MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-177N22
Chromosome	7 (Build37)
Map Location	111,705,048 - 111,705,565
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Olfr615, Olfr616, LOC100042167, Olfr617, Olfr618, Olfr619, Olfr620, LOC667639, Olfr622, Olfr623, Olfr624, Olfr625-ps1, Olfr261-ps1, Olfr260-ps1, Olfr627, Olfr1526-ps1, Olfr629, Olfr630, Olfr69, Olfr68, Olfr67, Hbb-b1, EG436003, Hbb-bh1, Hbb-y, Olfr66, Olfr64, Olfr65, Olfr631, Olfr632, Olfr633, Olfr634-ps1, LOC233614, Olfr635, Olfr636-ps1, Olfr637-ps1, Olfr638, Olfr639, Olfr640, Olfr641, Olfr642, Olfr643, Olfr644, Olfr645, Olfr646, 4931431F19Rik, Ubqln3, Ubqlnl, E030002O03Rik, Olfr647-ps1, Olfr648, Olfr649, Olfr650-ps1, Trim6, LOC667497, EG667823, Trim12, Trim34, 9230105E10Rik, A530023O14Rik, EG434219, LOC100041595, Trim30, AI451617, LOC672495, LOC625305, EG625321, Olfr651
Downstream gene	Olfr652, Olfr653, Olfr654, Olfr655, Olfr656, Olfr657, Olfr658, LOC667882, Olfr659, GA_x5J8B7W3SPQ-80592-80214, Olfr661, LOC625495, Olfr662-ps1, Olfr663, Olfr664, EG625530, LOC100042613, LOC233637, Dub1a, Dub1, Olfr665, Olfr666, Olfr667, Olfr668, Olfr669, EG545987, Olfr670, Olfr671, Olfr672, GA_x5J8B7W6B6J-189947-189022, Olfr674-ps1, Olfr675, Olfr676, Olfr677, LOC667987, Olfr678, Olfr679, Olfr680-ps1, Olfr681, Olfr682-ps1, Olfr683, Olfr684, Olfr685, Olfr686, EG668035, Olfr688, Olfr689, Olfr690, Olfr691, Olfr692, EG545989, 4632419K20Rik, Cnga4, EG244189, Cckbr, Prkcdbp, Smpd1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr615 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259084 MGI:3030449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr616 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259103 MGI:3030450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	Olfr617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258838 MGI:3030451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259049 MGI:3030452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr619 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259080 MGI:3030453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258808 MGI:3030454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 186 Proteins pseudo : _no_value

name	Olfr622 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259087 MGI:3030456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259126 MGI:3030457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258189 MGI:3030458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr625-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258169 MGI:3030459
definition	gene_synonym : MOR31-15P note : olfactory receptor 625, pseudogene 1 pseudo : _no_value

name	Olfr261-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404366 MGI:3030095
definition	gene_synonym : MOR4-6_p note : olfactory receptor 261, pseudogene 1 pseudo : _no_value

name	Olfr260-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404365 MGI:3030094
definition	gene_synonym : MOR26-4_p note : olfactory receptor 260, pseudogene 1 pseudo : _no_value

name	Olfr627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436002 MGI:3030461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1526-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259159 MGI:3031360
definition	gene_synonym : MOR22-4P note : olfactory receptor 1526, pseudogene 1 pseudo : _no_value

name	Olfr629 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258818 MGI:3030463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr630 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259102 MGI:3030464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr69 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18370 MGI:1341789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18369 MGI:1341790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr67 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18368 MGI:1341911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbb-b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15129 MGI:96021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436003 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436003 MGI:3645277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Hbb-bh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15132 MGI:96024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbb-y (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15135 MGI:96027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr66 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18367 MGI:1341906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18366 MGI:1341900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18365 MGI:1341910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258961 MGI:3030465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259123 MGI:3030466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr633 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258351 MGI:3030467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr634-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257949 MGI:3030468
definition	gene_synonym : MOR12-4 note : olfactory receptor 634, pseudogene 1 pseudo : _no_value

name	LOC233614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:233614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr635 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259122 MGI:3030469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr636-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258144 MGI:3030470
definition	gene_synonym : MOR12-2P note : olfactory receptor 636, pseudogene 1 pseudo : _no_value

name	Olfr637-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258143 MGI:3030471
definition	gene_synonym : MOR12-3P note : olfactory receptor 637, pseudogene 1 pseudo : _no_value

name	Olfr638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259124 MGI:3030472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259088 MGI:3030473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr640 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258819 MGI:3030474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr641 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259075 MGI:3030475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr642 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258326 MGI:3030476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr643 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259081 MGI:3030477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259125 MGI:3030478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258247 MGI:3030479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr646 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259058 MGI:3030480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931431F19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70980 MGI:1918230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins

name	Ubqln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244178 MGI:3045291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubqlnl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244179 MGI:2685336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030002O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244180 MGI:2443346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr647-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258137 MGI:3030481
definition	gene_synonym : MOR0-5P note : olfactory receptor 647, pseudogene 1 pseudo : _no_value

name	Olfr648 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258746 MGI:3030482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr649 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259057 MGI:3030483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr650-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258212 MGI:3030484
definition	gene_synonym : MOR31-14 note : olfactory receptor 650, pseudogene 1 pseudo : _no_value

name	Trim6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94088 MGI:2137352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins pseudo : _no_value

name	EG667823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667823 MGI:3646853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 16 Proteins

name	Trim12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76681 MGI:1923931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94094 MGI:2137359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230105E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319236 MGI:2441735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530023O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100041595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	Trim30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20128 MGI:98178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI451617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209387 MGI:3035181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 13 Proteins pseudo : _no_value

name	LOC625305 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins pseudo : _no_value

name	EG625321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625321 MGI:3643754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258809 MGI:3030485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr652 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259050 MGI:3030486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr653 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57250 MGI:3030487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258377 MGI:3030488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258817 MGI:3030489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr656 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259078 MGI:3030490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr657 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258309 MGI:3030491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr658 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259051 MGI:3030492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259052 MGI:3030493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3SPQ-80592-80214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257836
definition	note : olfactory receptor GA_x5J8B7W3SPQ-80592-80214 pseudo : _no_value

name	Olfr661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258743 MGI:3030495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr662-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404413 MGI:3030496
definition	gene_synonym : MOR34-13_p note : olfactory receptor 662, pseudogene 1 pseudo : _no_value

name	Olfr663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257914 MGI:3030497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr664 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667918 MGI:3030498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 161 Proteins

name	EG625530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625530 MGI:3643640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC233637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:233637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 60 ESTs, 8 Proteins

name	Dub1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381944 MGI:3051498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13531 MGI:107699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr665 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258810 MGI:3030499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr666 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259100 MGI:3030500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259062 MGI:3030501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259061 MGI:3030502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259045 MGI:3030503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545987 MGI:3643907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 5 Proteins

name	Olfr670 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384703 MGI:3030504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257910 MGI:3030505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258755 MGI:3030506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-189947-189022 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257774
definition	note : olfactory receptor GA_x5J8B7W6B6J-189947-189022 pseudo : _no_value

name	Olfr674-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258172 MGI:3030508
definition	gene_synonym : MOR32-7P note : olfactory receptor 674, pseudogene 1 pseudo : _no_value

name	Olfr675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258147 MGI:3030509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr676 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259099 MGI:3030510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr677 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258355 MGI:3030511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr678 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258753 MGI:3030512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr679 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259046 MGI:3030513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr680-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257981 MGI:3030514
definition	gene_synonym : MOR40-10P note : olfactory receptor 680, pseudogene 1 pseudo : _no_value

name	Olfr681 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404318 MGI:3030515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr682-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404415 MGI:3030516
definition	gene_synonym : MOR40-19_p note : olfactory receptor 682, pseudogene 1 pseudo : _no_value

name	Olfr683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259047 MGI:3030517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244187 MGI:3030518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258160 MGI:3030519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr686 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259072 MGI:3030520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668035 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668035 MGI:3643397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 Proteins

name	Olfr688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259161 MGI:3030522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258745 MGI:3030523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr690 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56860 MGI:3030524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr691 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259063 MGI:3030525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr692 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258352 MGI:3030526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545989 MGI:3643909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	4632419K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74349 MGI:1921599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnga4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233649 MGI:2664099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins pseudo : _no_value

name	Cckbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12426 MGI:99479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcdbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20597 MGI:98325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr615 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128808 GeneID:259084 MGI:3030449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 615 transcript_id : NM_147080.1

name	Olfr616 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128770 GeneID:259103 MGI:3030450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 616 transcript_id : NM_147099.1

name	LOC100042167 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257647 GeneID:100042167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : hypothetical protein LOC100042167 transcript_id : XM_001477481.1

name	Olfr617 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129182 GeneID:258838 MGI:3030451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 617 transcript_id : NM_146841.1

name	Olfr618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128856 GeneID:259049 MGI:3030452
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 618 transcript_id : NM_147047.1

name	Olfr619 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128810 GeneID:259080 MGI:3030453
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 619 transcript_id : NM_147076.1

name	Olfr620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129422 GeneID:258808 MGI:3030454
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 620 transcript_id : NM_146812.1

name	Olfr622 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128804 GeneID:259087 MGI:3030456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 622 transcript_id : NM_147083.1

name	Olfr623 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128756 GeneID:259126 MGI:3030457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 623 transcript_id : NM_147122.1

name	Olfr624 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185925 GeneID:258189 MGI:3030458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 624 transcript_id : NM_001011865.2

name	Olfr627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794773 GeneID:436002 MGI:3030461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 627 transcript_id : NM_001025386.1

name	Olfr629 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778936 GeneID:258818 MGI:3030463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 629 transcript_id : NM_146821.2

name	Olfr630 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128644 GeneID:259102 MGI:3030464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 630 transcript_id : NM_147098.1

name	Olfr69 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048107 GeneID:18370 MGI:1341789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 69 transcript_id : NM_013621.2

name	Olfr68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134947982 GeneID:18369 MGI:1341790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 68 transcript_id : NM_013620.2

name	Olfr67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407030 GeneID:18368 MGI:1341911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 67 transcript_id : NM_013619.3

name	Hbb-b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982299 GeneID:15129 MGI:96021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin, beta adult major chain transcript_id : NM_008220.2

name	EG436003 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762090 GeneID:436003 MGI:3645277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : predicted gene, EG436003 transcript_id : XM_488069.1

name	Hbb-bh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982298 GeneID:15132 MGI:96024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin Z, beta-like embryonic chain transcript_id : NM_008219.2

name	Hbb-y (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366327 GeneID:15135 MGI:96027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemoglobin Y, beta-like embryonic chain transcript_id : NM_008221.3

name	Olfr66 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948666 GeneID:18367 MGI:1341906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 66 transcript_id : NM_013618.3

name	Olfr64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948614 GeneID:18366 MGI:1341900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 64 transcript_id : NM_013617.3

name	Olfr65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165350 GeneID:18365 MGI:1341910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 65 transcript_id : NM_013616.2

name	Olfr631 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089293 GeneID:258961 MGI:3030465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 631 transcript_id : NM_146959.2

name	Olfr632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128750 GeneID:259123 MGI:3030466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 632 transcript_id : NM_147119.1

name	Olfr633 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129590 GeneID:258351 MGI:3030467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 633 transcript_id : NM_146354.1

name	Olfr635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128748 GeneID:259122 MGI:3030469
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 635 transcript_id : NM_147118.1

name	Olfr638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128752 GeneID:259124 MGI:3030472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 638 transcript_id : NM_147120.1

name	Olfr639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128798 GeneID:259088 MGI:3030473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 639 transcript_id : NM_147084.1

name	Olfr640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129216 GeneID:258819 MGI:3030474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 640 transcript_id : NM_146822.1

name	Olfr641 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128814 GeneID:259075 MGI:3030475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 641 transcript_id : NM_147072.1

name	Olfr642 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122856 GeneID:258326 MGI:3030476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 642 transcript_id : NM_146329.1

name	Olfr643 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128812 GeneID:259081 MGI:3030477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 643 transcript_id : NM_147077.1

name	Olfr644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128754 GeneID:259125 MGI:3030478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 644 transcript_id : NM_147121.1

name	Olfr645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369494 GeneID:258247 MGI:3030479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 645 transcript_id : NM_207144.1

name	Olfr646 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128838 GeneID:259058 MGI:3030480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 646 transcript_id : NM_147056.1

name	4931431F19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380891 GeneID:70980 MGI:1918230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins product : RIKEN cDNA 4931431F19 gene transcript_id : XM_133663.5

name	Ubqln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801660 GeneID:244178 MGI:3045291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 3 transcript_id : NM_198623.2

name	Ubqlnl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385042 GeneID:244179 MGI:2685336
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin-like transcript_id : NM_198624.2

name	E030002O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254252 GeneID:244180 MGI:2443346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E030002O03 gene transcript_id : NM_172905.2

name	Olfr648 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129342 GeneID:258746 MGI:3030482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 648 transcript_id : NM_146751.1

name	Olfr649 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128842 GeneID:259057 MGI:3030483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 649 transcript_id : NM_147055.1

name	Trim6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637826 GeneID:94088 MGI:2137352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 6 transcript_id : NM_001013616.2

name	EG667823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257652 GeneID:667823 MGI:3646853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 16 Proteins product : predicted gene, EG667823 transcript_id : XM_992714.2

name	Trim12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299738 GeneID:76681 MGI:1923931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 12 transcript_id : NM_023835.2

name	Trim34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371122 GeneID:94094 MGI:2137359
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 34 transcript_id : NM_030684.2

name	9230105E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982206 GeneID:319236 MGI:2441735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230105E10 gene transcript_id : NM_175677.3

name	A530023O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342270 GeneID:244183 MGI:2443916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530023O14 gene transcript_id : NM_175648.2

name	EG434219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257631 GeneID:434219 MGI:3647719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434219 transcript_id : XM_485980.4

name	Trim30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347378 GeneID:20128 MGI:98178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 30 transcript_id : NM_009099.2

name	AI451617 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40255280 GeneID:209387 MGI:3035181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI451617 transcript_id : NM_199146.1

name	EG625321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348957 GeneID:625321 MGI:3643754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625321 transcript_id : NM_001037924.2

name	Olfr651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129230 GeneID:258809 MGI:3030485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 651 transcript_id : NM_146813.1

name	Olfr652 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128858 GeneID:259050 MGI:3030486
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 652 transcript_id : NM_147048.1

name	Olfr653 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203818 GeneID:57250 MGI:3030487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 653 transcript_id : NM_147074.1

name	Olfr654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129542 GeneID:258377 MGI:3030488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 654 transcript_id : NM_146379.1

name	Olfr655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129220 GeneID:258817 MGI:3030489
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 655 transcript_id : NM_146820.1

name	Olfr656 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128816 GeneID:259078 MGI:3030490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 656 transcript_id : NM_147075.1

name	Olfr657 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129666 GeneID:258309 MGI:3030491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 657 transcript_id : NM_146312.1

name	Olfr658 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801805 GeneID:259051 MGI:3030492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 658 transcript_id : NM_147049.3

name	Olfr659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128854 GeneID:259052 MGI:3030493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 659 transcript_id : NM_147050.1

name	Olfr661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128636 GeneID:258743 MGI:3030495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 661 transcript_id : NM_146748.1

name	Olfr663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801301 GeneID:257914 MGI:3030497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 663 transcript_id : NM_001011757.1

name	Olfr664 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257634 GeneID:667918 MGI:3030498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 161 Proteins product : olfactory receptor 664 transcript_id : XM_001476881.1

name	EG625530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380902 GeneID:625530 MGI:3643640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG625530 transcript_id : XM_890107.2

name	LOC100042613 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257657 GeneID:100042613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042613 transcript_id : XM_001478060.1

name	LOC233637 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257636 GeneID:233637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 60 ESTs, 8 Proteins product : similar to Twinfilin, actin-binding protein, homolog 1 (Drosophila) transcript_id : XM_001476895.1

name	Dub1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299770 GeneID:381944 MGI:3051498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 1a transcript_id : NM_201409.2

name	Dub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681236 GeneID:13531 MGI:107699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deubiquitinating enzyme 1 transcript_id : NM_007887.1

name	Olfr665 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129232 GeneID:258810 MGI:3030499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 665 transcript_id : NM_146814.1

name	Olfr666 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128776 GeneID:259100 MGI:3030500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 666 transcript_id : NM_147096.1

name	Olfr667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529282 GeneID:259062 MGI:3030501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 667 transcript_id : NM_147060.2

name	Olfr668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128840 GeneID:259061 MGI:3030502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 668 transcript_id : NM_147059.1

name	Olfr669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203814 GeneID:259045 MGI:3030503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 669 transcript_id : NM_147043.1

name	EG545987 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380903 GeneID:545987 MGI:3643907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 5 Proteins product : predicted gene, EG545987, transcript variant 2 transcript_id : XM_899834.2

name	Olfr670 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54261733 GeneID:384703 MGI:3030504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 670 transcript_id : NM_207146.1

name	Olfr671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801297 GeneID:257910 MGI:3030505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 671 transcript_id : NM_001011755.1

name	Olfr672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203786 GeneID:258755 MGI:3030506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 672 transcript_id : NM_146760.1

name	Olfr675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801453 GeneID:258147 MGI:3030509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 675 transcript_id : NM_001011848.1

name	Olfr676 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128774 GeneID:259099 MGI:3030510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 676 transcript_id : NM_147095.1

name	Olfr677 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129582 GeneID:258355 MGI:3030511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 677 transcript_id : NM_146358.1

name	Olfr678 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129332 GeneID:258753 MGI:3030512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 678 transcript_id : NM_146758.1

name	Olfr679 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128866 GeneID:259046 MGI:3030513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 679 transcript_id : NM_147044.1

name	Olfr681 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430573 GeneID:404318 MGI:3030515
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 681 transcript_id : NM_207557.1

name	Olfr683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128860 GeneID:259047 MGI:3030517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 683 transcript_id : NM_147045.1

name	Olfr684 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402250 GeneID:244187 MGI:3030518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 684 transcript_id : NM_207249.1

name	Olfr685 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801471 GeneID:258160 MGI:3030519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 685 transcript_id : NM_001011857.1

name	Olfr686 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128818 GeneID:259072 MGI:3030520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 686 transcript_id : NM_147069.1

name	EG668035 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257638 GeneID:668035 MGI:3643397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 Proteins product : predicted gene, EG668035 transcript_id : XM_001477192.1

name	Olfr688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090808 GeneID:259161 MGI:3030522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 688 transcript_id : NM_001011533.2

name	Olfr689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129348 GeneID:258745 MGI:3030523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 689 transcript_id : NM_146750.1

name	Olfr690 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938013 GeneID:56860 MGI:3030524
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 690 transcript_id : NM_020290.1

name	Olfr691 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128836 GeneID:259063 MGI:3030525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 691 transcript_id : NM_147061.1

name	Olfr692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129592 GeneID:258352 MGI:3030526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 692 transcript_id : NM_146355.1

name	EG545989 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82907340 GeneID:545989 MGI:3643909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG545989 transcript_id : XM_620543.2

name	4632419K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930594 GeneID:74349 MGI:1921599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632419K20 gene transcript_id : NM_199009.1

name	Cnga4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370142 GeneID:233649 MGI:2664099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide gated channel alpha 4 transcript_id : NM_001033317.2

name	Cckbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349437 GeneID:12426 MGI:99479
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin B receptor transcript_id : NM_007627.3

name	Prkcdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22324937 GeneID:109042 MGI:1923422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C, delta binding protein transcript_id : NM_028444.1

name	Smpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755581 GeneID:20597 MGI:98325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 1, acid lysosomal transcript_id : NM_011421.1

name	Olfr615 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128809 GeneID:259084 MGI:3030449
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6284902-6285843; olfactory receptor MOR19-2 product : olfactory receptor 615 protein_id : NP_667291.1

name	Olfr616 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128771 GeneID:259103 MGI:3030450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6289676-6288723; olfactory receptor MOR19-1 product : olfactory receptor 616 protein_id : NP_667310.1

name	LOC100042167 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257648 GeneID:100042167
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477531.1

name	Olfr617 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129183 CCDS:CCDS21579.1 GeneID:258838 MGI:3030451
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6306819-6307775; olfactory receptor MOR31-10 product : olfactory receptor 617 protein_id : NP_667052.1

name	Olfr618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128857 CCDS:CCDS21580.1 GeneID:259049 MGI:3030452
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6320148-6321104; olfactory receptor MOR31-9 product : olfactory receptor 618 protein_id : NP_667258.1

name	Olfr619 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128811 CCDS:CCDS21581.1 GeneID:259080 MGI:3030453
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6326488-6327450; olfactory receptor MOR31-5 product : olfactory receptor 619 protein_id : NP_667287.1

name	Olfr620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129423 CCDS:CCDS21582.1 GeneID:258808 MGI:3030454
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6335095-6334154; olfactory receptor MOR4-1 product : olfactory receptor 620 protein_id : NP_667023.1

name	Olfr622 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128805 CCDS:CCDS21583.1 GeneID:259087 MGI:3030456
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6362863-6361910; olfactory receptor MOR26-1 product : olfactory receptor 622 protein_id : NP_667294.1

name	Olfr623 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128757 CCDS:CCDS21584.1 GeneID:259126 MGI:3030457
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6384836-6383883; olfactory receptor MOR1-4 product : olfactory receptor 623 protein_id : NP_667333.1

name	Olfr624 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185926 CCDS:CCDS21585.1 GeneID:258189 MGI:3030458
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6394126-6393197; olfactory receptor MOR4-2P product : olfactory receptor 624 protein_id : NP_001011865.2

name	Olfr627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794774 CCDS:CCDS21586.1 GeneID:436002 MGI:3030461
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6440320-6440766 product : olfactory receptor 627 protein_id : NP_001020557.1

name	Olfr629 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778937 CCDS:CCDS21588.1 GeneID:258818 MGI:3030463
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6466772-6465828; olfactory receptor MOR26-2 product : olfactory receptor 629 protein_id : NP_667032.2

name	Olfr630 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128645 CCDS:CCDS21589.1 GeneID:259102 MGI:3030464
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6483085-6482126; olfactory receptor MOR17-1 product : olfactory receptor 630 protein_id : NP_667309.1

name	Olfr69 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305353 CCDS:CCDS21590.1 GeneID:18370 MGI:1341789
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory receptor MOR22-2; GA_x6K02T2PBJ9-6494485-6493535 product : olfactory receptor 69 protein_id : NP_038649.1

name	Olfr68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134947983 CCDS:CCDS21591.1 GeneID:18369 MGI:1341790
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR22-3; GA_x6K02T2PBJ9-6504436-6503489 product : olfactory receptor 68 protein_id : NP_038648.2

name	Olfr67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407031 GeneID:18368 MGI:1341911
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6515150-6514170; olfactory receptor MOR31-1 product : olfactory receptor 67 protein_id : NP_038647.2

name	Hbb-b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982300 GeneID:15129 MGI:96021
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IMP] GO_process : GO:0030097 - hemopoiesis [Evidence IMP]; GO:0015671 - oxygen transport [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta major globin; beta-1-globin product : hemoglobin, beta adult major chain protein_id : NP_032246.2

name	EG436003 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762091 GeneID:436003 MGI:3645277
definition	codon_start : 1 product : similar to Hemoglobin subunit beta (Hemoglobin beta chain) (Beta-globin) protein_id : XP_488069.1

name	Hbb-bh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680179 CCDS:CCDS21592.1 GeneID:15132 MGI:96024
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta Hl globin product : hemoglobin Z, beta-like embryonic chain protein_id : NP_032245.1

name	Hbb-y (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680177 CCDS:CCDS21593.1 GeneID:15135 MGI:96027
definition	GO_component : GO:0005833 - hemoglobin complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : epsilon Y globin product : hemoglobin Y, beta-like embryonic chain protein_id : NP_032247.1

name	Olfr66 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948667 CCDS:CCDS21594.1 GeneID:18367 MGI:1341906
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6620959-6620024 product : olfactory receptor 66 protein_id : NP_038646.2

name	Olfr64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948615 GeneID:18366 MGI:1341900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6648196-6649143 product : olfactory receptor 64 protein_id : NP_038645.2

name	Olfr65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305343 CCDS:CCDS21596.1 GeneID:18365 MGI:1341910
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6634906-6633983 product : olfactory receptor 65 protein_id : NP_038644.1

name	Olfr631 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089294 CCDS:CCDS21597.1 GeneID:258961 MGI:3030465
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6662699-6663658; olfactory receptor MOR3-1 product : olfactory receptor 631 protein_id : NP_667170.2

name	Olfr632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128751 CCDS:CCDS21598.1 GeneID:259123 MGI:3030466
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6671256-6672209; olfactory receptor MOR2-1 product : olfactory receptor 632 protein_id : NP_667330.1

name	Olfr633 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129591 CCDS:CCDS21599.1 GeneID:258351 MGI:3030467
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6681230-6682168; olfactory receptor MOR12-5 product : olfactory receptor 633 protein_id : NP_666466.1

name	Olfr635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128749 CCDS:CCDS21600.1 GeneID:259122 MGI:3030469
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6713641-6714588; olfactory receptor MOR5-2 product : olfactory receptor 635 protein_id : NP_667329.1

name	Olfr638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128753 CCDS:CCDS21601.1 GeneID:259124 MGI:3030472
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6737723-6738670; olfactory receptor MOR5-1 product : olfactory receptor 638 protein_id : NP_667331.1

name	Olfr639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128799 GeneID:259088 MGI:3030473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6747143-6746193; olfactory receptor MOR12-1 product : olfactory receptor 639 protein_id : NP_667295.1

name	Olfr640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129217 CCDS:CCDS21602.1 GeneID:258819 MGI:3030474
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-6756759-6755815; olfactory receptor MOR13-4 product : olfactory receptor 640 protein_id : NP_667033.1

name	Olfr641 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128815 CCDS:CCDS21603.1 GeneID:259075 MGI:3030475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6773690-6774628; olfactory receptor MOR13-3 product : olfactory receptor 641 protein_id : NP_667283.1

name	Olfr642 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122857 CCDS:CCDS21604.1 GeneID:258326 MGI:3030476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6784380-6783436; olfactory receptor MOR13-6; odorant receptor S85; G-protein-coupled receptor product : olfactory receptor 642 protein_id : NP_666441.1

name	Olfr643 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128813 CCDS:CCDS21605.1 GeneID:259081 MGI:3030477
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6793628-6792684; olfactory receptor MOR13-2 product : olfactory receptor 643 protein_id : NP_667288.1

name	Olfr644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128755 CCDS:CCDS21606.1 GeneID:259125 MGI:3030478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6803062-6802118; olfactory receptor MOR13-1 product : olfactory receptor 644 protein_id : NP_667332.1

name	Olfr645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369495 CCDS:CCDS21607.1 GeneID:258247 MGI:3030479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6819097-6818150; olfactory receptor MOR13-5 product : olfactory receptor 645 protein_id : NP_997027.1

name	Olfr646 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128839 CCDS:CCDS21608.1 GeneID:259058 MGI:3030480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6841330-6842268; olfactory receptor MOR33-2 product : olfactory receptor 646 protein_id : NP_667267.1

name	4931431F19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20839440 GeneID:70980 MGI:1918230
definition	codon_start : 1 product : hypothetical protein LOC70980 protein_id : XP_133663.1

name	Ubqln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348486 CCDS:CCDS21610.1 GeneID:244178 MGI:3045291
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquilin 3 protein_id : NP_941025.1

name	Ubqlnl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348490 CCDS:CCDS21611.1 GeneID:244179 MGI:2685336
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquilin-like protein_id : NP_941026.1

name	E030002O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370386 CCDS:CCDS21612.1 GeneID:244180 MGI:2443346
definition	codon_start : 1 product : hypothetical protein LOC244180 protein_id : NP_766493.1

name	Olfr648 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129343 CCDS:CCDS21613.1 GeneID:258746 MGI:3030482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6914780-6913830; olfactory receptor MOR31-12 product : olfactory receptor 648 protein_id : NP_666962.1

name	Olfr649 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128843 CCDS:CCDS21614.1 GeneID:259057 MGI:3030483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-6924585-6923647; olfactory receptor MOR31-7 product : olfactory receptor 649 protein_id : NP_667266.1

name	Trim6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61966933 GeneID:94088 MGI:2137352
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : tripartite motif protein 6 protein_id : NP_001013637.1

name	EG667823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257653 GeneID:667823 MGI:3646853
definition	codon_start : 1 product : hypothetical protein LOC667823 protein_id : XP_997808.2

name	Trim12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299739 GeneID:76681 MGI:1923931
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 12 protein_id : NP_076324.2

name	Trim34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507607 GeneID:94094 MGI:2137359
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : tripartite motif protein 34 protein_id : NP_109609.1

name	9230105E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982207 GeneID:319236 MGI:2441735
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : tripartite motif protein TRIM5 protein_id : NP_783608.2

name	A530023O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316738 GeneID:244183 MGI:2443916
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC244183 protein_id : NP_783579.1

name	EG434219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257632 GeneID:434219 MGI:3647719
definition	codon_start : 1 product : similar to Expressed sequence AI451617 protein_id : XP_485980.4

name	Trim30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347379 GeneID:20128 MGI:98178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : regulatory protein, T lymphocyte 1 product : tripartite motif protein 30 protein_id : NP_033125.2

name	AI451617 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40255281 GeneID:209387 MGI:3035181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : tripartite motif protein 30-like product : hypothetical protein LOC209387 protein_id : NP_954597.1

name	EG625321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702328 GeneID:625321 MGI:3643754
definition	codon_start : 1 product : hypothetical protein LOC625321 protein_id : NP_001033013.1

name	Olfr651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129231 CCDS:CCDS21617.1 GeneID:258809 MGI:3030485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7179540-7180481; olfactory receptor MOR31-11 product : olfactory receptor 651 protein_id : NP_667024.1

name	Olfr652 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128859 CCDS:CCDS21618.1 GeneID:259050 MGI:3030486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7191524-7192471; olfactory receptor MOR31-8 product : olfactory receptor 652 protein_id : NP_667259.1

name	Olfr653 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203819 CCDS:CCDS21619.1 GeneID:57250 MGI:3030487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7206970-7207923; olfactory receptor MOR33-1; odorant receptor S19 product : olfactory receptor 653 protein_id : NP_667285.1

name	Olfr654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129543 CCDS:CCDS21620.1 GeneID:258377 MGI:3030488
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7215221-7216195; olfactory receptor MOR38-2 product : olfactory receptor 654 protein_id : NP_666491.1

name	Olfr655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129221 CCDS:CCDS21621.1 GeneID:258817 MGI:3030489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7224628-7223702; olfactory receptor MOR38-1 product : olfactory receptor 655 protein_id : NP_667031.1

name	Olfr656 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128817 CCDS:CCDS21622.1 GeneID:259078 MGI:3030490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7245486-7246451; olfactory receptor MOR27-1 product : olfactory receptor 656 protein_id : NP_667286.1

name	Olfr657 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129667 CCDS:CCDS21623.1 GeneID:258309 MGI:3030491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7263864-7264823; olfactory receptor MOR40-13 product : olfactory receptor 657 protein_id : NP_666424.1

name	Olfr658 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128853 CCDS:CCDS21624.1 GeneID:259051 MGI:3030492
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7273558-7272587; olfactory receptor MOR34-5 product : olfactory receptor 658 protein_id : NP_667260.1

name	Olfr659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128855 CCDS:CCDS21625.1 GeneID:259052 MGI:3030493
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7298889-7299857; olfactory receptor MOR34-4 product : olfactory receptor 659 protein_id : NP_667261.1

name	Olfr661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128637 CCDS:CCDS21626.1 GeneID:258743 MGI:3030495
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7316375-7317334; olfactory receptor MOR40-4; odorant receptor S83; G-protein-coupled receptor product : olfactory receptor 661 protein_id : NP_666959.1

name	Olfr663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801302 GeneID:257914 MGI:3030497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7331927-7332961; olfactory receptor MOR40-12 product : olfactory receptor 663 protein_id : NP_001011757.1

name	Olfr664 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257635 GeneID:667918 MGI:3030498
definition	codon_start : 1 product : olfactory receptor 664 protein_id : XP_001476931.1

name	EG625530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907334 GeneID:625530 MGI:3643640
definition	codon_start : 1 product : deubiquitinating enzyme 6 protein_id : XP_895200.1

name	LOC100042613 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257658 GeneID:100042613
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478110.1

name	LOC233637 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257637 GeneID:233637
definition	codon_start : 1 product : similar to Twinfilin, actin-binding protein, homolog 1 (Drosophila) protein_id : XP_001476945.1

name	Dub1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299771 CCDS:CCDS21628.1 GeneID:381944 MGI:3051498
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : deubiquitinating enzyme 1a protein_id : NP_958811.2

name	Dub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681237 CCDS:CCDS21629.1 GeneID:13531 MGI:107699
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0004843 - ubiquitin-specific protease activity [Evidence IDA] GO_process : GO:0016579 - protein deubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : deubiquitinating enzyme 1 protein_id : NP_031913.1

name	Olfr665 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129233 CCDS:CCDS21630.1 GeneID:258810 MGI:3030499
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7509539-7510489; olfactory receptor MOR34-7 product : olfactory receptor 665 protein_id : NP_667025.1

name	Olfr666 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128777 CCDS:CCDS21631.1 GeneID:259100 MGI:3030500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7522449-7521493; olfactory receptor MOR34-1 product : olfactory receptor 666 protein_id : NP_667307.1

name	Olfr667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529283 GeneID:259062 MGI:3030501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7546146-7545166; olfactory receptor MOR34-2 product : olfactory receptor 667 protein_id : NP_667271.2

name	Olfr668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128841 GeneID:259061 MGI:3030502
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7554614-7553658; olfactory receptor MOR34-3 product : olfactory receptor 668 protein_id : NP_667270.1

name	Olfr669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203815 CCDS:CCDS21632.1 GeneID:259045 MGI:3030503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7567376-7568329; olfactory receptor MOR34-6 product : olfactory receptor 669 protein_id : NP_667254.1

name	EG545987 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907314 GeneID:545987 MGI:3643907
definition	codon_start : 1 product : similar to MEK binding partner 1 isoform 2 protein_id : XP_904927.1

name	Olfr670 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261734 CCDS:CCDS21634.1 GeneID:384703 MGI:3030504
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7589577-7588639; olfactory receptor MOR32-8; olfactory receptor GA_x5J8B7W6B6J-141796-141659 product : olfactory receptor 670 protein_id : NP_997029.1

name	Olfr671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801298 CCDS:CCDS21635.1 GeneID:257910 MGI:3030505
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7604826-7603885; olfactory receptor MOR32-12 product : olfactory receptor 671 protein_id : NP_001011755.1

name	Olfr672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203787 GeneID:258755 MGI:3030506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7625746-7624808; olfactory receptor MOR32-4; odorant receptor S46 product : olfactory receptor 672 protein_id : NP_666971.1

name	Olfr675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801454 CCDS:CCDS21636.1 GeneID:258147 MGI:3030509
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7653782-7652841; olfactory receptor MOR32-9P product : olfactory receptor 675 protein_id : NP_001011848.1

name	Olfr676 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128775 CCDS:CCDS21637.1 GeneID:259099 MGI:3030510
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7664016-7664969; olfactory receptor MOR32-1 product : olfactory receptor 676 protein_id : NP_667306.1

name	Olfr677 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129583 CCDS:CCDS21638.1 GeneID:258355 MGI:3030511
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7685262-7686200; olfactory receptor MOR32-11 product : olfactory receptor 677 protein_id : NP_666470.1

name	Olfr678 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129333 CCDS:CCDS21639.1 GeneID:258753 MGI:3030512
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7698491-7699432; olfactory receptor MOR32-5 product : olfactory receptor 678 protein_id : NP_666969.1

name	Olfr679 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128867 CCDS:CCDS21640.1 GeneID:259046 MGI:3030513
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7714499-7715446; olfactory receptor MOR40-2 product : olfactory receptor 679 protein_id : NP_667255.1

name	Olfr681 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430574 CCDS:CCDS21641.1 GeneID:404318 MGI:3030515
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-7750163-7751110 product : olfactory receptor 681 protein_id : NP_997440.1

name	Olfr683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128861 CCDS:CCDS21642.1 GeneID:259047 MGI:3030517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7773007-7772066; olfactory receptor MOR40-1; odorant receptor S51 product : olfactory receptor 683 protein_id : NP_667256.1

name	Olfr684 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402251 CCDS:CCDS21643.1 GeneID:244187 MGI:3030518
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2PBJ9-7786441-7785503 product : olfactory receptor 684 protein_id : NP_997132.1

name	Olfr685 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801472 CCDS:CCDS21644.1 GeneID:258160 MGI:3030519
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7810071-7809121; olfactory receptor MOR37-1 product : olfactory receptor 685 protein_id : NP_001011857.1

name	Olfr686 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128819 CCDS:CCDS21645.1 GeneID:259072 MGI:3030520
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7832633-7831680; olfactory receptor MOR35-1 product : olfactory receptor 686 protein_id : NP_667280.1

name	EG668035 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257639 GeneID:668035 MGI:3643397
definition	codon_start : 1 product : similar to olfactory receptor Olfr687 protein_id : XP_001477242.1

name	Olfr688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090809 GeneID:259161 MGI:3030522
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7917168-7918148; olfactory receptor MOR40-5; olfactory receptor 688, pseudogene 1 product : olfactory receptor 688 protein_id : NP_001011533.2

name	Olfr689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129349 CCDS:CCDS21646.1 GeneID:258745 MGI:3030523
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7942985-7943947; olfactory receptor MOR40-3 product : olfactory receptor 689 protein_id : NP_666961.1

name	Olfr690 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938014 GeneID:56860 MGI:3030524
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PBJ9-7959171-7958224; olfactory receptor MOR31-2; odorant receptor S18 product : olfactory receptor 690 protein_id : NP_064686.1

name	Olfr691 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128837 CCDS:CCDS21647.1 GeneID:259063 MGI:3030525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7966695-7965727; olfactory receptor MOR31-6 product : olfactory receptor 691 protein_id : NP_667272.1

name	Olfr692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129593 CCDS:CCDS21648.1 GeneID:258352 MGI:3030526
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-7994144-7995106; olfactory receptor MOR36-1 product : olfactory receptor 692 protein_id : NP_666467.1

name	EG545989 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907341 GeneID:545989 MGI:3643909
definition	codon_start : 1 product : similar to Chromosome 11 open reading frame 42 protein_id : XP_620543.2

name	4632419K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930595 CCDS:CCDS21649.1 GeneID:74349 MGI:1921599
definition	codon_start : 1 product : hypothetical protein LOC74349 protein_id : NP_950174.1

name	Cnga4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370304 CCDS:CCDS21650.1 GeneID:233649 MGI:2664099
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence TAS]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IMP] codon_start : 1 note : olfactory cyclic nucleotide-gated channel; cyclic nucleotide gated cation channel; cyclic nucleotide-gated cation channel alpha 4 product : cyclic nucleotide gated channel alpha 4 protein_id : NP_001028489.1

name	Cckbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106265 CCDS:CCDS21651.1 GeneID:12426 MGI:99479
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0046935 - phosphatidylinositol 3-kinase regulator activity [Evidence ISS]; GO:0004435 - phosphoinositide phospholipase C activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0007586 - digestion [Evidence ISS]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence ISS]; GO:0007631 - feeding behavior [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007202 - phospholipase C activation [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0007600 - sensory perception [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CCK2/gastrin receptor; CCK-B/gastrin receptor product : cholecystokinin B receptor protein_id : NP_031653.1

name	Prkcdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22324938 CCDS:CCDS21652.1 GeneID:109042 MGI:1923422
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : protein kinase C, delta binding protein protein_id : NP_082720.1

name	Smpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755582 CCDS:CCDS21653.1 GeneID:20597 MGI:98325
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006685 - sphingomyelin catabolism [Evidence IEA] codon_start : 1 note : acid sphingomyelinase product : sphingomyelin phosphodiesterase 1, acid lysosomal protein_id : NP_035551.1

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 3 pseudo : _no_value

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 2 pseudo : _no_value

name	LOC233614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:233614
definition	number : 1 pseudo : _no_value

name	LOC100041595 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041595
definition	number : 2 pseudo : _no_value

name	LOC100041595 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041595
definition	number : 1 pseudo : _no_value

name	LOC625305 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625305
definition	number : 1 pseudo : _no_value

name	LOC667882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667882
definition	number : 1 pseudo : _no_value

name	LOC667882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667882
definition	number : 2 pseudo : _no_value

name	LOC625495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625495
definition	number : 2 pseudo : _no_value

name	LOC625495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625495
definition	number : 1 pseudo : _no_value

name	LOC667987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667987
definition	number : 1 pseudo : _no_value

name	LOC667987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667987
definition	number : 2 pseudo : _no_value

name	LOC667639 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257630 GeneID:667639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 186 Proteins product : similar to olfactory receptor Olr120 pseudo : _no_value transcript_id : XR_032639.1

name	LOC667497 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257654 GeneID:667497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 5 Proteins product : similar to ribosomal protein L27a pseudo : _no_value transcript_id : XR_033409.1

name	LOC672495 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257633 GeneID:672495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 13 Proteins product : similar to cyclin Y-like 1 pseudo : _no_value transcript_id : XR_032873.1

name	EG244189 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257640 GeneID:244189 MGI:3643689
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 3 Proteins product : predicted gene, EG244189 pseudo : _no_value transcript_id : XR_035686.1

clone name	MSMg01-317N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-490H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-106E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520G11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-317H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-233J11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-203E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-051M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-400I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-389A14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-547A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-484I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-518H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-183A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-046L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-510J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-461L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-177N22.b	B6Ng01-177N22.g
ACC	GA005022	GA005023
length	512	696
definition	B6Ng01-177N22.b	B6Ng01-177N22.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	tttgtttagctctgaaccccatttttaatggggttatttgaatttctgga gtccagcttcttgagctctaaaaataaagaagaaggaaagaaaagaagca aaatgttagcaaatccagttaagtacagtgtgtagcacagaagcatctgg aggttggaggagaactctctttccaccatggttcccagggattaaaacca ggcactcaggctagaggttgggtaccaaacagaaccactgagtcatctct ttggcccaagtttcataatttttcactgtggtctaataaagcagccatca acagagtctcttgggagctgcctaaggagcaatgaaaatgacacatactc tcccagtctaatgtcattccagactcactccctaccgctcactcccaggg ggtgcttcttgtgttcattgaggctaaatatgaatgattttatttccact gcagattttagattgcatcctcagatgttttgtgtttgttgaattgttgg atggttggttgg	gaattctgtagggctgtgaatgggcttctctgagagtagtgtttgcccat tatggagcctagtggtggaccctcagcactgtacaaaatcaggtgtggtg gctcttgcacgtggtctgtcttagttactcttctactgctgtgataaaca ccatgactgggacaaattgtaaggaaagtgtttcatttggggctcacagt agtgttcatgaccaccactgtgtggtgcatggcagcaggcagggagacag ggtgctggagcaggaagtaagaagtcacaacttgagacacaatcttgaca caaacttgagacagagagagaatggtggtggtggtcggaatctactgaat cctgaaagcttgcacctattccataccttctccaagaatgccccactctt ttttttttaattcttttttaaaattttttcctttttttttatttcgtatt ttcctcaattacatttccaatgctatcccaaaagtctcccacaccccccc ccccactcccctacccacccattcccattttttggccctgtagttcccct gtactggggcatataatctttcctgaacagtgtccctgataactgagaac caagtgtccaaaaatcttagcctttggggccatttgttattcaaactggc ccaggatgccactgcccttgcagcctggctgcatgaaggatcagga
quality values	Open. Hide. 62 62 62 62 62 62 44 37 59 59 62 62 62 62 59 62 62 62 62 59 49 62 62 62 62 59 56 43 46 43 32 32 31 54 43 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 49 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 56 54 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 39 54 58 58 58 53 58 43 48 27 35 20 6 17 13 15	Open. Hide. 62 47 62 47 62 62 47 44 62 62 62 62 44 27 32 32 28 28 20 28 24 46 49 43 62 62 62 62 62 62 62 62 59 59 59 62 59 62 59 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 46 59 62 54 43 54 62 59 59 62 62 62 62 62 62 62 62 59 62 59 54 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 49 62 59 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 59 62 51 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 43 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 47 32 62 62 62 62 62 56 56 56 56 37 39 56 62 62 56 62 56 51 56 56 51 51 56 56 51 56 56 56 62 56 56 56 56 56 56 47 56 56 56 56 62 62 47 62 42 62 56 56 56 56 56 56 62 62 56 56 29 56 41 62 52 52 52 31 38 29 24 30 28 38 43 35 38 22 37 41 35 33 34 35 22 31 13 9 15 16 42 38 34 37 18 20 16 9 13 13 29 40 41 46 35 32 28 29 28 38 42 30 33 25 19 18 52 39 32 28 17 30 50 50 42 32 50 41 31 34 27 9 33 27 23 14 19 18 17 32 35 19 24 13 12 33 52 52 9 10 38 27 28 33 9 25 33 24 15 12 33 26 27 31 22 42 33 35 27 10 19 24 47 26 21 25 25 15 18 19 18 16 16 16 14 9 22 19 14 24 25 26 28 25 22 21 33 33 36 30 48 12 24 11 32 32 20 9 13 13 19 21 21 13 33 29 33 36 23 24 19 20 6 10 13 9 9 9 13 20 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_111705048_111705565
seq2: B6Ng01-177N22.b_49_566 (reverse)

seq1  CCAACCAACCATCCAACAATTCAACAAACACAAAACATCTGAGGATGCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACCAACCATCCAACAATTCAACAAACACAAAACATCTGAGGATGCAA  50

seq1  TCTAAAATCTGCAGTGGAAATAAAATCATTCATATTTAGCCTCAATGAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAAATCTGCAGTGGAAATAAAATCATTCATATTTAGCCTCAATGAAC  100

seq1  ACAAGAAGCACCCCCTGGGAGTGAGCGGTAGGGAGTGAGTCTGGAATGAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGAAGCACCCCCTGGGAGTGAGCGGTAGGGAGTGAGTCTGGAATGAC  150

seq1  ATTAGACTGGGAGAGTATGTGTCATTTTCATTGCTCCTTAGGCAGCTCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGACTGGGAGAGTATGTGTCATTTTCATTGCTCCTTAGGCAGCTCCC  200

seq1  AAGAGACTCTGTTGATGGCTGCTTTATTAGACCACAGTGAAAAATTATGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGACTCTGTTGATGGCTGCTTTATTAGACCACAGTGAAAAATTATGA  250

seq1  AACTTGGGCCAAAGAGATGACTCAGTGGTTCTGTTTGGTACCCAACCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGGGCCAAAGAGATGACTCAGTGGTTCTGTTTGGTACCCAACCTCT  300

seq1  AGCCTGAGTGCCTGGTTTTAATCCCTGGGAACCATGGTGGAAAGAGAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGAGTGCCTGGTTTTAATCCCTGGGAACCATGGTGGAAAGAGAGTT  350

seq1  CTCCTCCAACCTCCAGATGCTTCTGTGCTACACACTGTACTTAACTGGAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCCAACCTCCAGATGCTTCTGTGCTACACACTGTACTTAACTGGAT  400

seq1  TTGCTAACATTTTGCTTCTTTTCTTTCCTTCTTCTTTATTTTTAGAGCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTAACATTTTGCTTCTTTTCTTTCCTTCTTCTTTATTTTTAGAGCTC  450

seq1  AAGAAGCTGGACTCCAGAAATTCAAATAACCCCATTAAAAATGGGGTTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAGCTGGACTCCAGAAATTCAAATAACCCCATTAAAAATGGGGTTCA  500

seq1  GAGCTAAACAAAGAATTC  518
      ||||||||||||||||||
seq2  GAGCTAAACAAAGAATTC  518

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information