MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-158F24
Chromosome	7 (Build37)
Map Location	50,330,954 - 50,332,023
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG434175, LOC100039556, EG637898, Gprc2a-rs2, LOC434177, Vmn2r-ps60, 4933421I07Rik, LOC628503, BC063263, LOC100039449, EG637776, C330019L16Rik, EG434179, EG546965, LOC546964, LOC100039706, EG637572, LOC100039507, EG435975, LOC668606, EG668668, LOC100039543, LOC668612
Downstream gene	LOC385199, LOC100039589, EG668620, Zfp715, Siglecf, Siglecg, LOC100039610, Lim2, Nkg7, Cldnd2, Etfb, 2210412E05Rik, A230106M20Rik, 4931406B18Rik, LOC668630, LOC100039946, Cd33, BC043301, Zfp719, 4933405K07Rik, Ceacam18, Siglece, Atpbd3, Klk14, Klk13, Klk12, Klk11, Klk10, Klk9, Klk8, Klk7, Klk6, Klk5, Klk4, Klk2-ps, Klk15, Klk1b7-ps, Klk1b8, Klk1b1, Klk1b9, Klk1b10-ps, Klk1b11, LOC100039713, Klk1b26, Klk1b18-ps, Klk1b27, Klk1b14-ps
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG434175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 274 ESTs, 42 Proteins

name	LOC100039556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins pseudo : _no_value

name	EG637898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins

name	Gprc2a-rs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	LOC434177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins

name	4933421I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins pseudo : _no_value

name	BC063263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins

name	LOC100039449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG637776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	C330019L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208111 MGI:3036263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434179 MGI:3648690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546965 MGI:3644564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC546964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100039706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	EG637572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637572 MGI:3648273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100039507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	EG435975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435975 MGI:3647107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC668606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668668 MGI:3648888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC668612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC385199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG668620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69930 MGI:1917180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglecf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233186 MGI:2681107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglecg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243958 MGI:2443630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233187 MGI:104698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72310 MGI:1931250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74276 MGI:1921526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110826 MGI:106098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210412E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75690 MGI:1922940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	A230106M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210094 MGI:2686277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 8 Proteins

name	4931406B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74054 MGI:1921304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668630 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cd33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12489 MGI:99440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043301 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210104 MGI:2652821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210105 MGI:2444708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 57 ESTs

name	4933405K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74400 MGI:1921650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72431 MGI:1919681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglece (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83382 MGI:1932475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpbd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233189 MGI:2385277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317653 MGI:2447564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626834 MGI:3615275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69511 MGI:1916761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 29 Proteins

name	Klk11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56538 MGI:1929977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69540 MGI:1916790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101533 MGI:1921082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259277 MGI:1343327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23993 MGI:1346336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19144 MGI:1343166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68668 MGI:1915918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56640 MGI:1861379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk2-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16603 MGI:892028
definition	gene_synonym : Gk25; Klk-ps10; mGk-25 note : kallikrein-related peptidase 2, pseudogene pseudo : _no_value

name	Klk15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317652 MGI:2447533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16604 MGI:892027
definition	gene_synonym : Klk-ps2; mGK-7 note : kallikrein 1-related peptidase b7, pseudogene pseudo : _no_value

name	Klk1b8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16624 MGI:892018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16623 MGI:892019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13648 MGI:95293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b10-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16605 MGI:892026
definition	gene_synonym : Klk-ps3; mGk-10 note : kallikrein 1-related peptidase b10, pseudogene pseudo : _no_value

name	Klk1b11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16613 MGI:892023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Klk1b26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16618 MGI:891981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b18-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16609 MGI:892024
definition	gene_synonym : Klk-ps7; mGK-18 note : kallikrein 1-related peptidase b18, pseudogene pseudo : _no_value

name	Klk1b27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16619 MGI:891980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b14-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16614 MGI:891983
definition	gene_synonym : Klk-ps11; Klk14; mGk-14 note : kallikrein 1-related peptidase b14, pseudogene pseudo : _no_value

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380406 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 41 Proteins product : predicted gene, EG434175, transcript variant 1 transcript_id : XM_485921.3

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257236 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 116 ESTs, 17 Proteins product : predicted gene, EG434175, transcript variant 2 transcript_id : XM_900988.3

name	EG637898 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257226 GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins product : predicted gene, EG637898 transcript_id : XM_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257228 GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 transcript_id : XM_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257230 GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins product : vomeronasal receptor Vmn2r-ps60 transcript_id : XM_893241.3

name	4933421I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803397 GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933421I07 gene transcript_id : NM_027702.2

name	BC063263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380409 GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins product : cDNA sequence BC063263, transcript variant 1 transcript_id : XM_485924.4

name	EG637776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257246 GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG637776 transcript_id : XM_913547.3

name	C330019L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803517 GeneID:208111 MGI:3036263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330019L16 gene transcript_id : NM_001034857.2

name	EG434179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606034 GeneID:434179 MGI:3648690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434179 transcript_id : NM_001008427.1

name	LOC546964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257231 GeneID:546964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to putative pheromone receptor transcript_id : XM_001472972.1

name	LOC100039706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257248 GeneID:100039706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : similar to Predicted gene, EG434179 transcript_id : XM_001472741.1

name	LOC100039507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257233 GeneID:100039507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001473023.1

name	EG435975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905334 GeneID:435975 MGI:3647107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG435975 transcript_id : XM_488033.3

name	EG668668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922661 GeneID:668668 MGI:3648888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668668 transcript_id : NM_001081036.2

name	LOC668612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257238 GeneID:668612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to putative pheromone receptor transcript_id : XM_001473135.1

name	EG668620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257184 GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668620 transcript_id : XM_001002654.2

name	Zfp715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173817 GeneID:69930 MGI:1917180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 715 transcript_id : NM_027264.3

name	Siglecf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704167 GeneID:233186 MGI:2681107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin F transcript_id : NM_145581.1

name	Siglecg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345055 GeneID:243958 MGI:2443630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin G transcript_id : NM_172900.2

name	LOC100039610 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257240 GeneID:100039610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039610 transcript_id : XM_001473186.1

name	Lim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370624 GeneID:233187 MGI:104698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lens intrinsic membrane protein 2 transcript_id : NM_177693.3

name	Nkg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892532 GeneID:72310 MGI:1931250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural killer cell group 7 sequence transcript_id : NM_024253.4

name	Cldnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508801 GeneID:74276 MGI:1921526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin domain containing 2 transcript_id : NM_028849.1

name	Etfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142459 GeneID:110826 MGI:106098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : electron transferring flavoprotein, beta polypeptide transcript_id : NM_026695.2

name	2210412E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257243 GeneID:75690 MGI:1922940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 2210412E05 gene transcript_id : XM_355890.5

name	A230106M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380396 GeneID:210094 MGI:2686277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 8 Proteins product : RIKEN cDNA A230106M20 gene transcript_id : XM_357746.5

name	4931406B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386082 GeneID:74054 MGI:1921304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406B18 gene transcript_id : NM_028737.3

name	LOC100039946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257254 GeneID:100039946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039946 transcript_id : XM_001473291.1

name	Cd33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946589 GeneID:12489 MGI:99440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD33 antigen transcript_id : NM_021293.1

name	BC043301 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711287 GeneID:210104 MGI:2652821
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC043301 transcript_id : NM_001008549.1

name	Zfp719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380432 GeneID:210105 MGI:2444708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 57 ESTs product : zinc finger protein 719, transcript variant 1 transcript_id : XM_145574.6

name	4933405K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354247 GeneID:74400 MGI:1921650
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933405K07 gene transcript_id : NM_028913.2

name	Ceacam18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037298 GeneID:72431 MGI:1919681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_028236.1

name	Siglece (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032001 GeneID:83382 MGI:1932475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin E transcript_id : NM_031181.2

name	Atpbd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704169 GeneID:233189 MGI:2385277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP binding domain 3 transcript_id : NM_145582.1

name	Klk14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469048 GeneID:317653 MGI:2447564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 14 transcript_id : NM_174866.1

name	Klk13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681721 GeneID:626834 MGI:3615275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 13 transcript_id : NM_001039042.2

name	Klk12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380399 GeneID:69511 MGI:1916761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 29 Proteins product : kallikrein related-peptidase 12 transcript_id : XM_893506.2

name	Klk11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910297 GeneID:56538 MGI:1929977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 11 transcript_id : NM_019974.1

name	Klk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130936 GeneID:69540 MGI:1916790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 10 transcript_id : NM_133712.2

name	Klk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801918 GeneID:101533 MGI:1921082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 9 transcript_id : NM_028660.2

name	Klk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893243 GeneID:259277 MGI:1343327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 8 transcript_id : NM_008940.2

name	Klk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981356 GeneID:23993 MGI:1346336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 7 (chymotryptic, stratum corneum) transcript_id : NM_011872.2

name	Klk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755179 GeneID:19144 MGI:1343166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 6 transcript_id : NM_011177.1

name	Klk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801926 GeneID:68668 MGI:1915918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 5 transcript_id : NM_026806.2

name	Klk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910515 GeneID:56640 MGI:1861379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 4 (prostase, enamel matrix, prostate) transcript_id : NM_019928.1

name	Klk15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469044 GeneID:317652 MGI:2447533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 15 transcript_id : NM_174865.1

name	Klk1b8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130782 GeneID:16624 MGI:892018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b8 transcript_id : NM_008457.2

name	Klk1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981660 GeneID:16623 MGI:892019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b1 transcript_id : NM_010645.2

name	Klk1b9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426850 GeneID:13648 MGI:95293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b9 transcript_id : NM_010116.1

name	Klk1b11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28875779 GeneID:16613 MGI:892023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b11 transcript_id : NM_010640.1

name	Klk1b26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754459 GeneID:16618 MGI:891981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related petidase b26 transcript_id : NM_010644.1

name	Klk1b27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802581 GeneID:16619 MGI:891980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b27 transcript_id : NM_020268.2

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905069 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 2 protein_id : XP_906081.1

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762951 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 1 protein_id : XP_485921.1

name	EG637898 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257227 GeneID:637898 MGI:3647050
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257229 GeneID:637873 MGI:1351347
definition	codon_start : 1 product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 protein_id : XP_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82905313 GeneID:628490
definition	codon_start : 1 product : similar to calcium-sensing receptor related protein 2 protein_id : XP_898334.1

name	4933421I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386252 GeneID:71162 MGI:1918412
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71162 protein_id : NP_081978.1

name	BC063263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762957 GeneID:434178 MGI:3584269
definition	codon_start : 1 product : similar to ZNF91L isoform 1 protein_id : XP_485924.1

name	EG637776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257247 GeneID:637776 MGI:3645327
definition	codon_start : 1 product : hypothetical protein protein_id : XP_918640.3

name	C330019L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702187 GeneID:208111 MGI:3036263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208111 protein_id : NP_001030029.1

name	EG434179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606035 GeneID:434179 MGI:3648690
definition	codon_start : 1 product : hypothetical protein LOC434179 protein_id : NP_001008427.1

name	LOC546964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257232 GeneID:546964
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001473022.1

name	LOC100039706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257249 GeneID:100039706
definition	codon_start : 1 product : similar to Predicted gene, EG434179 protein_id : XP_001472791.1

name	LOC100039507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257234 GeneID:100039507
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001473073.1

name	EG435975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905335 GeneID:435975 MGI:3647107
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_488033.3

name	EG668668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486640 GeneID:668668 MGI:3648888
definition	codon_start : 1 product : predicted gene, EG668668 protein_id : NP_001074505.1

name	LOC668612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257239 GeneID:668612
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001473185.1

name	EG668620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257185 GeneID:668620 MGI:3643075
definition	codon_start : 1 product : hypothetical protein LOC435970 protein_id : XP_001002654.2

name	Zfp715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173818 GeneID:69930 MGI:1917180
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 715 protein_id : NP_081540.3

name	Siglecf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704168 CCDS:CCDS21167.1 GeneID:233186 MGI:2681107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048029 - monosaccharide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : sialic acid-binding lectin Siglec-F product : sialic acid binding Ig-like lectin 5 protein_id : NP_663556.1

name	Siglecg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370378 GeneID:243958 MGI:2443630
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sialic acid binding Ig-like lectin 10 product : sialic acid binding Ig-like lectin G protein_id : NP_766488.1

name	LOC100039610 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257241 GeneID:100039610
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473236.1

name	Lim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244136 CCDS:CCDS21168.1 GeneID:233187 MGI:104698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence TAS] GO_function : GO:0005212 - structural constituent of eye lens [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0043010 - eye development (sensu Vertebrata) [Evidence IMP] codon_start : 1 note : total opacity 3 product : lens intrinsic membrane protein 2 protein_id : NP_808361.1

name	Nkg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980746 CCDS:CCDS21169.1 GeneID:72310 MGI:1931250
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : natural killer cell group 7 sequence protein_id : NP_077215.2

name	Cldnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508802 GeneID:74276 MGI:1921526
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : claudin domain containing 2 protein_id : NP_083125.1

name	Etfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142460 CCDS:CCDS21171.1 GeneID:110826 MGI:106098
definition	GO_component : GO:0017133 - electron transfer flavoprotein complex (sensu Eukaryota) [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence TAS] [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : electron transferring flavoprotein, beta polypeptide protein_id : NP_080971.2

name	2210412E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257244 GeneID:75690 MGI:1922940
definition	codon_start : 1 product : hypothetical protein LOC75690 protein_id : XP_355890.4

name	A230106M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905944 GeneID:210094 MGI:2686277
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357746.4

name	4931406B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541981 CCDS:CCDS21172.1 GeneID:74054 MGI:1921304
definition	codon_start : 1 product : hypothetical protein LOC74054 protein_id : NP_083013.2

name	LOC100039946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257255 GeneID:100039946
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473341.1

name	Cd33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946590 CCDS:CCDS21173.1 GeneID:12489 MGI:99440
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : CD33 antigen protein_id : NP_067268.1

name	BC043301 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56711288 GeneID:210104 MGI:2652821
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC210104 protein_id : NP_001008549.1

name	Zfp719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25050676 GeneID:210105 MGI:2444708
definition	codon_start : 1 product : zinc finger protein 719 isoform 1 protein_id : XP_145574.2

name	4933405K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312718 CCDS:CCDS21176.1 GeneID:74400 MGI:1921650
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74400 protein_id : NP_083189.1

name	Ceacam18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037299 CCDS:CCDS21177.1 GeneID:72431 MGI:1919681
definition	codon_start : 1 product : CEA-related cell adhesion molecule 1 protein_id : NP_082512.1

name	Siglece (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032002 CCDS:CCDS21178.1 GeneID:83382 MGI:1932475
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048029 - monosaccharide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005057 - receptor signaling protein activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 note : sialic acid-binding immunoglobulin-like lectin E; sialic acid binding Ig-like lectin 5 product : SIGLEC-like 1 protein_id : NP_112458.2

name	Atpbd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704170 CCDS:CCDS21179.1 GeneID:233189 MGI:2385277
definition	codon_start : 1 product : ATP binding domain 3 protein_id : NP_663557.1

name	Klk14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469049 CCDS:CCDS21180.1 GeneID:317653 MGI:2447564
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 14 protein_id : NP_777355.1

name	Klk13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681722 GeneID:626834 MGI:3615275
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : kallikrein 13 product : kallikrein 13 precursor protein_id : NP_001034131.2

name	Klk12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905950 GeneID:69511 MGI:1916761
definition	codon_start : 1 product : kallikrein 12 protein_id : XP_898599.1

name	Klk11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910298 GeneID:56538 MGI:1929977
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : hippostasin; kallikrein 11 product : protease, serine, 20 protein_id : NP_064358.1

name	Klk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526892 GeneID:69540 MGI:1916790
definition	codon_start : 1 product : kallikrein 10 protein_id : NP_598473.1

name	Klk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841069 GeneID:101533 MGI:1921082
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : kallikrein-like protein 3; kallikrein 9 product : kallikrein 9 homolog protein_id : NP_082936.1

name	Klk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679487 CCDS:CCDS21182.1 GeneID:259277 MGI:1343327
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence IMP] codon_start : 1 note : Brain Serine protease 1; neuropsin; protease, serine, 19 (neuropsin); kallikrein 8 product : protease, serine, 19 protein_id : NP_032966.1

name	Klk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777665 CCDS:CCDS21183.1 GeneID:23993 MGI:1346336
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : protease, serine, 6; thymopsin; kallikrein 7 (chymotryptic, stratum corneum) product : kallikrein 7 protein_id : NP_036002.1

name	Klk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755180 CCDS:CCDS21184.1 GeneID:19144 MGI:1343166
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0042982 - amyloid precursor protein metabolism [Evidence ISS]; GO:0007417 - central nervous system development [Evidence ISS]; GO:0030574 - collagen catabolism [Evidence ISS]; GO:0042445 - hormone metabolism [Evidence ISS]; GO:0042552 - myelination [Evidence ISS]; GO:0016540 - protein autoprocessing [Evidence ISS] codon_start : 1 note : protease, serine, 9; kallikrein 7; protease M; kallikrein 29; kallikrein 6 product : protease, serine, 18 protein_id : NP_035307.1

name	Klk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866015 CCDS:CCDS21185.1 GeneID:68668 MGI:1915918
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 5 protein_id : NP_081082.1

name	Klk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910516 CCDS:CCDS21186.1 GeneID:56640 MGI:1861379
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 function : degradation of the enamel matrix during enamel maturation note : protease, serine 17 (enamel matrix, prostate) product : kallikrein 4 (prostase, enamel matrix, prostate) protein_id : NP_064312.1

name	Klk15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469045 CCDS:CCDS21187.1 GeneID:317652 MGI:2447533
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 15 protein_id : NP_777354.1

name	Klk1b8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7705572 CCDS:CCDS21189.1 GeneID:16624 MGI:892018
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 8 protein_id : NP_032483.1

name	Klk1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659568 CCDS:CCDS21190.1 GeneID:16623 MGI:892019
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : tissue kallikrein product : kallikrein 1 protein_id : NP_034775.1

name	Klk1b9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426851 CCDS:CCDS21191.1 GeneID:13648 MGI:95293
definition	EC_number : 3.4.21.35 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : epidermal growth factor binding protein type C product : kallikrein 9 protein_id : NP_034246.1

name	Klk1b11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28875780 CCDS:CCDS21192.1 GeneID:16613 MGI:892023
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 11 protein_id : NP_034770.1

name	Klk1b26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754460 GeneID:16618 MGI:891981
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : EGF-BP type B; kallikrein 1-related petidase b25 product : kallikrein 26 protein_id : NP_034774.1

name	Klk1b27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12313877 CCDS:CCDS21194.1 GeneID:16619 MGI:891980
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 note : glandular kallikrein 27 product : kallikrein 27 protein_id : NP_064664.1

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 4 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 3 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 2 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 2 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 1 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 2 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 3 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 4 pseudo : _no_value

name	EG546965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546965
definition	number : 5 pseudo : _no_value

name	EG637572 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637572
definition	number : 1 pseudo : _no_value

name	EG637572 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637572
definition	number : 2 pseudo : _no_value

name	LOC668606 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668606
definition	number : 1 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 3 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 2 pseudo : _no_value

name	LOC100039543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039543
definition	number : 1 pseudo : _no_value

name	LOC385199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385199
definition	number : 1 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 1 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 2 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 3 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 4 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 5 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 6 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 1 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 2 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 3 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 4 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 5 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 6 pseudo : _no_value

name	LOC100039556 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257237 GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_030800.1

name	LOC628503 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257242 GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_030821.1

name	LOC668630 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257245 GeneID:668630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 5 Proteins product : similar to GTP-binding protein PTD004 pseudo : _no_value transcript_id : XR_031112.1

clone name	MSMg01-443N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-473P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476O09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-518H02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-528B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230B24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-158F24.b	B6Ng01-158F24.g
ACC	DH952337	DH952338
length	1,071	1,199
definition	DH952337\|Mus musculus domesticus DNA, BAC clone: B6Ng01-158F24, 5' end.	DH952338\|Mus musculus domesticus DNA, BAC clone: B6Ng01-158F24, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccaggacacccagggctacacagagaaactctgtctcaaaaaaca aaaacaacaacaacaaaaatttaatttgggctggtaagatggctcagcgg ttaagagagaaacgctgtctcgacaaacaaaaacaaaaaacacaaaaaaa ttaatttgggctggtgagatggctcagcgcttaagagcgccagccaactg ctcttccaaaggtactgagatcaaatccaagcaaccacatggtggctcac aaccatccctaatgaaatctgatgccgtcttctggagtggagtgtctgaa ggtggctacagtgtacttacatataataaataaataaataaataaataaa taaataaataaatatttttttgaaaaaagaagaagaaatctcaactcttc ctgctcatggctgcctgaacattgccatgctcctgccttgatgctaatgg actgacctctgaacctgtaagccagccccaattaaatattctcctttcta agatttaccttggtcataagttctgttcacagcagtaaatcccttcagcc atctttctaatacttctcacgagcaccttcccatatctgagagctcacag tgtccacatcgatcattatgcaggaaattgtactacacactttcctgcac tacagtctgctgtatgaattttctgaagtgtgatttctccacggagaatg atcagtttgctatttcaaatatatatatatgtatatattataatgcatat ttatatattataattgacatcttgtcaacaaatacagcatcaccaaatgt taacctttgctttttacattattctcaagattttatgttttatcataata taacacagtccaactttgttataaaaagatttattggtttatttttatgt atatgcgtacacaatagctgtcttcagacacatcagaagagggcatcaga tctcaccaggtggttgtgagccaccatgtggttactgggaattgaactca ggtcctctggtagagcgtcagtgcctcttggctgctgagcattttcttcc aatcaacagttcaactttttt	gaattctctacctcatatggaagaacaaacactcccaggatagccaaaac aatcctgaaccataaaggaacttctaaagcatcacacttcctcatctcaa gctgtactacatagcaatagtgataaaaaaaacaaatgatatcagtacag acaggaagatcagtggaatcgaatacccagaaatgaactcatacacctat ggacaattcttaggcaaagaagcaaaaaccatacaatagaaaaagaaagc atcgtgaacaaatgttctgatctaactggcagtgtgtatatagaagaatc accctgcacaggatggatcaaggacctcacataaaaccagctacactgaa tctaatagcagacaaagtaggaaatacccttgaacgcattggtacaggac acagaatttcctgagcagaacatcaatggctcaggctctaagaccaacag ttaatacatttcttgaaaatgaaaagcttctgtaagggagaggacactgt caataggacaaaacagtagccaaaaactgagaaaagatgttcaccaaccc tatagccaatagagggctaatatctaaaagttataaagatctcaaaaagt tagatgccaaaaaaatcaaacaacctaattaaaaatgggatacagagcta atcagaattctcaacagaggaagttcgaatgacctattgtagtggctatt cctggttgtcaacttgacaatatttggaatgaactacaatccggaattgg aaaggctcaccagtgacccttatcttgaggcttggagatccttatctgga tcttggtttgaagatcttgagccatagtggctatggattccagaagatta aatctctgagtttaaggaacacacctttaatctgggctatgccttcatct gggataaaggtgtgtggaacacactgtgatctgggctacaccttctgctg agacatataaggacattgagaaggagtctagctctgctctgctctcgctg ctgctgctgatgctgagtaactgctagatctggactcattccaagcgcga ctgagcatgttgggattggctgctgacgtaagtcatcaataaattcctta cattcagaccattcatagtctgtgactggagacctggacttacacctaag tatcgcagtcagtaatgtcatacgtgtgcgcatcgccagtaataggcca
quality values	Open. Hide. 61 43 39 24 50 53 35 19 61 61 47 50 50 61 61 47 47 61 61 61 61 61 61 61 37 43 28 23 34 25 34 30 35 43 59 61 61 61 61 61 61 59 59 61 61 59 55 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 59 59 61 59 59 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 44 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 59 61 61 61 61 61 61 59 49 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 55 61 61 59 59 55 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 61 61 59 61 59 61 61 59 61 61 61 55 61 61 61 61 59 59 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 59 55 59 61 61 61 61 61 61 59 59 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 50 61 50 53 53 47 50 50 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 61 43 61 50 50 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 50 53 61 43 53 57 57 57 57 53 53 50 57 53 57 57 57 57 53 57 53 53 53 53 57 39 53 53 39 53 53 53 53 47 47 45 53 53 53 53 53 53 57 26 57 45 53 53 45 53 53 53 53 53 57 50 47 53 52 53 53 53 53 47 47 52 50 52 52 53 45 39 57 53 50 38 57 57 57 52 32 57 57 45 53 53 47 53 53 53 53 53 57 53 57 47 50 53 50 57 52 42 53 42 52 53 31 53 53 50 53 53 50 53 57 42 45 38 50 53 38 29 46 41 43 45 52 43 50 53 38 53 52 28 53 47 30 52 43 40 50 37 38 18 37 40 53 52 23 33 41 23 53 41 31 38 38 39 37 46 46 53 42 38 37 37 57 34 33 34 57 52 50 50 53 52 52 48 48 39 39 41 37 43 37 42 52 47 40 47 40 40 53 33 26 25 36 57 31 35 47 53 39 57 52 42 47 40 42 41 48 41 48 36 23 30 16 53 41 33 31 35 40 53 29 25 44 29 40 24 20 33 28 33 30 32 37 47 23 31 37 33 41 35 30 30 31 23 39 30 32 34 12 24 24 32 28 32 32 46 30 31 30 30 51 51 51 18 23 31 23 47 12 22 30 44 29 30 27 11 33 29 48 27 51 51 37 29 29 31 29 47 46 28 29 28 25 28 29 31 32 29 31 30 20 29 32 18 31 29 35 31 29 38 20 33 29 43 51 27 29 19 30 29 35 33 51 51 51 29 22 35 16 51 39 29 25 24 24 23 7 39 29 34 29 51 51 51 39 33 29 29 27 27 31 29 29 27 28 28 21 24 24 10 19 20 27 27 33 28 31 31 29 29 28 24 43 31 16 15 29 21 13 29 20 29 26 30 15 38 33 19 31 13 51 24 20 20 25 18 11 12 23 15 29 20 19 21 23 18 14 16 33 20 33 31 9 19 27 22 22 28 31 34 21 23 17 30 20 14 26 18 26 25 21 20 17 28 22 21 51 33 14 22 16 27 30 27 26 31 29 27 12 23 21 13 29 18 14 14 23 25 29 9 9 6 9 9 8 4 4 9 18 13 9 25 9 6 9 19 9 22 9 15 17 31 34 26 31 14 15 5 30 4 6 7 5 6 10 7 14 8 28 12 19 13 34 30 19 25 12 9 12 9 31 10 15 13 18 30 26 29 31 12	Open. Hide. 61 47 55 49 36 36 28 34 19 25 25 25 27 24 27 59 59 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 61 61 59 59 59 52 43 59 55 55 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 55 55 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 59 55 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 55 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 50 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 55 61 61 61 47 61 61 61 61 50 47 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 53 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 61 61 61 61 61 53 53 57 50 53 53 52 53 57 47 47 57 57 57 57 50 57 47 47 57 53 47 40 53 47 53 53 50 47 47 37 47 47 42 47 53 53 57 52 50 47 24 16 53 53 57 57 57 53 57 57 52 53 45 57 53 57 53 53 53 50 57 57 57 38 52 53 52 50 50 53 53 53 47 47 50 53 53 40 52 57 57 57 52 41 53 50 53 53 37 46 30 41 28 53 53 57 57 57 50 37 43 50 52 57 53 32 47 43 46 45 43 37 38 39 42 57 53 57 47 37 53 57 57 31 36 36 50 34 50 57 38 53 50 30 52 39 40 42 38 57 30 31 57 44 53 37 36 34 53 36 42 53 24 38 44 57 36 53 46 34 36 53 39 40 53 42 30 38 38 43 40 41 53 25 53 36 37 44 37 24 39 34 37 37 37 40 40 53 32 24 41 44 32 40 26 41 32 37 44 45 37 36 24 44 35 35 30 51 32 30 32 28 30 31 31 36 44 30 41 29 30 30 33 41 30 32 30 37 30 30 28 39 31 29 11 51 18 33 29 10 32 29 32 29 30 28 28 29 29 18 12 30 36 29 36 21 28 35 34 32 48 29 22 31 27 36 21 26 31 36 23 29 29 25 31 21 29 29 29 27 35 29 28 18 28 28 29 27 29 29 22 51 33 29 26 33 24 29 28 29 35 33 29 26 23 30 16 16 29 29 25 20 36 29 28 28 27 29 28 31 21 19 29 15 26 21 23 33 32 19 26 16 35 35 51 23 29 31 29 27 29 27 33 12 29 46 27 17 16 19 16 16 28 29 15 30 14 21 18 29 51 33 24 20 28 28 29 28 51 31 17 28 18 24 26 19 13 18 16 12 17 18 22 15 17 42 25 20 16 8 51 19 18 32 17 19 12 26 10 22 28 17 19 17 18 12 4 8 5 6 17 7 8 10 22 10 19 42 25 19 30 16 20 9 9 4 5 18 11 8 28 16 9 44 10 14 11 7 10 7 12 20 15 9 23 20 10 17 15 24 17 6 4 3 12 14 9 7 10 7 28 29 31 19 7 17 26 16 30 14 12 9 6 15 9 6 13 26 29 14 4 6 8 26 13 23 26 29 23 22 5 3 5 16 10 23 10 6 4 13 4 7 10 12 14 15 21 9 5 15 11 14 6 16 7 9 18 7 5 20 20 7 11 19 9 7 4 4 5 4 4 2 2 2 2 7 10 6 2 3 6 9 14 6 5 20 24 9 18 4 12 10 17 5 8 16 12 16 10 19 11 5 3 4 10 8 18 12 9 19 12 6 5 5 8 21 17 7 10 8 13 18 14 6 6 10 4 14 3 2 2 3 4 5 4 5 4 3 2 1 3 3 7 6 19 7 6 8 8 7 9 3 5 13 7 11 3 5 4 14 11 4 14 3 3 11 1 2 1 19 8 5 15 5 5 20 6 5 5 4 19 4 13 13 20 4 4 9 19 4 9 6 13 4 3 10 8 3 10 3 4 5 5 2 3 19 4 5 2 1 4 5 19 3 6 7 5 4 21 10 7 9 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_50330954_50332023
seq2: B6Ng01-158F24.b_44_1114

seq1  GAATTCCAGGACACCCAGGGCTACACAGAGAAACTCTGTCTCAAAAAACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGACACCCAGGGCTACACAGAGAAACTCTGTCTCAAAAAACA  50

seq1  AAAACAACAACAACAAAAATTTAATTTGGGCTGGTAAGATGGCTCAGCGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAACAACAACAAAAATTTAATTTGGGCTGGTAAGATGGCTCAGCGG  100

seq1  TTAAGAGAGAAACGCTGTCTCGACAAACAAAAACAAAAAACACAAAAAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGAGAGAAACGCTGTCTCGACAAACAAAAACAAAAAACACAAAAAAA  150

seq1  TTAATTTGGGCTGGTGAGATGGCTCAGCGCTTAAGAGCGCCAGCCAACTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTTGGGCTGGTGAGATGGCTCAGCGCTTAAGAGCGCCAGCCAACTG  200

seq1  CTCTTCCAAAGGTACTGAGATCAAATCCAAGCAACCACATGGTGGCTCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCCAAAGGTACTGAGATCAAATCCAAGCAACCACATGGTGGCTCAC  250

seq1  AACCATCCCTAATGAAATCTGATGCCGTCTTCTGGAGTGGAGTGTCTGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCATCCCTAATGAAATCTGATGCCGTCTTCTGGAGTGGAGTGTCTGAA  300

seq1  GGTGGCTACAGTGTACTTACATATAATAAATAAATAAATAAATAAATAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCTACAGTGTACTTACATATAATAAATAAATAAATAAATAAATAAA  350

seq1  TAAATAAATAAATATTTTTTTGAAAAAAGAAGAAGAAATCTCAACTCTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATAAATAAATATTTTTTTGAAAAAAGAAGAAGAAATCTCAACTCTTC  400

seq1  CTGCTCATGGCTGCCTGAACATTGCCATGCTCCTGCCTTGATGCTAATGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCATGGCTGCCTGAACATTGCCATGCTCCTGCCTTGATGCTAATGG  450

seq1  ACTGACCTCTGAACCTGTAAGCCAGCCCCAATTAAATATTCTCCTTTCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACCTCTGAACCTGTAAGCCAGCCCCAATTAAATATTCTCCTTTCTA  500

seq1  AGATTTACCTTGGTCATAAGTTCTGTTCACAGCAGTAAATCCCTTCAGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTTACCTTGGTCATAAGTTCTGTTCACAGCAGTAAATCCCTTCAGCC  550

seq1  ATCTTTCTAATACTTCTCACGAGCACCTTCCCATATCTGAGAGCTCACAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTCTAATACTTCTCACGAGCACCTTCCCATATCTGAGAGCTCACAG  600

seq1  TGTCCACATCGATCATTATGCAGGAAATTGTACTACACACTTTCCTGCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCACATCGATCATTATGCAGGAAATTGTACTACACACTTTCCTGCAC  650

seq1  TACAGTCTGCTGTATGAATTTTCTGAAGTGTGATTTCTCCACGGAGAATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGTCTGCTGTATGAATTTTCTGAAGTGTGATTTCTCCACGGAGAATG  700

seq1  ATCAGTTTGCTATTTCAAATATATATATATGTATATATTATAATGCATAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGTTTGCTATTTCAAATATATATATATGTATATATTATAATGCATAT  750

seq1  TTATATATTATAATTGACATCTTGTCAACAAATACAGCATCACCAAATGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATATTATAATTGACATCTTGTCAACAAATACAGCATCACCAAATGT  800

seq1  TAACCTTTGCTTTTTACATTATTCTCAAGATTTTATGTTTTATCATAATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCTTTGCTTTTTACATTATTCTCAAGATTTTATGTTTTATCATAATA  850

seq1  TAACACAGTCCAACTTTGTTATAAAAAGATTTATTGGTTTATTTTTATGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACACAGTCCAACTTTGTTATAAAAAGATTTATTGGTTTATTTTTATGT  900

seq1  ATATGCGTACACAATAGCTGTCTTCAGACACATCAGAAGAGGGCATCAGA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGCGTACACAATAGCTGTCTTCAGACACATCAGAAGAGGGCATCAGA  950

seq1  TCTCACCAGGTGGTTGTGAGCCACCATGTGGTTACTGGGAATTGAACTCA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACCAGGTGGTTGTGAGCCACCATGTGGTTACTGGGAATTGAACTCA  1000

seq1  GGTCCTCTGGTAGAGCAGTCAGTG-CTCTTGGCTGCTGAGCCATCTC-TC  1048
      |||||||||||||||| ||||||| ||||||||||||||||  | || ||
seq2  GGTCCTCTGGTAGAGC-GTCAGTGCCTCTTGGCTGCTGAGCATTTTCTTC  1049

seq1  CAATCAACAGTCCAACTTTTTT  1070
      ||||||||||| ||||||||||
seq2  CAATCAACAGTTCAACTTTTTT  1071

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information