MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-157I13
Chromosome	7 (Build37)
Map Location	26,460,899 - 26,462,035
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gm1096, BC049730, EG210155, Cd177, Ceacam10, EG545936, LOC100043712, Lypd4, Dmrtc2, Rps19, Cd79a, Arhgef1, EG232974, Rabac1, Atp1a3, Grik5, Zfp574, Pou2f2, Dedd2, Zfp526, Gsk3a, 9130221H12Rik, Erf, Cic, Pafah1b3, EG623131, Tmem145, Megf8, Cnfn, Lipe, BC024561, LOC434148, Ceacam1, Ceacam2, LOC100043722, EG632778, 2310004L02Rik, B3gnt8, Bckdha, Exosc5, A830041P22Rik
Downstream gene	BC028440, Tgfb1, Ccdc97, Hnrpul1, Axl, LOC667950, Cyp2s1, LOC100043732, EG623475, Cyp2b10, LOC232993, EG667957, BC026762, Cyp2b13, EG668047, LOC623532, Cyp2b9, LOC667968, Cyp2a4, Nlrp9c, LOC100043195, Nlrp4a, Nlrp9a, V1re12, EG243881
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm1096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381959 MGI:2685942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	BC049730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232972 MGI:2681843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG210155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210155 MGI:3643098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68891 MGI:1916141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26366 MGI:1347248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545936 MGI:3645761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 745 ESTs, 1 Protein

name	Lypd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232973 MGI:2687054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmrtc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71241 MGI:1918491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20085 MGI:1333780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd79a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12518 MGI:101774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16801 MGI:1353510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232974 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232974 MGI:3642958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Rabac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14470 MGI:1201692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp1a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232975 MGI:88107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grik5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14809 MGI:95818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232976 MGI:2442951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pou2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18987 MGI:101897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dedd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67379 MGI:1914629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp526 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210172 MGI:2445181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsk3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:606496 MGI:2152453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130221H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77124 MGI:1924374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13875 MGI:109637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18476 MGI:108414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins

name	Cnfn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lipe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC024561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434148 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins pseudo : _no_value

name	Ceacam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Ceacam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26367 MGI:1347246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	EG632778 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632778 MGI:3646269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310004L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66349 MGI:1913599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bckdha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12039 MGI:107701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27998 MGI:107889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830041P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320208 MGI:2443589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232987 MGI:2387643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21803 MGI:98725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52132 MGI:1196455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpul1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232989 MGI:2443517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Axl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26362 MGI:1347244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 2 Proteins pseudo : _no_value

name	Cyp2s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74134 MGI:1921384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 708 ESTs, 6 Proteins

name	EG623475 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623475 MGI:3648424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins

name	Cyp2b10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13088 MGI:88598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC232993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG667957 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667957 MGI:3643081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	BC026762 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236428 MGI:2652842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	Cyp2b13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13089 MGI:88599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668047 MGI:3645710
definition	note : predicted gene, EG668047 pseudo : _no_value

name	LOC623532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Cyp2b9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Cyp2a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nlrp4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233001 MGI:2675292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	V1re12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1096 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380029 GeneID:381959 MGI:2685942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : gene model 1096, (NCBI) transcript_id : XM_992620.1

name	BC049730 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59933291 GeneID:232972 MGI:2681843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049730 transcript_id : NM_199150.1

name	EG210155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559427 GeneID:210155 MGI:3643098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG210155 transcript_id : NM_177593.1

name	Cd177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328435 GeneID:68891 MGI:1916141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD177 antigen transcript_id : NM_026862.3

name	Ceacam10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352593 GeneID:26366 MGI:1347248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 10 transcript_id : NM_007675.3

name	LOC100043712 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256655 GeneID:100043712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 745 ESTs, 1 Protein product : similar to thymosin, beta 10 transcript_id : XM_001480801.1

name	Lypd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802293 GeneID:232973 MGI:2687054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 4 transcript_id : NM_182785.2

name	Dmrtc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532960 GeneID:71241 MGI:1918491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : doublesex and mab-3 related transcription factor like family C2 transcript_id : NM_027732.1

name	Rps19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963510 GeneID:20085 MGI:1333780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S19 transcript_id : NM_023133.1

name	Cd79a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386539 GeneID:12518 MGI:101774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD79A antigen (immunoglobulin-associated alpha) transcript_id : NM_007655.3

name	Arhgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678667 GeneID:16801 MGI:1353510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_008488.1

name	EG232974 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256454 GeneID:232974 MGI:3642958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG232974 transcript_id : XM_992867.2

name	Rabac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676377 GeneID:14470 MGI:1201692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab acceptor 1 (prenylated) transcript_id : NM_010261.2

name	Atp1a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450320 GeneID:232975 MGI:88107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, alpha 3 polypeptide transcript_id : NM_144921.1

name	Grik5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680092 GeneID:14809 MGI:95818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 5 (gamma 2) transcript_id : NM_008168.1

name	Zfp574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363109 GeneID:232976 MGI:2442951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 574 transcript_id : NM_175477.3

name	Pou2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755131 GeneID:18987 MGI:101897
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 2 transcript_id : NM_011138.1

name	Dedd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299735 GeneID:67379 MGI:1914629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death effector domain-containing DNA binding protein 2 transcript_id : NM_207677.3

name	Zfp526 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802142 GeneID:210172 MGI:2445181
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 526 transcript_id : NM_175436.3

name	Gsk3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384360 GeneID:606496 MGI:2152453
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase kinase 3 alpha transcript_id : NM_001031667.1

name	9130221H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341578 GeneID:77124 MGI:1924374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130221H12 gene transcript_id : NM_178400.2

name	Erf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254587 GeneID:13875 MGI:109637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ets2 repressor factor transcript_id : NM_010155.2

name	Cic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475687 GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capicua homolog (Drosophila) transcript_id : NM_027882.2

name	Pafah1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679200 GeneID:18476 MGI:108414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit transcript_id : NM_008776.1

name	EG623131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486844 GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG623131 transcript_id : NM_001081294.1

name	Tmem145 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637852 GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 145 transcript_id : NM_183311.2

name	Megf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256457 GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins product : multiple EGF-like-domains 8 transcript_id : XM_194337.7

name	Cnfn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487008 GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornifelin transcript_id : NM_001081375.1

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239969 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_010719.5

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239971 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_001039507.1

name	BC024561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891726 GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024561 transcript_id : NM_153576.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719312 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039187.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719302 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_011926.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719300 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039186.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719298 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039185.1

name	Ceacam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802842 GeneID:26367 MGI:1347246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 2 transcript_id : NM_007543.3

name	EG632778 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381235 GeneID:632778 MGI:3646269
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG632778 transcript_id : NM_001039243.2

name	2310004L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377182 GeneID:66349 MGI:1913599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310004L02 gene transcript_id : NM_025504.3

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087056 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_146184.4

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087052 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_001036740.2

name	Bckdha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389002 GeneID:12039 MGI:107701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain ketoacid dehydrogenase E1, alpha polypeptide transcript_id : NM_007533.3

name	Exosc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343823 GeneID:27998 MGI:107889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 5 transcript_id : NM_138586.2

name	A830041P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378229 GeneID:320208 MGI:2443589
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830041P22 gene transcript_id : NM_177102.3

name	BC028440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024310 GeneID:232987 MGI:2387643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC028440 transcript_id : NM_172148.1

name	Tgfb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755774 GeneID:21803 MGI:98725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta 1 transcript_id : NM_011577.1

name	Ccdc97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373814 GeneID:52132 MGI:1196455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 97 transcript_id : NM_028771.2

name	Hnrpul1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801559 GeneID:232989 MGI:2443517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 1 transcript_id : NM_144922.2

name	Hnrpul1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342548 GeneID:232989 MGI:2443517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 1 transcript_id : NM_178089.2

name	Axl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892528 GeneID:26362 MGI:1347244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AXL receptor tyrosine kinase transcript_id : NM_009465.3

name	Cyp2s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892669 GeneID:74134 MGI:1921384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily s, polypeptide 1 transcript_id : NM_028775.3

name	LOC100043732 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256659 GeneID:100043732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 708 ESTs, 6 Proteins product : similar to ribosomal protein L37a transcript_id : XM_001480907.1

name	EG623475 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256460 GeneID:623475 MGI:3648424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins product : predicted gene, EG623475 transcript_id : XM_887930.3

name	Cyp2b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129803 GeneID:13088 MGI:88598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 10 transcript_id : NM_009999.3

name	Cyp2b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77416369 GeneID:13088 MGI:88598
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 10 transcript_id : NM_009998.4

name	BC026762 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256661 GeneID:236428 MGI:2652842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : cDNA sequence BC026762 transcript_id : XM_001480912.1

name	Cyp2b13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681104 GeneID:13089 MGI:88599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 13 transcript_id : NM_007813.1

name	Cyp2b9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129801 GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 9 transcript_id : NM_010000.2

name	Cyp2a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268117 GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 4 transcript_id : NM_009997.2

name	Nlrp9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815823 GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9C transcript_id : NM_001042612.1

name	Nlrp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803250 GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4A transcript_id : NM_172896.2

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299742 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048219.1

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299751 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048220.1

name	V1re12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717778 GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E12 transcript_id : NM_134231.1

name	EG243881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487254 GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG243881 transcript_id : NM_001081148.1

name	Gm1096 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380030 GeneID:381959 MGI:2685942
definition	codon_start : 1 product : similar to CDNA sequence BC049730 protein_id : XP_997714.1

name	BC049730 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59933292 CCDS:CCDS20960.1 GeneID:232972 MGI:2681843
definition	codon_start : 1 product : hypothetical protein LOC232972 protein_id : NP_954601.1

name	EG210155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559428 GeneID:210155 MGI:3643098
definition	codon_start : 1 product : hypothetical protein LOC210155 protein_id : NP_808261.1

name	Cd177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328436 CCDS:CCDS20962.1 GeneID:68891 MGI:1916141
definition	codon_start : 1 product : CD177 antigen protein_id : NP_081138.2

name	Ceacam10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982465 GeneID:26366 MGI:1347248
definition	codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 10 product : CEA-related cell adhesion molecule 10 protein_id : NP_031701.2

name	LOC100043712 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256656 GeneID:100043712
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_001480851.1

name	Lypd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33354251 CCDS:CCDS20964.1 GeneID:232973 MGI:2687054
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : Ly6/Plaur domain containing 4 protein_id : NP_877586.1

name	Dmrtc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532961 CCDS:CCDS20965.1 GeneID:71241 MGI:1918491
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007548 - sex differentiation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : doublesex and mab-3 related transcription factor 7 protein_id : NP_082008.1

name	Rps19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963511 CCDS:CCDS20966.1 GeneID:20085 MGI:1333780
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence ISS]; GO:0007516 - hemocyte development (sensu Arthropoda) [Evidence ISS]; GO:0051272 - positive regulation of cell motility [Evidence ISS]; GO:0009991 - response to extracellular stimulus [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S19 protein_id : NP_075622.1

name	Cd79a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677429 CCDS:CCDS20967.1 GeneID:12518 MGI:101774
definition	GO_component : GO:0019815 - B cell receptor complex [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0050853 - B cell receptor signaling pathway [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : Ig alpha; immunoglobulin-associated alpha product : CD79A antigen (immunoglobulin-associated alpha) protein_id : NP_031681.2

name	Arhgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678668 GeneID:16801 MGI:1353510
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IEA] codon_start : 1 note : lymphoid blast crisis like 2 product : Rho guanine nucleotide exchange factor (GEF) 1 protein_id : NP_032514.1

name	EG232974 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256455 GeneID:232974 MGI:3642958
definition	codon_start : 1 product : similar to hCG2040171 protein_id : XP_997961.2

name	Rabac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859558 CCDS:CCDS20968.1 GeneID:14470 MGI:1201692
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : GTP binding protein associated protein 1 product : Rab acceptor 1 protein_id : NP_034391.1

name	Atp1a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450321 CCDS:CCDS20969.1 GeneID:232975 MGI:88107
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005890 - sodium:potassium-exchanging ATPase complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0008150 - biological_process [Evidence ND]; GO:0006812 - cation transport [Evidence IEA]; GO:0030641 - hydrogen ion homeostasis [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence ISS] [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] [Evidence ISS]; GO:0030317 - sperm motility [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Na+/K+ -ATPase alpha 3 subunit protein_id : NP_659170.1

name	Grik5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680093 CCDS:CCDS20970.1 GeneID:14809 MGI:95818
definition	GO_component : GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutamate receptor, ionotropic, kainate 5 (gamma 2) protein_id : NP_032194.1

name	Zfp574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425222 CCDS:CCDS20971.1 GeneID:232976 MGI:2442951
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 574 protein_id : NP_780686.1

name	Pou2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755132 GeneID:18987 MGI:101897
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0048305 - immunoglobulin secretion [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : POU domain, class 2, transcription factor 2 protein_id : NP_035268.1

name	Dedd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299736 CCDS:CCDS20973.1 GeneID:67379 MGI:1914629
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : death effector domain-containing DNA-binding protein 2 product : death effector domain-containing DNA binding protein 2 protein_id : NP_997560.3

name	Zfp526 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425158 CCDS:CCDS20975.1 GeneID:210172 MGI:2445181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 526 protein_id : NP_780645.1

name	Gsk3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384361 CCDS:CCDS20976.1 GeneID:606496 MGI:2152453
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 product : glycogen synthase kinase 3 alpha protein_id : NP_001026837.1

name	9130221H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409968 GeneID:77124 MGI:1924374
definition	codon_start : 1 product : hypothetical protein LOC77124 protein_id : NP_848487.1

name	Erf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254588 CCDS:CCDS20978.1 GeneID:13875 MGI:109637
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Est2 repressor factor product : Ets2 repressor factor protein_id : NP_034285.2

name	Cic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16507202 GeneID:71722 MGI:1918972
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : capicua homolog protein_id : NP_082158.1

name	Pafah1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679201 CCDS:CCDS20979.1 GeneID:18476 MGI:108414
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] [Evidence IGI] codon_start : 1 product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit protein_id : NP_032802.1

name	EG623131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486845 GeneID:623131 MGI:3648539
definition	codon_start : 1 product : predicted gene, EG623131 protein_id : NP_001074763.1

name	Tmem145 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119637853 GeneID:330485 MGI:3607779
definition	codon_start : 1 product : hypothetical protein LOC330485 protein_id : NP_899134.2

name	Megf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256458 GeneID:269878 MGI:2446294
definition	codon_start : 1 product : multiple EGF-like-domains 8 protein_id : XP_194337.7

name	Cnfn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487009 GeneID:72383 MGI:1919633
definition	GO_component : GO:0001533 - cornified envelope [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cornifelin protein_id : NP_001074844.1

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239970 CCDS:CCDS20981.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hormone-sensitive lipase product : lipase, hormone sensitive isoform 1 protein_id : NP_034849.2

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239972 CCDS:CCDS20982.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; hormone-sensitive lipase product : lipase, hormone sensitive isoform 2 protein_id : NP_001034596.1

name	BC024561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133891727 GeneID:232983 MGI:2387642
definition	codon_start : 1 note : 13.6-kDa protein product : VEGF co-regulated chemokine 1 protein_id : NP_705804.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719303 CCDS:CCDS20985.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 3 protein_id : NP_036056.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719299 CCDS:CCDS20984.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 protein_id : NP_001034274.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719313 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 4 protein_id : NP_001034276.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719301 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 2 protein_id : NP_001034275.1

name	Ceacam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671734 CCDS:CCDS20986.1 GeneID:26367 MGI:1347246
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : biliary glycoprotein 2 product : CEA-related cell adhesion molecule 2 protein_id : NP_031569.1

name	EG632778 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986651 CCDS:CCDS20987.1 GeneID:632778 MGI:3646269
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC632778 protein_id : NP_001034332.1

name	2310004L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560249 CCDS:CCDS20988.1 GeneID:66349 MGI:1913599
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66349 protein_id : NP_079780.2

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861482 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_001031817.1

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122729 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_666296.1

name	Bckdha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982494 GeneID:12039 MGI:107701
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003863 - 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity [Evidence IEA]; GO:0016536 - cyclin-dependent protein kinase 5 activator regulator activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : BCKAD E1[a] product : branched chain ketoacid dehydrogenase E1, alpha polypeptide protein_id : NP_031559.2

name	Exosc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070392 CCDS:CCDS20990.1 GeneID:27998 MGI:107889
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] codon_start : 1 product : exosome component 5 protein_id : NP_613052.1

name	A830041P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893037 GeneID:320208 MGI:2443589
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320208 protein_id : NP_796076.1

name	BC028440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024311 CCDS:CCDS20992.1 GeneID:232987 MGI:2387643
definition	codon_start : 1 product : hypothetical protein LOC232987 protein_id : NP_742160.1

name	Tgfb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755775 CCDS:CCDS20993.1 GeneID:21803 MGI:98725
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0005160 - transforming growth factor beta receptor binding [Evidence TAS] GO_process : GO:0008219 - cell death [Evidence IMP]; GO:0016049 - cell growth [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA] [Evidence TAS]; GO:0006952 - defense response [Evidence TAS]; GO:0008354 - germ cell migration [Evidence IDA]; GO:0040007 - growth [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0048535 - lymph node development [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence TAS]; GO:0030279 - negative regulation of ossification [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0048298 - positive regulation of isotype switching to IgA isotypes [Evidence ISS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0051098 - regulation of binding [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0051101 - regulation of DNA binding [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0042306 - regulation of protein import into nucleus [Evidence IDA]; GO:0016202 - regulation of striated muscle development [Evidence IDA]; GO:0001501 - skeletal development [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 note : TGF-beta 1; regulatory protein; transforming growth factor-beta 1 product : transforming growth factor, beta 1 protein_id : NP_035707.1

name	Ccdc97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311899 CCDS:CCDS20994.1 GeneID:52132 MGI:1196455
definition	codon_start : 1 product : coiled-coil domain containing 97 protein_id : NP_083047.1

name	Hnrpul1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450323 CCDS:CCDS20995.1 GeneID:232989 MGI:2443517
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; EIB-55kDa associated protein 5 product : EIB-55kDa associated protein 5 isoform 1 protein_id : NP_659171.1

name	Hnrpul1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017405 GeneID:232989 MGI:2443517
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; EIB-55kDa associated protein 5 product : EIB-55kDa associated protein 5 isoform 2 protein_id : NP_835190.1

name	Axl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542164 CCDS:CCDS20996.1 GeneID:26362 MGI:1347244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : ufo oncogene homolog product : AXL receptor tyrosine kinase protein_id : NP_033491.2

name	Cyp2s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311915 CCDS:CCDS20997.1 GeneID:74134 MGI:1921384
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2s1 product : cytochrome P450, family 2, subfamily s, polypeptide 1 protein_id : NP_083051.1

name	LOC100043732 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256660 GeneID:100043732
definition	codon_start : 1 product : similar to ribosomal protein L37a protein_id : XP_001480957.1

name	EG623475 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256461 GeneID:623475 MGI:3648424
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893023.3

name	Cyp2b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753576 GeneID:13088 MGI:88598
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; cytochrome P450, family 2, subfamily b, polypeptide 20; cytochrome P450, 2b20; cytochrome P450, 2b10, phenobarbitol inducible, type b product : cytochrome P450, family 2, subfamily b, polypeptide 10 isoform 1 protein_id : NP_034128.1

name	Cyp2b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080153 CCDS:CCDS20999.1 GeneID:13088 MGI:88598
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cytochrome P450, family 2, subfamily b, polypeptide 20; cytochrome P450, 2b20; cytochrome P450, 2b10, phenobarbitol inducible, type b product : cytochrome P450, family 2, subfamily b, polypeptide 10 isoform 2 protein_id : NP_034129.1

name	BC026762 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256662 GeneID:236428 MGI:2652842
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480962.1

name	Cyp2b13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681105 CCDS:CCDS21000.1 GeneID:13089 MGI:88599
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2b13, phenobarbitol inducible, type c; phenobarbital inducible, type c product : cytochrome P450, family 2, subfamily b, polypeptide 13 protein_id : NP_031839.1

name	Cyp2b9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753578 CCDS:CCDS21001.1 GeneID:13094 MGI:88600
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2b9, phenobarbitol inducible, type a; 16alphaoh-a product : cytochrome P450, family 2, subfamily b, polypeptide 9 protein_id : NP_034130.1

name	Cyp2a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268118 CCDS:CCDS21002.1 GeneID:13086 MGI:88596
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a4; testosterone 15alpha-hydroxylase product : cytochrome P450, family 2, subfamily a, polypeptide 4 protein_id : NP_034127.2

name	Nlrp9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815824 GeneID:330490 MGI:3028627
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : NACHT, LRR and PYD containing protein 9c protein_id : NP_001036077.1

name	Nlrp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370372 CCDS:CCDS21003.1 GeneID:243880 MGI:2443697
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NACHT/LRR/pyrin domain-containing protein 4 product : NACHT, leucine rich repeat and PYD containing 4A protein_id : NP_766484.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299743 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 1 protein_id : NP_001041684.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299752 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 2 protein_id : NP_001041685.1

name	V1re12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717779 CCDS:CCDS21005.1 GeneID:171265 MGI:2159634
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E12 protein_id : NP_598992.1

name	EG243881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487255 GeneID:243881 MGI:3646735
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243881 protein_id : NP_001074617.1

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 1 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 2 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 3 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 4 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 5 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 6 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 7 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 8 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 9 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 8 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 7 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 6 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 5 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 4 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 3 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 2 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 1 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 10 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 9 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 8 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 7 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 6 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 5 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 4 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 3 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 2 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 1 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 3 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 2 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 1 pseudo : _no_value

name	EG545936 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256654 GeneID:545936 MGI:3645761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG545936 transcript_id : XR_035466.1

name	LOC434148 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256657 GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins product : similar to GrpE-like 2, mitochondrial pseudo : _no_value transcript_id : XR_034878.1

name	LOC100043722 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256658 GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_034880.1

name	LOC667950 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256459 GeneID:667950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 2 Proteins product : similar to chondroitin sulfate proteoglycan 6 (bamacan) pseudo : _no_value transcript_id : XR_034331.1

name	LOC667968 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256463 GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ubiquitin specific peptidase 12 pseudo : _no_value transcript_id : XR_034342.1

clone name	MSMg01-519E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-322A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-170L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-419A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306J03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406C03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-544H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-157I13.b	B6Ng01-157I13.g
ACC	DH951742	DH951743
length	1,286	1,114
definition	DH951742\|Mus musculus domesticus DNA, BAC clone: B6Ng01-157I13, 5' end.	DH951743\|Mus musculus domesticus DNA, BAC clone: B6Ng01-157I13, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttatgcagatggaagattatatcttataatagatatttttagca cacagagtaaaatattaaaagtctatataagtaagacttctgaataaatt ctaaaaggaagaaatgagatatcagttagctggaatggatccagctgaga ttgtagtaccttttactaatgctgaaattgtctcattgtgggcagaaaat gaacattggcaaagagcttacagtaattcttttggagaaactaacaaata tacaaaaaagcaagtgacctcagtttataagaagaaataatcatattctc cctcatataataaaagggacaccaatttctggagtaccttcattttatac tcgtgcaaataaatcgggaaaggcaggatatacgccaacaagtataagag attgcgagtccctagaattcagttcaaaaatcaaagctgtgtgccattat tgtggtattatgagactcttgatatgcagaaagagttgttttgcatatag aaactgctaaacttattcaagatgattccaaattaaaatcaatgtttatt caactacaacaaatgatcaaaccagaaatcatctcttgtatataacagat atcaaataccatgtggatctaccaggtcttctagaacaagataatgatga aattgatcagctattgataggaagtatactagaggcttcaaatttttatt taaaaacaccatgttaacagcaaaggtttataaaaattttttttctatca catggcaagaagccaagaaaattgaaaagaaatgtcctacttgtccttta tataaccaaactctattacctgcaggaaatatctctataagtgccccaaa aatgacatttggcaaatggatgtgtttcattgtgcagagtttggtaaact gaaatgtgtgcatcatactataaacacatatttaggatttcagtgagcaa ctgctttaagttctgcaaaggccaattctttcattacaaatttattagaa gttatggcaattgtggggactacctagacaatagactgacaaccctcctt ccagcatatgtcaatagtaaataagacattttgcaaatatataaaaaacg tttacagctttacatccagggctaaggaatgacggttatggagagattca attatctttaaaagtgcttagaaacagaagggcatcagttctggaataga ttacgtaggctctgacctaatttgagtgggcatcattaacaccgctcgtg agactgtggattaacagagcacgcgctgctgatcta	gaattcactaggagggtaaggatgatgggtgttactgagctcagtggtct gatggaaaaatgaggctagttaggagttcataccctcatccgtgagtccg aaaggagggccttctttgtgccatgcacttttttttcaggcccgaggcac atccctgaacaaaagagactaaatcccagccccagtggagctggtgttga tgggagcaggcaggagcggcatgcaaacggaagcgggtagcagtttttta acgtggcgtaaaagacaaatagagcaagaggaaggagctagtaaatacct tctggtgaaaaccatcctggcccttgcccctggcgttatccctcccgtgg gtctctgtgccagacactcagactgagccaagcatgctcccagacgccat ctgctctctccgggagtggggccggtgccagcttgagtgtttggactctt ggcaaagttccctggcaccctagagctagggaactccacggcctcacatc gggaatcctcctgtctagccagatggagggcggcaggaaagggaggcagt gcaaactgggtgggcttcctgaaggaggggatgtcttggagggccaggag cgttcttcagttgaacggacacgtattataaatcataaaattgataaaca cattacatgtgttcactgcgcttactttgccagactttgggtaaatgtgt gggcatttgttgtcacatctaagttaaaatccatatgtcgggctgtggaa atgactcagaggaaaggggggcttgctgctaatcctgataatctatgttg gatcccaggaacatatctggtggaagaaaagaaccaactcctacaattca tccactgacttctacacatgcttgctctacatagcatgtgtgcaccacac aaagaataatgtatataaaattttttgttttgttttggagacagggtttc tctgtgtagccctggctgtctggaactcactttgtagacaggctgactca actcagaaatcggcttgcctctgctccgagtgctgggataaaggcgtgtg ccacccaactcggcataaaaatgtttaatgtatacattagaagaatggcc atgtcccgagtttc
quality values	Open. Hide. 61 47 23 27 61 61 61 61 50 43 47 61 36 61 61 38 61 61 61 61 61 59 22 61 59 59 59 31 38 27 27 25 31 26 26 37 37 59 61 61 61 59 61 59 55 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 43 55 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 59 59 61 61 61 61 61 59 59 61 61 61 61 61 55 37 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 59 59 59 59 61 61 61 55 61 61 61 61 61 61 61 61 59 55 59 61 59 59 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 59 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 55 61 61 61 59 59 59 61 61 59 59 59 59 61 61 61 61 59 61 59 61 59 61 59 59 61 61 59 61 61 61 61 59 59 59 59 59 59 61 61 55 55 61 61 61 61 61 61 61 61 55 61 55 61 52 55 61 55 61 61 52 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 52 52 36 43 52 52 55 61 61 61 61 55 55 52 55 61 61 55 61 61 55 55 55 55 55 55 61 55 55 61 61 55 61 55 61 55 55 50 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 55 55 55 55 55 61 61 61 55 55 61 55 55 50 61 61 61 61 61 61 61 61 61 61 61 53 53 61 53 50 53 61 61 61 61 53 53 50 50 50 61 53 53 50 53 50 50 50 50 61 61 61 61 43 61 53 61 43 61 61 39 47 50 37 34 50 61 61 61 61 61 61 61 61 61 46 61 61 61 61 61 61 61 61 61 52 40 47 45 47 43 47 34 45 52 45 50 61 61 61 61 53 52 45 47 47 47 47 43 38 57 57 57 57 50 53 57 50 57 52 57 53 57 45 53 53 53 52 43 46 47 47 42 53 52 52 47 47 39 47 47 42 47 39 43 45 53 57 57 53 57 53 47 50 50 45 47 28 38 40 47 53 50 57 53 50 53 53 45 57 53 47 50 53 53 53 45 45 57 50 57 47 30 53 57 47 43 32 57 57 41 38 47 47 47 57 53 50 36 52 57 32 33 53 53 53 53 57 50 50 42 45 45 46 53 52 45 39 27 43 37 57 42 37 20 42 46 38 57 57 57 53 31 31 57 53 42 57 35 43 45 45 30 33 34 32 37 57 47 38 32 50 47 38 38 52 33 39 46 23 38 18 57 38 42 42 35 57 57 57 32 35 57 52 57 57 57 57 40 35 35 30 42 36 33 40 36 40 52 52 34 28 41 37 39 38 24 22 21 14 37 32 52 41 33 22 12 44 41 40 57 57 44 29 44 57 36 26 32 24 24 30 29 40 35 31 35 40 19 19 33 34 57 40 37 27 27 37 25 37 21 30 25 36 31 29 47 30 29 30 27 30 30 25 30 30 31 27 19 20 14 40 46 32 20 27 28 29 31 30 29 28 29 32 29 28 33 34 24 25 19 21 15 30 45 45 23 28 28 29 15 17 32 46 29 29 31 23 29 45 31 27 43 38 14 15 29 23 29 20 46 20 27 15 29 30 29 26 35 31 34 20 29 23 26 51 32 34 43 29 28 46 25 23 28 29 27 51 17 23 29 13 29 15 26 20 17 29 26 23 28 29 33 25 28 22 21 29 26 15 12 18 13 25 25 31 51 28 22 23 21 24 11 44 10 20 26 23 21 28 34 21 23 18 22 18 21 29 22 28 51 22 19 19 16 33 10 12 19 19 12 27 51 14 27 27 11 15 19 22 28 22 18 30 51 18 21 11 26 31 22 20 6 36 19 10 44 18 16 18 28 15 6 14 33 22 30 9 18 20 17 26 25 30 19 33 12 13 8 13 35 38 7 11 10 9 6 13 23 25 28 12 8 9 27 24 10 8 4 14 18 13 23 18 17 9 6 6 6 8 16 9 30 9 9 8 11 6 8 30 18 13 22 11 7 6 19 15 5 5 6 5 5 16 33 22 5 5 3 1 4 8 16 18 31 27 23 11 20 7 4 3 6 8 8 9 5 5 5 4 20 36 12 9 14 4 4 7 7 14 5 6 5 25 25 25 7 13 4 3 3 12 4 13 22 6 24 10 4 3 3 6 17 7 4 4 5 7 4 6 10 6 6 21 8 11 4 4 6 4 10 8 9 20 6 6 6 4 5 6 9 8 9 4 4 15 16 10 3 4 5 8 10 21 10 6 7 14 13 12 12 5 7 10 6 12 10 3 1 4 4 1 2 3 3 10 13 10 4 16 4 4 4 6 18 5 10 10 6 7 4 5 15 4 11 7 5 15 5 4 4 4 7 3 4 4 4 9 1 3 8 3 1 1 20 4 6 5 5 7 4 4 19 17 4 7 3 8 5 3 8 19 6 4 3 5 3 12 2 1 3 2 1 3 3 27 12 1 18 9 4 13 13 4 19 4 8 4 7 4 4 4 6 5 16 8 11 3 3 6 12	Open. Hide. 55 30 61 59 61 28 19 23 28 13 13 25 24 19 28 28 43 52 59 52 61 59 59 59 59 59 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 55 55 55 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 59 59 61 59 61 59 61 61 61 61 61 61 59 61 61 59 61 59 59 61 61 61 61 61 59 61 59 59 59 61 59 52 44 59 59 61 61 61 59 59 59 59 59 43 37 59 59 59 59 52 61 59 59 59 52 59 49 61 44 55 59 59 61 61 59 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 59 59 59 61 61 61 61 61 59 59 59 59 59 59 59 59 61 61 61 61 61 61 59 59 61 59 59 61 61 59 61 61 59 52 55 55 55 55 61 55 55 55 55 55 61 61 61 61 61 61 55 55 61 61 61 55 61 61 61 55 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 55 52 55 55 55 55 52 61 61 61 61 61 52 55 61 55 55 61 61 55 61 61 61 55 55 55 55 50 50 61 55 49 55 61 50 55 61 61 61 61 61 61 61 55 55 55 55 50 61 61 61 61 61 61 55 55 61 55 61 55 61 55 61 55 61 50 50 55 55 55 61 61 61 61 61 61 61 61 50 50 53 50 50 50 61 61 61 61 50 61 61 61 61 50 50 50 50 50 50 50 53 50 43 47 50 50 52 50 40 61 52 50 53 52 53 61 50 53 61 47 50 50 47 38 50 35 47 39 50 50 50 42 52 45 53 53 52 53 61 61 47 45 47 42 45 43 34 42 53 61 50 53 50 45 47 47 40 45 61 61 61 61 61 47 61 61 61 61 61 47 47 47 57 57 47 47 47 57 57 53 43 47 47 46 52 53 57 53 32 32 45 43 50 53 57 57 53 53 47 47 50 47 27 33 42 33 42 57 53 38 57 47 19 47 57 47 37 30 57 53 50 57 47 47 47 52 35 53 47 26 50 42 33 38 52 30 35 40 45 53 50 47 41 38 37 42 53 57 52 52 53 43 50 53 37 37 38 47 35 45 45 41 45 50 43 45 57 53 43 37 39 47 47 57 57 50 43 46 53 38 31 46 43 44 50 37 50 30 53 50 45 50 34 52 53 50 53 53 29 37 31 47 53 53 50 40 52 41 34 30 37 46 38 39 39 37 47 30 32 34 16 38 50 50 47 46 37 28 35 43 53 37 53 29 40 30 53 42 39 36 23 40 41 34 34 37 53 53 28 28 24 36 24 42 36 37 29 34 28 39 52 31 57 57 37 33 20 29 29 43 35 39 40 35 37 42 53 39 26 40 40 33 30 22 25 57 30 31 40 33 24 37 23 19 7 21 11 17 41 53 30 31 57 57 53 45 44 23 26 28 40 35 36 39 28 30 15 44 30 23 30 30 30 33 25 34 27 30 32 28 30 30 48 30 31 30 23 29 27 14 30 30 30 17 11 15 24 30 14 30 24 35 24 27 29 46 28 29 23 17 32 18 44 51 46 27 14 48 29 20 20 17 22 29 29 24 34 29 32 28 34 29 27 30 26 23 28 23 32 21 24 28 41 28 28 28 33 19 21 28 29 17 23 17 28 31 31 20 29 38 29 27 28 28 24 29 16 21 28 26 28 28 29 41 23 35 28 29 31 21 29 24 14 22 23 20 29 44 36 17 27 10 13 34 36 27 31 14 32 17 29 24 32 51 44 25 26 51 51 51 51 25 12 20 51 38 34 28 26 42 38 26 27 12 23 13 28 13 14 26 38 18 25 51 19 11 8 6 8 19 10 28 14 27 19 19 25 11 27 20 21 9 19 21 22 30 18 15 23 23 20 18 27 23 14 13 20 35 16 16 14 27 5 6 19 7 9 18 11 12 8 4 6 10 17 21 25 18 31 12 6 6 19 42 23 20 29 6 5 19 10 12 13 14 15 13 17 5 5 15 6 11 21 5 15 7 8 15 18 14 14 34 7 10 7 4 27 8 4 4 6 10 8 14 5 7 17 5 4 8 16 10 4 4 3 4 6 4 16 5 4 5 23 26 30 35 18 4 6 4 26 24 8 8 27 10 5 3 5 9 26 11 5 4 4 17 7 16 12 8 9 10 6 20 4 5 5 5 5 7 6 25 13 4 3 5 13 16 8 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_26460899_26462035
seq2: B6Ng01-157I13.g_68_1181 (reverse)

seq1  GAAACTCGGGACATATGCCCATCCTCCTAGATGTGATAACAATTAAACAT  50
      ||||||||||||  ||| |||| || ||| |||| |||   |||||||| 
seq2  GAAACTCGGGAC--ATGGCCATTCTTCTA-ATGT-ATA--CATTAAACA-  43

seq1  TTTTTTATGCCGAGTGTGGTGGCACACGCCTTTAATCCCAGCACTCGGGA  100
       ||||||||||||||  |||||||||||||||| ||||||||||||||  
seq2  -TTTTTATGCCGAGTTGGGTGGCACACGCCTTT-ATCCCAGCACTCGG--  89

seq1  GGCAGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAAGT  150
       ||||||||| || |||||||||| |||| | |||||| |||||||||||
seq2  AGCAGAGGCAAGCCGATTTCTGAG-TTGA-GTCAGCCT-GTCTACAAAGT  136

seq1  GAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCCAAAAACA  200
      |||||||| ||||||||||||||||||||||||||||||||||||||   
seq2  GAGTTCCA-GACAGCCAGGGCTACACAGAGAAACCCTGTCTCCAAAA--C  183

seq1  AAAACAAAAAAATTTTTATATTACATTTATTTCTTTTGTGTGGTGCACAC  250
      |||||||||||  ||||||| |||| |||||   ||||||||||||||||
seq2  AAAACAAAAAA--TTTTATA-TACA-TTATT--CTTTGTGTGGTGCACAC  227

seq1  ATGCTATGTAGAGCAAGCATGTGTAGAAGTCAGTGGATGAATTGTAGGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTATGTAGAGCAAGCATGTGTAGAAGTCAGTGGATGAATTGTAGGAG  277

seq1  TTGGTTCTTTTCTTCCACCAGATATGTTCCTGGGATCCAACATAGATTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTCTTTTCTTCCACCAGATATGTTCCTGGGATCCAACATAGATTAT  327

seq1  CAGGATTAGCAGCAAGCCCCCCTTTCCTCTGAGTCATTTCCACAGCCCGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGATTAGCAGCAAGCCCCCCTTTCCTCTGAGTCATTTCCACAGCCCGA  377

seq1  CATATGGATTTTAACTTAGATGTGACAACAAATGCCCACACATTTACCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATGGATTTTAACTTAGATGTGACAACAAATGCCCACACATTTACCCA  427

seq1  AAGTCTGGCAAAGTAAGCGCAGTGAACACATGTAATGTGTTTATCAATTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTGGCAAAGTAAGCGCAGTGAACACATGTAATGTGTTTATCAATTT  477

seq1  TATGATTTATAATACGTGTCCGTTCAACTGAAGAACGCTCCTGGCCCTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGATTTATAATACGTGTCCGTTCAACTGAAGAACGCTCCTGGCCCTCC  527

seq1  AAGACATCCCCTCCTTCAGGAAGCCCACCCAGTTTGCACTGCCTCCCTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACATCCCCTCCTTCAGGAAGCCCACCCAGTTTGCACTGCCTCCCTTT  577

seq1  CCTGCCGCCCTCCATCTGGCTAGACAGGAGGATTCCCGATGTGAGGCCGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCGCCCTCCATCTGGCTAGACAGGAGGATTCCCGATGTGAGGCCGT  627

seq1  GGAGTTCCCTAGCTCTAGGGTGCCAGGGAACTTTGCCAAGAGTCCAAACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTTCCCTAGCTCTAGGGTGCCAGGGAACTTTGCCAAGAGTCCAAACA  677

seq1  CTCAAGCTGGCACCGGCCCCACTCCCGGAGAGAGCAGATGGCGTCTGGGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAGCTGGCACCGGCCCCACTCCCGGAGAGAGCAGATGGCGTCTGGGA  727

seq1  GCATGCTTGGCTCAGTCTGAGTGTCTGGCACAGAGACCCACGGGAGGGAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCTTGGCTCAGTCTGAGTGTCTGGCACAGAGACCCACGGGAGGGAT  777

seq1  AACGCCAGGGGCAAGGGCCAGGATGGTTTTCACCAGAAGGTATTTACTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGCCAGGGGCAAGGGCCAGGATGGTTTTCACCAGAAGGTATTTACTAG  827

seq1  CTCCTTCCTCTTGCTCTATTTGTCTTTTACGCCACGTTAAAAAACTGCTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTCCTCTTGCTCTATTTGTCTTTTACGCCACGTTAAAAAACTGCTA  877

seq1  CCCGCTTCCGTTTGCATGCCGCTCCTGCCTGCTCCCATCAACACCAGCTC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGCTTCCGTTTGCATGCCGCTCCTGCCTGCTCCCATCAACACCAGCTC  927

seq1  CACTGGGGCTGGGATTTAGTCTCTTTTGTTCAGGGATGTGCCTCGGGCCT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGGGCTGGGATTTAGTCTCTTTTGTTCAGGGATGTGCCTCGGGCCT  977

seq1  GAAAAAAAAGTGCATGGCACAAAGAAGGCCCTCCTTTCGGACTCACGGAT  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAAAAAGTGCATGGCACAAAGAAGGCCCTCCTTTCGGACTCACGGAT  1027

seq1  GAGGGTATGAACTCCTAACTAGCCTCATTTTTCCATCAGACCACTGAGCT  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGTATGAACTCCTAACTAGCCTCATTTTTCCATCAGACCACTGAGCT  1077

seq1  CAGTAACACCCATCATCCTTACCCTCCTAGTGAATTC  1137
      |||||||||||||||||||||||||||||||||||||
seq2  CAGTAACACCCATCATCCTTACCCTCCTAGTGAATTC  1114

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information