MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-178F10
Chromosome	7 (Build37)	5 (Build37)
Map Location	52,739,210 - 52,739,488	108,324,153 - 108,324,648
singlet/doublet	singlet	singlet
Overlap gene	Dhdh
Upstream gene	2310044H10Rik, 1700021P22Rik, Mybpc2, Spib, Pold1, Nr1h2, Napsa, Kcnc3, Myh14, 1700023D19Rik, Zfp473, Vrk3, EG628904, Atf5, Nup62, Il4i1, Tbc1d17, Akt1s1, Pnkp, Ptov1, Med25, Fuz, Ap2a1, Stk22s1, Cpt1c, Prmt1, Bcl2l12, Irf3, AI480556, Rras, Prr12, Prrg2, Nosip, Rcn3, Fcgrt, Rps11, Rnu35b, Rpl13a, Rnu35a, Rnu34, Rnu33, Rnu32, Flt3l, Aldh16a1, Pih1d1, Slc17a7, Gm581, LOC100039953, Tifp39, BC050196, Dkkl1, Tead2, Cd37, Slc6a16, 1700039E15Rik, Trpm4, LOC100040970, Hrc, 2410127E16Rik, Mtag2, Lin7b, Snrp70, Kcna7, Ntf5, LOC100040019, Lhb, Ruvbl2, Gys1, Ftl1, Bax
Downstream gene	Nucb1, Tulp2, Myd116, Plekha4, Hsd17b14, Bcat2, Fgf21, Fut1, Izumo1, Rasip1, 5430432N15Rik, Fut2, Sec1, Gm484, Car11, Dbp, Sphk2, Rpl18, 4930403C10Rik, Spaca4, Sult2b1, EG545963, Lmtk3, Pscd2, Kcnj14, Grwd1, Grin2d, Kdelr1, Syngr4, Tmem143, Emp3, BC013491, LOC677321, Abcc6, Nomo1, Kcnj11, Abcc8, Ush1c, Otog, Myod1, Kcnc1, Sergef
Link	Open Mouse BAC browser

Click to get alignment info.

name	2310044H10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69683 MGI:1916933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75538 MGI:1922788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins

name	Mybpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233199 MGI:1336170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272382 MGI:892986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18971 MGI:97741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22260 MGI:1352463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Napsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16541 MGI:109365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16504 MGI:96669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71960 MGI:1919210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700023D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75510 MGI:1922760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Zfp473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243963 MGI:2442697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vrk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101568 MGI:2182465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628904 MGI:3645141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Atf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107503 MGI:2141857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18226 MGI:1351500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il4i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14204 MGI:109552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233204 MGI:2449973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67605 MGI:1914855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnkp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59047 MGI:1891698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptov1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84113 MGI:1933946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75613 MGI:1922863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fuz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70300 MGI:1917550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein

name	Ap2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11771 MGI:101921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stk22s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22116 MGI:1347560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cpt1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78070 MGI:2446526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15469 MGI:107846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75736 MGI:1922986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54131 MGI:1859179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI480556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233208 MGI:2141980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rras (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20130 MGI:98179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233210 MGI:2679002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 82 ESTs, 3 Proteins

name	Prrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65116 MGI:1929596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nosip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66394 MGI:1913644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52377 MGI:1277122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcgrt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14132 MGI:103017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27207 MGI:1351329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu35b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27212 MGI:1351321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22121 MGI:1351455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu35a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27211 MGI:1351319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27210 MGI:1351325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27208 MGI:1351323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27209 MGI:1351324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14256 MGI:95560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh16a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69748 MGI:1916998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pih1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68845 MGI:1916095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72961 MGI:1920211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm581 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210541 MGI:2685427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100039953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tifp39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114640 MGI:2152297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC050196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384619 MGI:2687329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dkkl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50722 MGI:1354963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tead2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21677 MGI:104904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12493 MGI:88330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381884 MGI:2685930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	1700039E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76713 MGI:1923963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68667 MGI:1915917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 389 ESTs, 1 Protein

name	Hrc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15464 MGI:96226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410127E16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76787 MGI:1924037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtag2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50994 MGI:1860766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lin7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22342 MGI:1330858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrp70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20637 MGI:98341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcna7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16495 MGI:96664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78405 MGI:97381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Lhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16866 MGI:96782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ruvbl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20174 MGI:1342299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gys1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14936 MGI:101805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14325 MGI:95589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bax (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12028 MGI:99702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71755 MGI:1919005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nucb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18220 MGI:97388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tulp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56734 MGI:1861600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Myd116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17872 MGI:1100516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekha4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69217 MGI:1916467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd17b14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66065 MGI:1913315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12036 MGI:1276534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56636 MGI:1861377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fut1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14343 MGI:109375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Izumo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73456 MGI:1920706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69903 MGI:1917153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430432N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74490 MGI:1921740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein

name	Fut2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14344 MGI:109374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56546 MGI:1928893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243967 MGI:2685330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12348 MGI:1336193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13170 MGI:94866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sphk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19899 MGI:98003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930403C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73813 MGI:1921063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spaca4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69363 MGI:1916613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54200 MGI:1926342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545963 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545963 MGI:3648578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmtk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381983 MGI:3039582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pscd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19158 MGI:1334255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211480 MGI:2384820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101612 MGI:2141989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14814 MGI:95823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kdelr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68137 MGI:1915387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58867 MGI:1928903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70209 MGI:1917459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13732 MGI:1098729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC013491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211535 MGI:2446120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 179 ESTs, 5 Proteins pseudo : _no_value

name	Abcc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27421 MGI:1351634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nomo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211548 MGI:2385850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnj11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16514 MGI:107501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20927 MGI:1352629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ush1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72088 MGI:1919338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Otog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18419 MGI:1202064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Myod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17927 MGI:97275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16502 MGI:96667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sergef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27414 MGI:1351630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310044H10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574073 GeneID:69683 MGI:1916933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310044H10 gene transcript_id : NM_197991.1

name	1700021P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257279 GeneID:75538 MGI:1922788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 4 Proteins product : RIKEN cDNA 1700021P22 gene, transcript variant 6 transcript_id : XM_901475.3

name	Mybpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347841 GeneID:233199 MGI:1336170
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein C, fast-type transcript_id : NM_178067.3

name	Mybpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122730 GeneID:233199 MGI:1336170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein C, fast-type transcript_id : NM_146189.1

name	Spib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61969657 GeneID:272382 MGI:892986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Spi-B transcription factor (Spi-1/PU.1 related) transcript_id : NM_019866.1

name	Pold1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981550 GeneID:18971 MGI:97741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), delta 1, catalytic subunit transcript_id : NM_011131.2

name	Nr1h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130379 GeneID:22260 MGI:1352463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group H, member 2 transcript_id : NM_009473.2

name	Napsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680551 GeneID:16541 MGI:109365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : napsin A aspartic peptidase transcript_id : NM_008437.1

name	Kcnc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778991 GeneID:16504 MGI:96669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shaw-related subfamily, member 3 transcript_id : NM_008422.2

name	Myh14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130423 GeneID:71960 MGI:1919210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 14 transcript_id : NM_028021.2

name	1700023D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380460 GeneID:75510 MGI:1922760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 1700023D19 gene, transcript variant 1 transcript_id : XM_620490.3

name	Zfp473 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922647 GeneID:243963 MGI:2442697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 473 transcript_id : NM_178734.3

name	Vrk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527165 GeneID:101568 MGI:2182465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vaccinia related kinase 3 transcript_id : NM_133945.1

name	EG628904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380423 GeneID:628904 MGI:3645141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG628904 transcript_id : XM_914602.2

name	Atf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507623 GeneID:107503 MGI:2141857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 5 transcript_id : NM_030693.1

name	Nup62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716348 GeneID:18226 MGI:1351500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 62 transcript_id : NM_053074.1

name	Il4i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802587 GeneID:14204 MGI:109552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 4 induced 1 transcript_id : NM_010215.2

name	Tbc1d17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120336 GeneID:233204 MGI:2449973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 17 transcript_id : NM_001042655.1

name	Akt1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374622 GeneID:67605 MGI:1914855
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AKT1 substrate 1 (proline-rich) transcript_id : NM_026270.2

name	Pnkp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601008 GeneID:59047 MGI:1891698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polynucleotide kinase 3'- phosphatase transcript_id : NM_021549.2

name	Ptov1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149317 GeneID:84113 MGI:1933946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostate tumor over expressed gene 1 transcript_id : NM_133949.1

name	Med25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350961 GeneID:75613 MGI:1922863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 25 homolog (yeast) transcript_id : NM_029365.2

name	Fuz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257288 GeneID:70300 MGI:1917550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein product : fuzzy homolog (Drosophila) transcript_id : XM_001474814.1

name	Ap2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256509 GeneID:11771 MGI:101921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, alpha 1 subunit transcript_id : NM_001077264.1

name	Ap2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256501 GeneID:11771 MGI:101921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, alpha 1 subunit transcript_id : NM_007458.2

name	Stk22s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938288 GeneID:22116 MGI:1347560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 22 substrate 1 transcript_id : NM_011651.2

name	Stk22s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938290 GeneID:22116 MGI:1347560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 22 substrate 1 transcript_id : NM_001077591.1

name	Cpt1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24211026 GeneID:78070 MGI:2446526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine palmitoyltransferase 1c transcript_id : NM_153679.1

name	Prmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130593 GeneID:15469 MGI:107846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 1 transcript_id : NM_019830.2

name	Bcl2l12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801687 GeneID:75736 MGI:1922986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 12 (proline rich) transcript_id : NM_029410.2

name	Irf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699428 GeneID:54131 MGI:1859179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 3 transcript_id : NM_016849.3

name	AI480556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605681 GeneID:233208 MGI:2141980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI480556 transcript_id : NM_001008422.1

name	Rras (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891823 GeneID:20130 MGI:98179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Harvey rat sarcoma oncogene, subgroup R transcript_id : NM_009101.2

name	Prr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380427 GeneID:233210 MGI:2679002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 82 ESTs, 3 Proteins product : proline rich 12 transcript_id : XM_001003082.1

name	Prrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930410 GeneID:65116 MGI:1929596
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 transcript_id : NM_022999.1

name	Nosip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801495 GeneID:66394 MGI:1913644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitric oxide synthase interacting protein transcript_id : NM_025533.2

name	Rcn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794451 GeneID:52377 MGI:1277122
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulocalbin 3, EF-hand calcium binding domain transcript_id : NM_026555.1

name	Fcgrt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801903 GeneID:14132 MGI:103017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, alpha chain transporter transcript_id : NM_010189.2

name	Rps11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980755 GeneID:27207 MGI:1351329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S11 transcript_id : NM_013725.2

name	Rpl13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892386 GeneID:22121 MGI:1351455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L13a transcript_id : NM_009438.4

name	Flt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982427 GeneID:14256 MGI:95560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 3 ligand transcript_id : NM_013520.2

name	Aldh16a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26080428 GeneID:69748 MGI:1916998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 16 family, member A1 transcript_id : NM_145954.1

name	Pih1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802032 GeneID:68845 MGI:1916095
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PIH1 domain containing 1 transcript_id : NM_029406.2

name	Slc17a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859826 GeneID:72961 MGI:1920211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 transcript_id : NM_182993.1

name	Gm581 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257252 GeneID:210541 MGI:2685427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 581, (NCBI) transcript_id : XM_149934.8

name	LOC100039953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257256 GeneID:100039953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039953 transcript_id : XM_001473839.1

name	Tifp39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716586 GeneID:114640 MGI:2152297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberoinfundibular peptide of 39 residues (TIP39) preprohormone transcript_id : NM_053256.1

name	BC050196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235780 GeneID:384619 MGI:2687329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050196 transcript_id : NM_201374.1

name	Dkkl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980690 GeneID:50722 MGI:1354963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dickkopf-like 1 transcript_id : NM_015789.2

name	Tead2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560533 GeneID:21677 MGI:104904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 2 transcript_id : NM_011565.2

name	Cd37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802952 GeneID:12493 MGI:88330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD37 antigen transcript_id : NM_007645.3

name	Slc6a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380433 GeneID:381884 MGI:2685930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : solute carrier family 6, member 16 transcript_id : XM_355900.4

name	1700039E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701685 GeneID:76713 MGI:1923963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700039E15 gene transcript_id : NM_001033176.1

name	Trpm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364628 GeneID:68667 MGI:1915917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily M, member 4 transcript_id : NM_175130.3

name	LOC100040970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257294 GeneID:100040970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 389 ESTs, 1 Protein product : similar to Ribosomal protein L14 transcript_id : XM_001475571.1

name	Hrc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778930 GeneID:15464 MGI:96226
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine rich calcium binding protein transcript_id : NM_010473.2

name	2410127E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037460 GeneID:76787 MGI:1924037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410127E16 gene transcript_id : NM_029741.1

name	Lin7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755970 GeneID:22342 MGI:1330858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lin-7 homolog B (C. elegans) transcript_id : NM_011698.1

name	Snrp70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130481 GeneID:20637 MGI:98341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U1 small nuclear ribonucleoprotein polypeptide A transcript_id : NM_009224.4

name	Kcna7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485673 GeneID:16495 MGI:96664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, member 7 transcript_id : NM_010596.2

name	Ntf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016141 GeneID:78405 MGI:97381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophin 5 transcript_id : NM_198190.1

name	LOC100040019 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257258 GeneID:100040019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to hCG1796489 transcript_id : XM_001473952.1

name	Lhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404412 GeneID:16866 MGI:96782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : luteinizing hormone beta transcript_id : NM_008497.2

name	Ruvbl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383697 GeneID:20174 MGI:1342299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RuvB-like protein 2 transcript_id : NM_011304.3

name	Gys1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672917 GeneID:14936 MGI:101805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase 1, muscle transcript_id : NM_030678.3

name	Ftl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326465 GeneID:14325 MGI:95589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin light chain 1 transcript_id : NM_010240.2

name	Bax (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778943 GeneID:12028 MGI:99702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-associated X protein transcript_id : NM_007527.3

name	Dhdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347369 GeneID:71755 MGI:1919005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrodiol dehydrogenase (dimeric) transcript_id : NM_027903.2

name	Nucb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679157 GeneID:18220 MGI:97388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleobindin 1 transcript_id : NM_008749.1

name	Tulp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930727 GeneID:56734 MGI:1861600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby-like protein 2 transcript_id : NM_001045555.1

name	Tulp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930721 GeneID:56734 MGI:1861600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby-like protein 2 transcript_id : NM_008807.2

name	Myd116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678977 GeneID:17872 MGI:1100516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid differentiation primary response gene 116 transcript_id : NM_008654.1

name	Plekha4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507324 GeneID:69217 MGI:1916467
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4 transcript_id : NM_148927.1

name	Hsd17b14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098115 GeneID:66065 MGI:1913315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 14 transcript_id : NM_025330.2

name	Bcat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365745 GeneID:12036 MGI:1276534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain aminotransferase 2, mitochondrial transcript_id : NM_009737.2

name	Fgf21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379814 GeneID:56636 MGI:1861377
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 21 transcript_id : NM_020013.3

name	Fut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802983 GeneID:14343 MGI:109375
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 1 transcript_id : NM_008051.4

name	Izumo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301150 GeneID:73456 MGI:1920706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : izumo sperm-egg fusion 1 transcript_id : NM_001018013.1

name	Rasip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676214 GeneID:69903 MGI:1917153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras interacting protein 1 transcript_id : NM_028544.1

name	5430432N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257304 GeneID:74490 MGI:1921740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : RIKEN cDNA 5430432N15 gene transcript_id : XM_001476117.1

name	Fut2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227196 GeneID:14344 MGI:109374
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 2 transcript_id : NM_018876.3

name	Sec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910229 GeneID:56546 MGI:1928893
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory blood group 1 transcript_id : NM_019934.1

name	Gm484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490393 GeneID:243967 MGI:2685330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 484, (NCBI) transcript_id : NM_001033356.2

name	Car11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801671 GeneID:12348 MGI:1336193
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 11 transcript_id : NM_009800.3

name	Dbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393239 GeneID:13170 MGI:94866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D site albumin promoter binding protein transcript_id : NM_016974.1

name	Sphk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130964 GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 2 transcript_id : NM_203280.2

name	Sphk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354966 GeneID:56632 MGI:1861380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingosine kinase 2 transcript_id : NM_020011.4

name	Rpl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83699423 GeneID:19899 MGI:98003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L18 transcript_id : NM_009077.2

name	4930403C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345328 GeneID:73813 MGI:1921063
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930403C10 gene transcript_id : NM_001033170.2

name	Spaca4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802360 GeneID:69363 MGI:1916613
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm acrosome associated 4 transcript_id : NM_027055.2

name	Sult2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567407 GeneID:54200 MGI:1926342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family, cytosolic, 2B, member 1 transcript_id : NM_017465.1

name	EG545963 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702114 GeneID:545963 MGI:3648578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545963 transcript_id : NM_001033792.1

name	Lmtk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828724 GeneID:381983 MGI:3039582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lemur tyrosine kinase 3 transcript_id : NM_001005511.1

name	Pscd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543517 GeneID:19158 MGI:1334255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled-coil domains 2 transcript_id : NM_011181.2

name	Kcnj14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892517 GeneID:211480 MGI:2384820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 14 transcript_id : NM_145963.2

name	Grwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956277 GeneID:101612 MGI:2141989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate-rich WD repeat containing 1 transcript_id : NM_153419.1

name	Grin2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922605 GeneID:14814 MGI:95823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA2D (epsilon 4) transcript_id : NM_008172.2

name	Kdelr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129902 GeneID:68137 MGI:1915387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 transcript_id : NM_133950.2

name	Syngr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587010 GeneID:58867 MGI:1928903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 4 transcript_id : NM_021482.2

name	Tmem143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450160 GeneID:70209 MGI:1917459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 143 transcript_id : NM_144801.1

name	Emp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753749 GeneID:13732 MGI:1098729
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial membrane protein 3 transcript_id : NM_010129.1

name	BC013491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371876 GeneID:211535 MGI:2446120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013491 transcript_id : NM_001033243.2

name	Abcc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055155 GeneID:27421 MGI:1351634
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 6 transcript_id : NM_018795.1

name	Nomo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802551 GeneID:211548 MGI:2385850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nodal modulator 1 transcript_id : NM_153057.3

name	Kcnj11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328178 GeneID:16514 MGI:107501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly rectifying channel, subfamily J, member 11 transcript_id : NM_010602.2

name	Abcc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130128 GeneID:20927 MGI:1352629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 8 transcript_id : NM_011510.3

name	Ush1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281801 GeneID:72088 MGI:1919338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C homolog (human) transcript_id : NM_153677.1

name	Ush1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963768 GeneID:72088 MGI:1919338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C homolog (human) transcript_id : NM_023649.1

name	Otog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257307 GeneID:18419 MGI:1202064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : otogelin transcript_id : XM_001476814.1

name	Myod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6996931 GeneID:17927 MGI:97275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myogenic differentiation 1 transcript_id : NM_010866.1

name	Kcnc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677931 GeneID:16502 MGI:96667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shaw-related subfamily, member 1 transcript_id : NM_008421.2

name	Sergef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305092 GeneID:27414 MGI:1351630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretion regulating guanine nucleotide exchange factor transcript_id : NM_013789.1

name	2310044H10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574074 GeneID:69683 MGI:1916933
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310044H10 protein_id : NP_932108.1

name	1700021P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257280 GeneID:75538 MGI:1922788
definition	codon_start : 1 product : hypothetical protein LOC75538 isoform 6 protein_id : XP_906568.2

name	Mybpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122731 GeneID:233199 MGI:1336170
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 exception : mismatches in translation note : fast-type C-protein product : myosin binding protein C, fast-type protein_id : NP_666301.1

name	Mybpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017369 GeneID:233199 MGI:1336170
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 exception : mismatches in translation note : fast-type C-protein product : myosin binding protein C, fast-type protein_id : NP_835168.1

name	Spib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61969658 CCDS:CCDS21209.1 GeneID:272382 MGI:892986
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Spi-1/PU.1 related; Ets transcription factor Spi-B product : Spi-B transcription factor (Spi-1/PU.1 related) protein_id : NP_063919.1

name	Pold1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981551 CCDS:CCDS21210.1 GeneID:18971 MGI:97741
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IMP]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006287 - base-excision repair, gap-filling [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0045004 - DNA replication proofreading [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DNA polymerase delta 1, catalytic domain; polymerase (DNA directed), delta 1, catalytic subunit (125kDa) product : polymerase (DNA directed), delta 1, catalytic subunit protein_id : NP_035261.2

name	Nr1h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678507 CCDS:CCDS21211.1 GeneID:22260 MGI:1352463
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0044255 - cellular lipid metabolism [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : liver X receptor; ubiquitously-expressed nuclear receptor 2 product : nuclear receptor subfamily 1, group H, member 2 protein_id : NP_033499.1

name	Napsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680552 CCDS:CCDS21212.1 GeneID:16541 MGI:109365
definition	GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : kidney-derived aspartic protease-like protein product : napsin A aspartic peptidase protein_id : NP_032463.1

name	Kcnc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778992 GeneID:16504 MGI:96669
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage gated channel, Shaw-related subfamily, member 3 protein_id : NP_032448.2

name	Myh14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336026 GeneID:71960 MGI:1919210
definition	GO_component : GO:0016459 - myosin [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0030898 - actin-dependent ATPase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0000146 - microfilament motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030048 - actin filament-based movement [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : nonmuscle myosin heavy chain product : myosin, heavy chain 14 protein_id : NP_082297.1

name	1700023D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63557333 GeneID:75510 MGI:1922760
definition	codon_start : 1 product : hypothetical protein LOC75510 isoform 1 protein_id : XP_620490.1

name	Zfp473 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922648 CCDS:CCDS21213.1 GeneID:243963 MGI:2442697
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 473 protein_id : NP_848849.2

name	Vrk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527166 CCDS:CCDS21214.1 GeneID:101568 MGI:2182465
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : vaccinia related kinase 3 protein_id : NP_598706.1

name	EG628904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380424 GeneID:628904 MGI:3645141
definition	codon_start : 1 product : similar to sialic acid binding immunoglobin-like lectin protein_id : XP_919695.2

name	Atf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507624 CCDS:CCDS21215.1 GeneID:107503 MGI:2141857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor-like protein ODA-10; activating transcription factor 7; activating transcription factor X product : ativating transcription factor 5 protein_id : NP_109618.1

name	Nup62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716349 CCDS:CCDS21216.1 GeneID:18226 MGI:1351500
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence ISS] [Evidence IDA]; GO:0031074 - nucleocytoplasmic shuttling complex [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0005487 - nucleocytoplasmic transporter activity [Evidence ISS] [Evidence IEA]; GO:0015288 - porin activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0051425 - PTB domain binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence ISS]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0017056 - structural constituent of nuclear pore [Evidence IEA]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0043130 - ubiquitin binding [Evidence ISS] GO_process : GO:0008219 - cell death [Evidence ISS]; GO:0016477 - cell migration [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS] [Evidence IMP]; GO:0042059 - negative regulation of epidermal growth factor receptor signaling pathway [Evidence IMP]; GO:0043407 - negative regulation of MAPK activity [Evidence IMP]; GO:0043072 - negative regulation of non-apoptotic programmed cell death [Evidence ISS]; GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IMP]; GO:0006913 - nucleocytoplasmic transport [Evidence IEA]; GO:0045742 - positive regulation of epidermal growth factor receptor signaling pathway [Evidence ISS]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0009966 - regulation of signal transduction [Evidence ISS] codon_start : 1 note : nuclear pore complex 1 product : nucleoporin 62 protein_id : NP_444304.1

name	Il4i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753872 CCDS:CCDS21217.1 GeneID:14204 MGI:109552
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_function : GO:0001716 - L-amino-acid oxidase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IDA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : interleukin-four induced gene 1; interleukin-four induced gene-1 protein; L-amino acid oxidase; interleukin-four induced protein-1 product : interleukin 4 induced 1 protein_id : NP_034345.1

name	Tbc1d17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120337 GeneID:233204 MGI:2449973
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 product : TBC1 domain family, member 17 protein_id : NP_001036120.1

name	Akt1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312878 CCDS:CCDS21218.1 GeneID:67605 MGI:1914855
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007219 - Notch signaling pathway [Evidence ISS] codon_start : 1 note : lobe-like product : AKT1 substrate 1 (proline-rich) protein_id : NP_080546.1

name	Pnkp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601009 GeneID:59047 MGI:1891698
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046404 - ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0046403 - polynucleotide 3'-phosphatase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : polynucleotide kinase 3'-phosphatase product : polynucleotide kinase 3'- phosphatase protein_id : NP_067524.2

name	Ptov1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149318 CCDS:CCDS21219.1 GeneID:84113 MGI:1933946
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA] GO_process : GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 product : prostate tumor over expressed gene 1 protein_id : NP_598710.1

name	Med25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149312 CCDS:CCDS21220.1 GeneID:75613 MGI:1922863
definition	codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 9 homolog protein_id : NP_083641.1

name	Fuz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257289 GeneID:70300 MGI:1917550
definition	codon_start : 1 product : fuzzy homolog protein_id : XP_001474864.1

name	Ap2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116256510 GeneID:11771 MGI:101921
definition	GO_component : GO:0030122 - AP-2 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] [Evidence ISS]; GO:0005905 - coated pit [Evidence IEA]; GO:0030117 - membrane coat [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence ISS] [Evidence IEA]; GO:0006895 - Golgi to endosome transport [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence TAS] [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; adaptor-related protein complex AP-2, alpha 1 subunit product : adaptor protein complex AP-2, alpha 1 subunit isoform b protein_id : NP_001070732.1

name	Ap2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671561 GeneID:11771 MGI:101921
definition	GO_component : GO:0030122 - AP-2 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] [Evidence ISS]; GO:0005905 - coated pit [Evidence IEA]; GO:0030117 - membrane coat [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence ISS] [Evidence IEA]; GO:0006895 - Golgi to endosome transport [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence TAS] [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : isoform a is encoded by transcript variant 1; adaptor-related protein complex AP-2, alpha 1 subunit product : adaptor protein complex AP-2, alpha 1 subunit isoform a protein_id : NP_031484.1

name	Stk22s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938289 GeneID:22116 MGI:1347560
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis-specific serine/threonine kinase substrate 1; clone 4 product : serine/threonine kinase 22 substrate 1 isoform 1 protein_id : NP_035781.2

name	Stk22s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938291 GeneID:22116 MGI:1347560
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; testis-specific serine/threonine kinase substrate 1; clone 4 product : serine/threonine kinase 22 substrate 1 isoform 2 protein_id : NP_001071059.1

name	Cpt1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24211027 CCDS:CCDS21221.1 GeneID:78070 MGI:2446526
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0004095 - carnitine O-palmitoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : CPT I-C product : carnitine palmitoyltransferase 1, brain protein_id : NP_710146.1

name	Prmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790109 CCDS:CCDS21222.1 GeneID:15469 MGI:107846
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008469 - histone-arginine N-methyltransferase activity [Evidence ISS]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008276 - protein methyltransferase activity [Evidence ISS] [Evidence IMP]; GO:0035242 - protein-arginine omega-N asymmetric methyltransferase activity [Evidence ISS]; GO:0035241 - protein-arginine omega-N monomethyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016275 - [cytochrome c]-arginine N-methyltransferase activity [Evidence ISS] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0019919 - peptidyl-arginine methylation, to asymmetrical-dimethyl arginine [Evidence ISS]; GO:0035247 - peptidyl-arginine omega-N-methylation [Evidence ISS]; GO:0006479 - protein amino acid methylation [Evidence ISS] codon_start : 1 note : arginine N-methyltransferase 1 product : heterogeneous nuclear ribonucleoproteins methyltransferase-like 2 protein_id : NP_062804.1

name	Bcl2l12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553305 CCDS:CCDS21223.1 GeneID:75736 MGI:1922986
definition	codon_start : 1 product : BCL2-like 12 (proline rich) protein_id : NP_083686.1

name	Irf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393627 CCDS:CCDS21224.1 GeneID:54131 MGI:1859179
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045351 - interferon type I biosynthesis [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon regulatory factor 3 protein_id : NP_058545.1

name	AI480556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605682 CCDS:CCDS21225.1 GeneID:233208 MGI:2141980
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0019904 - protein domain specific binding [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence ISS]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : serine arginine-rich pre-mRNA splicing factor SR-A1 protein_id : NP_001008422.1

name	Rras (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677819 CCDS:CCDS21226.1 GeneID:20130 MGI:98179
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : Harvey rat sarcoma oncogene, subgroup R protein_id : NP_033127.1

name	Prr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380428 GeneID:233210 MGI:2679002
definition	codon_start : 1 product : proline rich 12 protein_id : XP_001003082.1

name	Prrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930411 CCDS:CCDS21227.1 GeneID:65116 MGI:1929596
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 protein_id : NP_075375.1

name	Nosip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384956 CCDS:CCDS21228.1 GeneID:66394 MGI:1913644
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA] codon_start : 1 product : nitric oxide synthase interacting protein protein_id : NP_079809.1

name	Rcn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794452 CCDS:CCDS21229.1 GeneID:52377 MGI:1277122
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation product : reticulocalbin 3 protein_id : NP_080831.1

name	Fcgrt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753836 GeneID:14132 MGI:103017
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IEA]; GO:0030106 - MHC class I receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neonatal Fc receptor product : Fc receptor, IgG, alpha chain transporter protein_id : NP_034319.1

name	Rps11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426889 GeneID:27207 MGI:1351329
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein S11 protein_id : NP_038753.1

name	Rpl13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981945 CCDS:CCDS21230.1 GeneID:22121 MGI:1351455
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : tissue specific transplantation antigen P198-7; tum-transplantation antigen P198 product : ribosomal protein L13a protein_id : NP_033464.2

name	Flt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982428 GeneID:14256 MGI:95560
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0030098 - lymphocyte differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : FMS-like tyrosine kinase 3 ligand protein_id : NP_038548.2

name	Aldh16a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080429 CCDS:CCDS21231.1 GeneID:69748 MGI:1916998
definition	codon_start : 1 product : aldehyde dehydrogenase 16 family, member A1 protein_id : NP_666066.1

name	Pih1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313052 CCDS:CCDS21232.1 GeneID:68845 MGI:1916095
definition	codon_start : 1 product : NOP17 protein_id : NP_083682.1

name	Slc17a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859827 GeneID:72961 MGI:1920211
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence ISS] GO_function : GO:0015319 - sodium:inorganic phosphate symporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0042137 - sequestering of neurotransmitter [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 protein_id : NP_892038.1

name	Gm581 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257253 GeneID:210541 MGI:2685427
definition	codon_start : 1 product : similar to hCG2036794 protein_id : XP_149934.6

name	LOC100039953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257257 GeneID:100039953
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473889.1

name	Tifp39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716587 CCDS:CCDS21233.1 GeneID:114640 MGI:2152297
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] GO_process : GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : tuberoinfundibular 39 residue protein product : tuberoinfundibular peptide of 39 residues preprohormone protein_id : NP_444486.1

name	BC050196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235781 CCDS:CCDS21234.1 GeneID:384619 MGI:2687329
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC384619 protein_id : NP_958762.1

name	Dkkl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980691 CCDS:CCDS21235.1 GeneID:50722 MGI:1354963
definition	codon_start : 1 product : soggy 1 protein_id : NP_056604.2

name	Tead2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106433 CCDS:CCDS21236.1 GeneID:21677 MGI:104904
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : a putative transcription factor which binds to the GT-IIC motif and is structurally related to transcriptional enhancer factor-1 (TEF-1) product : TEA domain family member 2 protein_id : NP_035695.1

name	Cd37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680880 CCDS:CCDS21237.1 GeneID:12493 MGI:88330
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 product : CD37 antigen protein_id : NP_031671.1

name	Slc6a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380434 GeneID:381884 MGI:2685930
definition	codon_start : 1 product : similar to orphan neurotransmitter transporter NTT5 protein_id : XP_355900.3

name	1700039E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701686 CCDS:CCDS21238.1 GeneID:76713 MGI:1923963
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76713 protein_id : NP_001028348.1

name	Trpm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171322 GeneID:68667 MGI:1915917
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005227 - calcium activated cation channel activity [Evidence ISS]; GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence ISS] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0042391 - regulation of membrane potential [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transient receptor potential ion channel melastatin subgroup member 4 product : transient receptor potential cation channel, subfamily M, member 4 protein_id : NP_780339.1

name	LOC100040970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257295 GeneID:100040970
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475621.1

name	Hrc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778931 GeneID:15464 MGI:96226
definition	codon_start : 1 product : histidine rich calcium binding protein protein_id : NP_034603.2

name	2410127E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037461 GeneID:76787 MGI:1924037
definition	codon_start : 1 product : hypothetical protein LOC76787 protein_id : NP_084017.1

name	Lin7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755971 CCDS:CCDS21239.1 GeneID:22342 MGI:1330858
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0007269 - neurotransmitter secretion [Evidence IGI]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vertebrate homolog of C. elegans Lin-7 type 2 product : lin 7 homolog b protein_id : NP_035828.1

name	Snrp70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846113 CCDS:CCDS21240.1 GeneID:20637 MGI:98341
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : U1 small nuclear ribonucleoprotein 70 kDa polypeptide A product : U1 small nuclear ribonucleoprotein 70 kDa protein_id : NP_033250.3

name	Kcna7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485674 GeneID:16495 MGI:96664
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage gated channel, shaker related subfamily, member 7 product : potassium voltage-gated channel, shaker-related subfamily, member 7 protein_id : NP_034726.2

name	Ntf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016142 CCDS:CCDS21241.1 GeneID:78405 MGI:97381
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005166 - neurotrophin p75 receptor binding [Evidence TAS] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0008544 - epidermis development [Evidence IMP]; GO:0007402 - ganglion mother cell fate determination [Evidence IMP]; GO:0007616 - long-term memory [Evidence IMP]; GO:0042490 - mechanoreceptor differentiation [Evidence IGI]; GO:0008052 - sensory organ boundary specification [Evidence IMP] codon_start : 1 note : neurotrophin-4 product : neurotrophin 5 protein_id : NP_937833.1

name	LOC100040019 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257259 GeneID:100040019
definition	codon_start : 1 product : similar to hCG1796489 protein_id : XP_001474002.1

name	Lhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404413 CCDS:CCDS21242.1 GeneID:16866 MGI:96782
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : luteinizing hormone beta protein_id : NP_032523.2

name	Ruvbl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755382 CCDS:CCDS21243.1 GeneID:20174 MGI:1342299
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : RuvB-like protein 2 protein_id : NP_035434.1

name	Gys1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560022 CCDS:CCDS21244.1 GeneID:14936 MGI:101805
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004373 - glycogen (starch) synthase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005978 - glycogen biosynthesis [Evidence IMP]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 note : glycogen synthase 3, brain product : glycogen synthase 1, muscle protein_id : NP_109603.2

name	Ftl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326466 GeneID:14325 MGI:95589
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA] codon_start : 1 product : ferritin light chain 1 protein_id : NP_034370.2

name	Bax (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680770 CCDS:CCDS21246.1 GeneID:12028 MGI:99702
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0044445 - cytosolic part [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0008637 - apoptotic mitochondrial changes [Evidence IDA]; GO:0008635 - caspase activation via cytochrome c [Evidence IMP] [Evidence IDA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IMP]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence IMP]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0030264 - nuclear fragmentation [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0051260 - protein homooligomerization [Evidence IDA]; GO:0001844 - protein insertion into mitochondrial membrane during induction of apoptosis [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0043281 - regulation of caspase activity [Evidence IMP]; GO:0001836 - release of cytochrome c from mitochondria [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IMP]; GO:0009611 - response to wounding [Evidence IMP]; GO:0046666 - retinal cell programmed cell death [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : Bcl2-associated X protein protein_id : NP_031553.1

name	Dhdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229131 CCDS:CCDS21247.1 GeneID:71755 MGI:1919005
definition	GO_function : GO:0047115 - trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity [Evidence IEA] codon_start : 1 product : dihydrodiol dehydrogenase (dimeric) protein_id : NP_082179.1

name	Nucb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679158 GeneID:18220 MGI:97388
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : nucleobindin 1 protein_id : NP_032775.1

name	Tulp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930728 GeneID:56734 MGI:1861600
definition	GO_function : GO:0008081 - phosphoric diester hydrolase activity [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; testis specific phosphodiesterase product : tubby-like protein 2 isoform 2 protein_id : NP_001039020.1

name	Tulp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930722 GeneID:56734 MGI:1861600
definition	GO_function : GO:0008081 - phosphoric diester hydrolase activity [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis specific phosphodiesterase product : tubby-like protein 2 isoform 1 protein_id : NP_032833.2

name	Myd116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678978 CCDS:CCDS21249.1 GeneID:17872 MGI:1100516
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : myeloid differentiation primary response gene 116 protein_id : NP_032680.1

name	Plekha4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507325 GeneID:69217 MGI:1916467
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 note : phosphoinositol 3-phosphate binding protein-1 product : pleckstrin homology domain-containing, family A member 4 protein_id : NP_683729.1

name	Hsd17b14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098116 CCDS:CCDS21251.1 GeneID:66065 MGI:1913315
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dehydrogenase/reductase (SDR family) member 10 protein_id : NP_079606.2

name	Bcat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859514 CCDS:CCDS21252.1 GeneID:12036 MGI:1276534
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004084 - branched-chain-amino-acid transaminase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0009082 - branched chain family amino acid biosynthesis [Evidence IEA]; GO:0009083 - branched chain family amino acid catabolism [Evidence IMP]; GO:0009081 - branched chain family amino acid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : branched chain aminotransferase 2, mitochondrial protein_id : NP_033867.1

name	Fgf21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910218 CCDS:CCDS21253.1 GeneID:56636 MGI:1861377
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 21 protein_id : NP_064397.1

name	Fut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49355810 CCDS:CCDS21254.1 GeneID:14343 MGI:109375
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008107 - galactoside 2-alpha-L-fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : H transferase; beta-galactoside alpha-1,2-fucosyltransferase product : fucosyltransferase 1 protein_id : NP_032077.2

name	Izumo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301151 CCDS:CCDS21255.1 GeneID:73456 MGI:1920706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IC]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IDA] codon_start : 1 function : membrane fusion product : sperm-specific protein Izumo protein_id : NP_001018013.1

name	Rasip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676215 CCDS:CCDS21256.1 GeneID:69903 MGI:1917153
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0016459 - myosin [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0017016 - Ras GTPase binding [Evidence ISS] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras interacting protein 1 protein_id : NP_082820.1

name	5430432N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257305 GeneID:74490 MGI:1921740
definition	codon_start : 1 product : hypothetical protein LOC74490 protein_id : XP_001476167.1

name	Fut2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542827 CCDS:CCDS21258.1 GeneID:14344 MGI:109374
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0008417 - fucosyltransferase activity [Evidence IDA]; GO:0008107 - galactoside 2-alpha-L-fucosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IDA] codon_start : 1 note : GDP-L-fucose:beta-D-galactoside 2-alpha-1-fucosyltransferase product : fucosyltransferase 2 protein_id : NP_061364.2

name	Sec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910230 GeneID:56546 MGI:1928893
definition	GO_function : GO:0008417 - fucosyltransferase activity [Evidence IDA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 3; fucosyltransferase 10; GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III product : secretory blood group 1 protein_id : NP_064318.1

name	Gm484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490394 GeneID:243967 MGI:2685330
definition	codon_start : 1 product : hypothetical protein LOC243967 protein_id : NP_001028528.2

name	Car11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208838 CCDS:CCDS21259.1 GeneID:12348 MGI:1336193
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : CA-RP XI product : carbonic anhydrase 11 protein_id : NP_033930.1

name	Dbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393240 CCDS:CCDS21260.1 GeneID:13170 MGI:94866
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : D site albumin promoter binding protein protein_id : NP_058670.1

name	Sphk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981070 CCDS:CCDS21261.1 GeneID:56632 MGI:1861380
definition	GO_component : GO:0005829 - cytosol [Evidence IEP]; GO:0005624 - membrane fraction [Evidence IEP] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence IDA] [Evidence IMP]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017016 - Ras GTPase binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence NAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006669 - sphinganine-1-phosphate biosynthesis [Evidence NAS]; GO:0006670 - sphingosine metabolism [Evidence IMP] codon_start : 1 product : sphingosine kinase 2 protein_id : NP_064395.2

name	Sphk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42544000 CCDS:CCDS21261.1 GeneID:56632 MGI:1861380
definition	GO_component : GO:0005829 - cytosol [Evidence IEP]; GO:0005624 - membrane fraction [Evidence IEP] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017050 - D-erythro-sphingosine kinase activity [Evidence IDA] [Evidence IMP]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017016 - Ras GTPase binding [Evidence ISS]; GO:0008481 - sphinganine kinase activity [Evidence NAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0001568 - blood vessel development [Evidence IGI]; GO:0007420 - brain development [Evidence IGI]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006669 - sphinganine-1-phosphate biosynthesis [Evidence NAS]; GO:0006670 - sphingosine metabolism [Evidence IMP] codon_start : 1 product : sphingosine kinase 2 protein_id : NP_975009.1

name	Rpl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699424 GeneID:19899 MGI:98003
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L18 protein_id : NP_033103.2

name	4930403C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701676 GeneID:73813 MGI:1921063
definition	codon_start : 1 product : hypothetical protein LOC73813 protein_id : NP_001028342.1

name	Spaca4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312278 CCDS:CCDS21262.1 GeneID:69363 MGI:1916613
definition	codon_start : 1 exception : mismatches in translation product : sperm acrosomal membrane protein 14 protein_id : NP_081331.1

name	Sult2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567408 CCDS:CCDS21263.1 GeneID:54200 MGI:1926342
definition	GO_function : GO:0004027 - alcohol sulfotransferase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0000103 - sulfate assimilation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : hydroxysteroid sulfotransferase product : sulfotransferase family, cytosolic, 2B, member 1 protein_id : NP_059493.1

name	EG545963 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702115 GeneID:545963 MGI:3648578
definition	codon_start : 1 product : hypothetical protein LOC545963 protein_id : NP_001028964.1

name	Lmtk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828725 GeneID:381983 MGI:3039582
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lemur tyrosine kinase 3 protein_id : NP_001005511.1

name	Pscd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755186 GeneID:19158 MGI:1334255
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence ISS] codon_start : 1 note : cytohesin 2 product : pleckstrin homology, Sec7 and coiled-coil domains 2 protein_id : NP_035311.1

name	Kcnj14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122399 CCDS:CCDS21265.1 GeneID:211480 MGI:2384820
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium inwardly-rectifying channel J14 protein_id : NP_666075.1

name	Grwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956278 CCDS:CCDS21266.1 GeneID:101612 MGI:2141989
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : glutamate rich WD repeat protein GRWD product : glutamate-rich WD repeat containing 1 protein_id : NP_700468.1

name	Grin2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922606 CCDS:CCDS21267.1 GeneID:14814 MGI:95823
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : GluRepsilon4 product : glutamate receptor, ionotropic, NMDA2D (epsilon 4) protein_id : NP_032198.2

name	Kdelr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527170 CCDS:CCDS21268.1 GeneID:68137 MGI:1915387
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046923 - ER retention sequence binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006621 - protein retention in ER [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : KDEL endoplasmic reticulum protein retention receptor 1 protein_id : NP_598711.1

name	Syngr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587011 GeneID:58867 MGI:1928903
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : synaptogyrin 4 protein product : synaptogyrin 4 protein_id : NP_067457.2

name	Tmem143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450161 CCDS:CCDS21269.1 GeneID:70209 MGI:1917459
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70209 protein_id : NP_659050.1

name	Emp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753750 CCDS:CCDS21270.1 GeneID:13732 MGI:1098729
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : epithelial membrane protein 3 protein_id : NP_034259.1

name	BC013491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701754 CCDS:CCDS21271.1 GeneID:211535 MGI:2446120
definition	codon_start : 1 product : hypothetical protein LOC211535 protein_id : NP_001028415.1

name	Abcc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055156 CCDS:CCDS21272.1 GeneID:27421 MGI:1351634
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : multidrug resistance-associated protein-6 product : ATP-binding cassette, sub-family C, member 6 protein_id : NP_061265.1

name	Nomo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151748 CCDS:CCDS21273.1 GeneID:211548 MGI:2385850
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nodal modulator 1 protein_id : NP_694697.2

name	Kcnj11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754426 CCDS:CCDS21274.1 GeneID:16514 MGI:107501
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium unwardly rectifying channel, subfamily J, member 11 product : potassium inwardly rectifying channel, subfamily J, member 11 protein_id : NP_034732.1

name	Abcc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62241017 CCDS:CCDS21275.1 GeneID:20927 MGI:1352629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008281 - sulfonylurea receptor activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sulfonylurea receptor product : ATP-binding cassette, sub-family C (CFTR/MRP), member 8 protein_id : NP_035640.2

name	Ush1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281802 CCDS:CCDS21276.1 GeneID:72088 MGI:1919338
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform b3 is encoded by transcript variant b3 product : harmonin isoform b3 protein_id : NP_710143.1

name	Ush1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963769 GeneID:72088 MGI:1919338
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0001917 - photoreceptor inner segment [Evidence IDA]; GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform a1 is encoded by transcript variant a1 product : harmonin isoform a1 protein_id : NP_076138.1

name	Otog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257308 GeneID:18419 MGI:1202064
definition	codon_start : 1 product : otogelin protein_id : XP_001476864.1

name	Myod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996932 CCDS:CCDS21277.1 GeneID:17927 MGI:97275
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007517 - muscle development [Evidence IGI] [Evidence IDA]; GO:0007518 - myoblast cell fate determination [Evidence IDA]; GO:0045445 - myoblast differentiation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007519 - striated muscle development [Evidence TAS] [Evidence IGI] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myogenic differentiation 1 protein_id : NP_034996.1

name	Kcnc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680522 CCDS:CCDS21278.1 GeneID:16502 MGI:96667
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage gated channel, Shaw-related subfamily, member 1 protein_id : NP_032447.1

name	Sergef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305093 CCDS:CCDS21279.1 GeneID:27414 MGI:1351630
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : guanine nucleotide exchange factor (RCC1 related) protein_id : NP_038817.1

name	Rnu35b (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:23466421 GeneID:27212 MGI:1351321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U35b small nucleolar transcript_id : NR_000004.8

name	Rnu35a (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73912721 GeneID:27211 MGI:1351319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U35a small nucleolar transcript_id : NR_000003.8

name	Rnu34 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73661179 GeneID:27210 MGI:1351325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U34 small nucleolar transcript_id : NR_002455.1

name	Rnu33 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:29171312 GeneID:27208 MGI:1351323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U33 small nucleolar transcript_id : NR_001277.2

name	Rnu32 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73912722 GeneID:27209 MGI:1351324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U32 small nucleolar transcript_id : NR_000002.8

name	Mtag2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257186 GeneID:50994 MGI:1860766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis associated gene 2 transcript_id : XR_035719.1

name	LOC677321 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257306 GeneID:677321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 179 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G pseudo : _no_value transcript_id : XR_032868.1

clone name	MSMg01-324F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177I21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-353D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076J01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-178F10.b	B6Ng01-178F10.g
ACC	GA005354	GA005355
length	625	491
definition	B6Ng01-178F10.b	B6Ng01-178F10.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(52,739,210 - 52,739,488)	(108,324,153 - 108,324,648)
sequence	gaattcattaactctttgtgagccagggagaaaggaaaagaaaggaacaa gcacagacacacacacacacacacacacacacacacacacacacacacac tgggtgaagcagaaaagggtcacactaccactttattggtcctagttttt ttttttttttttttttggtttttcgagacagggtttctctgtgtagccct ggctgtcctggaactcactctgtagaccaagctggcctcgaactcagaaa tccgcctgcctctgcctcccgagtgctgggattaaaggcgtgcgccacca cgcccggctggtcctagtttttataccttctcaggaaaattgattacatg gttttctaagcacttttgcattccataagttcacagtaagtttaaggtaa tatttaatgtcataggtcggtaagctttaaggaattatagtagaattgtt tacatgtctttccattgagactagtacctgaccgaacattccttatctat tttctagctctacaagttcattataagtttaaaccaatagtttttttgtt tttttgtttttttgttttttttgtttgtttgtttgttttttttttacttt tcttcgagacagggtttctctgtat	tttcttacatgtttgtacaaatgtgcacctcatgcattcatgagcacagt ggtccatcagaagaggatatggagtccctagaaatgaagttaaagacagt tgtgagctgccactcttgtgctagaaatagaatcagtaattgagtgctct taactgttggaccatttttccatcctatggaaaagagtcttaaataatga agtgccacatctaagtagcacctctgttggttttttgttgttgttgttgt tgttttttgtttgtttgtttgtttgtttttcgagacagggtttctctgta tagctctggctgtcctggaactcactctgtagaccaggctggcctcatgg cctcaaactcagaaatccgcctgcctccgcctcctgagtgctgggattaa aggcatgcaccaccacgccccgctgttggttttttttttttttttttttt aaagatttatttatttatttttctattatatgttaagttca
quality values	Open. Hide. 62 24 43 42 62 37 21 54 47 56 56 56 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 59 59 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 56 42 49 56 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 59 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 50 50 50 34 46 46 49 50 48 18 43 30 46 34 31 45 59 46 46 50 49 43 38 43 43 46 34 36 34 43 34 43 59 50 46 51 50 27 43 50 31 34 38 38 59 56 59 59 51 51 51 49 46 48 50 46 46 34 48 24 46 46 46 49 43 36 38 50 50 50 34 48 38 50 23 31 56 49 46 43 37 18 48 51 59 51 43 49 30 39 45 28 56 43 46 39 49 43 56 34 43 39 39 38 34 28 51 39 23 49 30 34 38 56 34 38 39 34 34 43 51 27 45 18 27 23 46 39 34 49 49 34 43 50 34 46 28 28 50 59 40 50 23 38 46 49 27 41 49 39 49 27 34 46 51 46 49 51 50 46 41 43 34 38 40 34 38 37 30 56 56 59 50 49 39 48 32 48 43 46 43 49 39 50 56 50 34 49 51 59 56 50 43 51 30 39 43 43 48 56 56 45 48 43 40 50 50 46 48 43 49 46 51 43 46 56 56 49 50 48 36 38 46 56 51 56 51 49 43 46 35 59 30 34 46 38 34 28 35 43 43 51 43 56 34 51 41 49 56 34 56 34 36 38 50 34 49 51 43 49 51 43 43 34 38 28 50 51 49 43 49 50 48 48 27 30 46 23 48 46 39 46 49 24 36 36 41 59 50 59 56 43 43 49 46 50 49 51 39 48 51 51 48 23 38 39 39 43 23 24 43 39 45 37 50 46 43 50 24 56 59 56 56 43 45 34 34 37 59 59 59 56 56 56 56 46 38 33 45 45 44 39 39 50 50 50 45 51 34 50 39 38 35 35 43 43 44 44 51 56 59 50 62 43 62 56 62 44 37 51 38 50 32 44 44 32 56 56 62 47 47 51 47 42 51 56 56 62 56 56 44 24 56 51 50 44 56 51 56 33 50 43 51 56 37 38 38 39 21 30 31 37 14 14 34 38 14 21 23 30 17 20 20 56 56 27 38 21 27 10 46 39 43 26 30 32 39 22 16 27 15 22 10 22 22 17 17 38 30 26 39 32 40 30 17 38 27 10 10 7	Open. Hide. 62 62 62 62 62 54 62 59 39 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 59 62 62 62 59 62 62 54 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 59 62 62 62 59 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 51 62 59 62 62 62 62 54 54 62 62 54 62 62 62 62 62 62 62 62 59 56 59 62 59 62 62 62 59 59 62 50 50 56 59 62 50 59 59 48 54 51 43 51 56 34 50 59 46 54 43 62 59 59 59 51 59 50 59 62 62 51 59 62 62 59 62 59 59 19 28 23 30 18 27 56 51 62 62 54 25 54 59 59 59 59 59 46 56 62 62 62 62 62 49 49 51 39 43 51 62 62 43 34 46 45 34 41 59 49 51 59 43 54 62 59 59 59 59 59 59 62 49 46 50 59 50 30 39 39 28 34 36 34 46 35 50 56 50 50 36 48 56 59 51 50 50 43 34 49 41 36 43 59 59 59 59 39 40 34 31 30 34 19 15 15 14 16 17 18 18 8 10 17 13 10 10 8 11 12 14 13 14 11 20 10 14 12 8 12 18 6 11 8 21 34 23 17 16 23 24 22 13 11 21 8 17 9 13 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_52739210_52739488
seq2: B6Ng01-178F10.b_193_672 (reverse)

seq1  ATACAGAGAAACCCTGTCTCGAA------------------AAACA---A  29
      |||||||||||||||||||||||                  |||||   |
seq2  ATACAGAGAAACCCTGTCTCGAAGAAAAGTAAAAAAAAAACAAACAAACA  50

seq1  AACAAAACAAAGCAAAACAAAGCAAAACAAAAAAA-------GTTAAAGT  72
      ||||||| |||  |||| | |  ||||||||||||        ||||| |
seq2  AACAAAAAAAACAAAAAAACAAAAAAACAAAAAAACTATTGGTTTAAACT  100

seq1  T-------------------------TAAATAACGA--------------  83
      |                         || |||| ||              
seq2  TATAATGAACTTGTAGAGCTAGAAAATAGATAAGGAATGTTCGGTCAGGT  150

seq1  --------------------------------------------------  83
                                                        
seq2  ACTAGTCTCAATGGAAAGACATGTAAACAATTCTACTATAATTCCTTAAA  200

seq1  -------------------TAAAT--------------------------  88
                         |||||                          
seq2  GCTTACCGACCTATGACATTAAATATTACCTTAAACTTACTGTGAACTTA  250

seq1  ----TTGCAA------TTA---------GTATT--GTTTT----------  107
           |||||      |||         ||| |   ||||          
seq2  TGGAATGCAAAAGTGCTTAGAAAACCATGTAATCAATTTTCCTGAGAAGG  300

seq1  -----------GG----GCCGGGTGTGGTGGTGCACGCCTTTAATCTTAG  142
                 ||    |||||| ||||||| ||||||||||||||  ||
seq2  TATAAAAACTAGGACCAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAG  350

seq1  CACTTGGGAGGCAGAGGCAGGCGGATTTTTGAGTTCGAGGCCAGCCTGGT  192
      |||| ||||||||||||||||||||||| |||||||||||||||| ||||
seq2  CACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCTTGGT  400

seq1  CTACAAAGTGAGTTCCAGGACACCCAGGGCTACACAGAGAAACCCTGTCT  242
      ||||| |||||||||||||||| |||||||||||||||||||||||||||
seq2  CTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCT  450

seq1  CAAAAAAACCAAAAAAATAACCCAAAAAACAAAAAAA  279
      |  ||||||||||||||      |||||| |||||||
seq2  C-GAAAAACCAAAAAAA------AAAAAAAAAAAAAA  480

seq1: chr5_108324153_108324648
seq2: B6Ng01-178F10.g_64_560

seq1  GAATTCTTTCTTACATGTTTGTACAAATGTGCACCTCATGCATTCATGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCTTACATGTTTGTACAAATGTGCACCTCATGCATTCATGAG  50

seq1  CACAGTGGTCCATCAGAAGAGGATATGGAGTCCCTAGAAATGAAGTTAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTGGTCCATCAGAAGAGGATATGGAGTCCCTAGAAATGAAGTTAAA  100

seq1  GACAGTTGTGAGCTGCCACTCTTGTGCTAGAAATAGAATCAGTAATTGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGTTGTGAGCTGCCACTCTTGTGCTAGAAATAGAATCAGTAATTGAG  150

seq1  TGCTCTTAACTGTTGGACCATTTTTCCATCCTATGGAAAAGAGTCTTAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTTAACTGTTGGACCATTTTTCCATCCTATGGAAAAGAGTCTTAAA  200

seq1  TAATGAAGTGCCACATCTAAGTAGCACCTCTGTTGGTTTTTTGTTGTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGAAGTGCCACATCTAAGTAGCACCTCTGTTGGTTTTTTGTTGTTGT  250

seq1  TGTTGTTGTTTTTTGTTTGTTTGTTTGTTTGTTTTTCGAGACAGGGTTTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGTTGTTTTTTGTTTGTTTGTTTGTTTGTTTTTCGAGACAGGGTTTC  300

seq1  TCTGTATAGCTCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTATAGCTCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCC  350

seq1  TCATGGCCTCAAACTCAGAAATCCGCCTGCCTCCGCCTCCTGAGTGCTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGGCCTCAAACTCAGAAATCCGCCTGCCTCCGCCTCCTGAGTGCTGG  400

seq1  GATTAAAGGCATGCACCACCACGCCCCGCTGTTGGTTTTTTTTTTTTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAAAGGCATGCACCACCACGCCCCGCTGTTGGTTTTTTTTTTTTTTT  450

seq1  TTTTTTAAAGATTTATTTATTTATTTATTTATTATATG-TAAGTACA  496
      |||||||||||||||||||||||||| | ||||||||| ||||| ||
seq2  TTTTTTAAAGATTTATTTATTTATTTTTCTATTATATGTTAAGTTCA  497

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information