCTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGCCAACAATTCTGTAGGGAAACTGTTTTTGTGTATGCCTGGCTTT  737

seq1  AATTGATTAGACAATTTTCTCTTGGTATCCATTTGTTCTTCATGAAACAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGATTAGACAATTTTCTCTTGGTATCCATTTGTTCTTCATGAAACAT  787

seq1  AACTTTGTCGTAGGTAGTATTTGTAAACAATGTGCTAGAACACATGTATA  850
      ||||||||||||||||||||||||||||||||| ||||||||||||| ||
seq2  AACTTTGTCGTAGGTAGTATTTGTAAACAATGTCCTAGAACACATGTGTA  837

seq1  TATATATATATAT  863
      |||||||||||||
seq2  TATATATATATAT  850

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information