MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-188E03
Chromosome	7 (Build37)
Map Location	30,138,294 - 30,139,331
singlet/doublet	singlet
Overlap gene	Sipa1l3
Upstream gene	Plekhg2, Zfp36, Ixl, Paf1, Samd4b, 1700085B13Rik, Gmfg, Lrfn1, LOC624672, 1700028B04Rik, EG330496, Il28, Sycn, 1190020J12Rik, Pak4, C330005M16Rik, Fbxo27, Fbxo17, Mrps12, Sars2, EG624918, Nfkbib, Sirt2, 5830482F20Rik, Hnrpl, Ech1, Lgals4, Lgals7, Capn12, Actn4, Eif3s12, Map4k1, Ryr1, Rasgrp4, 1110006G06Rik, Spred3, Ggn, Psmd8, A230107C01Rik, Kcnk6, Yif1b, Spint2, Ppp1r14a, Neud4
Downstream gene	LOC100043791, 4932431P20Rik, 4930432E11Rik, 1700067C01Rik, Zfp84, LOC100043794, Zfp30, EG625349, 6330581L23Rik, BC027344, Zfp420, Zfp27, Zfp74, LOC625437, LOC100043796, Zfp568, Zfp14, LOC100043798, Zfp82, Zfp566, Zfp260, Zfp382, Zfp146, EG330503, Cox7a1, Capns1, Tbcb, Polr2i, Ovol3, Wdr62, EG668354, 1700020L13Rik, Clip3, Alkbh6, AI428936, 0610010E21Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Plekhg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101497 MGI:2141874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22695 MGI:99180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ixl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67224 MGI:1914474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54624 MGI:1923988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Samd4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233033 MGI:2448542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700085B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76721 MGI:1923971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Gmfg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lrfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80749 MGI:2136810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	1700028B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70001 MGI:1917251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	EG330496 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330496 MGI:3647279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338374 MGI:2450574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sycn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68416 MGI:1915666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190020J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233038 MGI:2685009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pak4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70584 MGI:1917834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330005M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101744 MGI:2142121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233040 MGI:2685007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50760 MGI:1354707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24030 MGI:1346333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71984 MGI:1919234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624918 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624918 MGI:3645242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Nfkbib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18036 MGI:104752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64383 MGI:1927664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830482F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320435 MGI:2444024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15388 MGI:104816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ech1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51798 MGI:1858208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16855 MGI:107536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16858 MGI:1316742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60594 MGI:1891369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60595 MGI:1890773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73830 MGI:1921080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map4k1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26411 MGI:1346882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ryr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20190 MGI:99659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasgrp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233046 MGI:2386851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110006G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73833 MGI:1921083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spred3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101809 MGI:2142186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243897 MGI:2181461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Psmd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57296 MGI:1888669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230107C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320225 MGI:2443617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52150 MGI:1891291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77254 MGI:1924504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spint2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20733 MGI:1338031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppp1r14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68458 MGI:1931139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neud4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29861 MGI:1352748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sipa1l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74206 MGI:1921456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs

name	4932431P20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114675 MGI:2149781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	4930432E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243900 MGI:3045259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	1700067C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76718 MGI:1923968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74352 MGI:107780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Zfp30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22693 MGI:99178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625349 MGI:3643038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 196 ESTs

name	6330581L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233056 MGI:1923431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC027344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233057 MGI:2446235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs

name	Zfp27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72723 MGI:107784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043796 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 411 ESTs, 4 Proteins

name	Zfp568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243905 MGI:2142347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330502 MGI:1890753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp566 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72556 MGI:1919806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26466 MGI:1347071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233060 MGI:3588204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26465 MGI:1347092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330503 MGI:3644651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12865 MGI:1316714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12336 MGI:88266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbcb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66411 MGI:1913661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69920 MGI:1917170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovol3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381867 MGI:2388075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Wdr62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233064 MGI:1923696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins

name	EG668354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668354 MGI:3644977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 4 Proteins pseudo : _no_value

name	1700020L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75629 MGI:1922879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Clip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76686 MGI:1923936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alkbh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233065 MGI:2142037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI428936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233066 MGI:2141950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68332 MGI:1915582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446220 GeneID:101497 MGI:2141874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 2 transcript_id : NM_001083912.1

name	Plekhg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922715 GeneID:101497 MGI:2141874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 2 transcript_id : NM_138752.2

name	Zfp36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130057 GeneID:22695 MGI:99180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 36 transcript_id : NM_011756.4

name	Ixl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754100 GeneID:67224 MGI:1914474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intersex-like (Drosophila) transcript_id : NM_026042.2

name	Paf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891702 GeneID:54624 MGI:1923988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) transcript_id : NM_019458.3

name	Samd4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375565 GeneID:233033 MGI:2448542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterile alpha motif domain containing 4B transcript_id : NM_175021.2

name	1700085B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256489 GeneID:76721 MGI:1923971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700085B13 gene transcript_id : XM_001479846.1

name	Gmfg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861214 GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glia maturation factor, gamma transcript_id : NM_022024.2

name	Gmfg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861221 GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glia maturation factor, gamma transcript_id : NM_001039192.1

name	Lrfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385437 GeneID:80749 MGI:2136810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and fibronectin type III domain containing 1 transcript_id : NM_030562.1

name	EG330496 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130494424 GeneID:330496 MGI:3647279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330496 transcript_id : NM_001024673.2

name	Il28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28893578 GeneID:338374 MGI:2450574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 28 transcript_id : NM_177396.1

name	Sycn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754041 GeneID:68416 MGI:1915666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syncollin transcript_id : NM_026716.2

name	1190020J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487434 GeneID:233038 MGI:2685009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190020J12 gene transcript_id : NM_001081115.1

name	Pak4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672923 GeneID:70584 MGI:1917834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p21 (CDKN1A)-activated kinase 4 transcript_id : NM_027470.3

name	C330005M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377644 GeneID:101744 MGI:2142121
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330005M16 gene transcript_id : NM_175319.3

name	Fbxo27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802348 GeneID:233040 MGI:2685007
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 27 transcript_id : NM_207238.2

name	Fbxo17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657080 GeneID:50760 MGI:1354707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 17 transcript_id : NM_015796.1

name	Mrps12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803235 GeneID:24030 MGI:1346333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S12 transcript_id : NM_011885.3

name	Sars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963764 GeneID:71984 MGI:1919234
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seryl-aminoacyl-tRNA synthetase 2 transcript_id : NM_023637.1

name	EG624918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380082 GeneID:624918 MGI:3645242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG624918 transcript_id : XM_898523.2

name	Nfkbib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130180 GeneID:18036 MGI:104752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta transcript_id : NM_010908.4

name	Sirt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364001 GeneID:64383 MGI:1927664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae) transcript_id : NM_022432.3

name	5830482F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379968 GeneID:320435 MGI:2444024
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830482F20 gene transcript_id : NM_177158.3

name	Hnrpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130380 GeneID:15388 MGI:104816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein L transcript_id : NM_177301.4

name	Ech1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949036 GeneID:51798 MGI:1858208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl coenzyme A hydratase 1, peroxisomal transcript_id : NM_016772.1

name	Lgals4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849704 GeneID:16855 MGI:107536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 4 transcript_id : NM_010706.1

name	Lgals7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49619226 GeneID:16858 MGI:1316742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 7 transcript_id : NM_008496.4

name	Capn12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11230799 GeneID:60594 MGI:1891369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 12 transcript_id : NM_021894.1

name	Actn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18702319 GeneID:60595 MGI:1890773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actinin alpha 4 transcript_id : NM_021895.2

name	Eif3s12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359029 GeneID:73830 MGI:1921080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 12 transcript_id : NM_028659.2

name	Map4k1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101944152 GeneID:26411 MGI:1346882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase kinase 1 transcript_id : NM_008279.2

name	Ryr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046266 GeneID:20190 MGI:99659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ryanodine receptor 1, skeletal muscle transcript_id : NM_009109.2

name	Rasgrp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378014 GeneID:233046 MGI:2386851
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS guanyl releasing protein 4 transcript_id : NM_145149.3

name	1110006G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345599 GeneID:73833 MGI:1921083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110006G06 gene transcript_id : NM_028661.2

name	Spred3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254389 GeneID:101809 MGI:2142186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sprouty-related, EVH1 domain containing 3 transcript_id : NM_182927.2

name	Ggn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173828 GeneID:243897 MGI:2181461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gametogenetin transcript_id : NM_182694.2

name	Ggn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130677 GeneID:243897 MGI:2181461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gametogenetin transcript_id : NM_182696.2

name	Psmd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802467 GeneID:57296 MGI:1888669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 transcript_id : NM_026545.2

name	A230107C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802271 GeneID:320225 MGI:2443617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230107C01 gene transcript_id : NM_001039721.2

name	Kcnk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802767 GeneID:52150 MGI:1891291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily K, member 6 transcript_id : NM_001033525.2

name	Yif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803382 GeneID:77254 MGI:1924504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 interacting factor homolog B (S. cerevisiae) transcript_id : NM_029887.2

name	Spint2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139426 GeneID:20733 MGI:1338031
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine protease inhibitor, Kunitz type 2 transcript_id : NM_001082548.1

name	Spint2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127138977 GeneID:20733 MGI:1338031
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine protease inhibitor, Kunitz type 2 transcript_id : NM_011464.2

name	Ppp1r14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891709 GeneID:68458 MGI:1931139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 14A transcript_id : NM_026731.3

name	Neud4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130893 GeneID:29861 MGI:1352748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal d4 domain family member transcript_id : NM_013874.2

name	Sipa1l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486629 GeneID:74206 MGI:1921456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal-induced proliferation-associated 1 like 3 transcript_id : NM_001081028.1

name	LOC100043791 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256675 GeneID:100043791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs product : hypothetical protein LOC100043791 transcript_id : XM_001481062.1

name	1700067C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922672 GeneID:76718 MGI:1923968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700067C01 gene transcript_id : NM_029714.2

name	Zfp84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865960 GeneID:74352 MGI:107780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 84 transcript_id : NM_023750.2

name	LOC100043794 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256677 GeneID:100043794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100043794 transcript_id : XM_001481066.1

name	Zfp30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305644 GeneID:22693 MGI:99178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 30 transcript_id : NM_013705.1

name	EG625349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256495 GeneID:625349 MGI:3643038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 196 ESTs product : predicted gene, EG625349 transcript_id : XM_889916.3

name	6330581L23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122722 GeneID:233056 MGI:1923431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330581L23 gene transcript_id : NM_146185.1

name	BC027344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343455 GeneID:233057 MGI:2446235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC027344 transcript_id : NM_173738.2

name	Zfp420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256681 GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : zinc finger protein 420, transcript variant 2 transcript_id : XM_001481071.1

name	Zfp420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256679 GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : zinc finger protein 420, transcript variant 1 transcript_id : XM_001481070.1

name	Zfp27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83416320 GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 27 transcript_id : NM_011754.2

name	Zfp27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83416318 GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 27 transcript_id : NM_001037707.1

name	Zfp74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341627 GeneID:72723 MGI:107784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 74 transcript_id : NM_178384.2

name	LOC100043796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256685 GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 378 ESTs, 4 Proteins product : similar to macrophage migration inhibitory factor, transcript variant 2 transcript_id : XM_001481076.1

name	LOC100043796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256683 GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 410 ESTs, 4 Proteins product : similar to macrophage migration inhibitory factor, transcript variant 1 transcript_id : XM_001481075.1

name	Zfp568 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803302 GeneID:243905 MGI:2142347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 568 transcript_id : NM_001033355.2

name	Zfp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641900 GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 14 transcript_id : NM_178733.5

name	Zfp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641899 GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 14 transcript_id : NM_011748.2

name	LOC100043798 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256687 GeneID:100043798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043798 transcript_id : XM_001481083.1

name	Zfp82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83423529 GeneID:330502 MGI:1890753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 82 transcript_id : NM_177889.3

name	Zfp566 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269713 GeneID:72556 MGI:1919806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 566 transcript_id : NM_152814.2

name	Zfp260 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741879 GeneID:26466 MGI:1347071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 260 transcript_id : NM_011981.4

name	Zfp382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486593 GeneID:233060 MGI:3588204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 382 transcript_id : NM_001081007.1

name	Zfp146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116642879 GeneID:26465 MGI:1347092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 146 transcript_id : NM_011980.3

name	EG330503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802898 GeneID:330503 MGI:3644651
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330503 transcript_id : NM_001033540.2

name	Cox7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816960 GeneID:12865 MGI:1316714
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIa 1 transcript_id : NM_009944.3

name	Capns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802724 GeneID:12336 MGI:88266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain, small subunit 1 transcript_id : NM_009795.3

name	Tbcb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801754 GeneID:66411 MGI:1913661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin folding cofactor B transcript_id : NM_025548.2

name	Polr2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625756 GeneID:69920 MGI:1917170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide I transcript_id : NM_027259.1

name	Ovol3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256497 GeneID:381867 MGI:2388075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : OVO homolog-like 3 (Drosophila) transcript_id : XM_355880.5

name	Wdr62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380132 GeneID:233064 MGI:1923696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins product : WD repeat domain 62, transcript variant 2 transcript_id : XM_891376.2

name	1700020L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380105 GeneID:75629 MGI:1922879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700020L13 gene transcript_id : XM_001000510.1

name	Clip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487424 GeneID:76686 MGI:1923936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAP-GLY domain containing linker protein 3 transcript_id : NM_001081114.1

name	Alkbh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38569507 GeneID:233065 MGI:2142037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 6 (E. coli) transcript_id : NM_198027.2

name	AI428936 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886478 GeneID:233066 MGI:2141950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI428936 transcript_id : NM_153577.2

name	0610010E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118962 GeneID:68332 MGI:1915582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010E21 gene transcript_id : NM_001033140.3

name	Plekhg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446221 GeneID:101497 MGI:2141874
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; common-site lymphoma/leukemia GEF product : common-site lymphoma/leukemia guanine nucleotide exchange factor isoform b protein_id : NP_001077381.1

name	Plekhg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922716 CCDS:CCDS21040.1 GeneID:101497 MGI:2141874
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; common-site lymphoma/leukemia GEF product : common-site lymphoma/leukemia guanine nucleotide exchange factor isoform a protein_id : NP_620091.2

name	Zfp36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756059 CCDS:CCDS21041.1 GeneID:22695 MGI:99180
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS] [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0050728 - negative regulation of inflammatory response [Evidence IMP]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IMP]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0043488 - regulation of mRNA stability [Evidence IDA]; GO:0050779 - RNA destabilization [Evidence IMP] codon_start : 1 note : tristetraprolin product : zinc finger protein 36 protein_id : NP_035886.1

name	Ixl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754101 CCDS:CCDS21042.1 GeneID:67224 MGI:1914474
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : intersex-like protein_id : NP_080318.2

name	Paf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980912 CCDS:CCDS21043.1 GeneID:54624 MGI:1923988
definition	codon_start : 1 product : Paf1, RNA polymerase II associated factor, homolog protein_id : NP_062331.2

name	Samd4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239399 CCDS:CCDS21044.1 GeneID:233033 MGI:2448542
definition	codon_start : 1 exception : mismatches in translation product : sterile alpha motif domain containing 4B protein_id : NP_778186.1

name	1700085B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256490 GeneID:76721 MGI:1923971
definition	codon_start : 1 product : hypothetical protein LOC76721 protein_id : XP_001479896.1

name	Gmfg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11993950 GeneID:63986 MGI:1927135
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : glia maturation factor, gamma isoform 1 protein_id : NP_071307.1

name	Gmfg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861222 GeneID:63986 MGI:1927135
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : glia maturation factor, gamma isoform 2 protein_id : NP_001034281.1

name	Lrfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385438 CCDS:CCDS21045.1 GeneID:80749 MGI:2136810
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : synaptic differentiation enhancing molecule 1 product : leucine rich repeat and fibronectin type III domain containing 1 protein_id : NP_085039.1

name	EG330496 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130494425 GeneID:330496 MGI:3647279
definition	codon_start : 1 note : IFN-lambda2 product : interferon-lambda2 protein_id : NP_001019844.2

name	Il28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893579 CCDS:CCDS21047.1 GeneID:338374 MGI:2450574
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha product : interleukin 28 protein_id : NP_796370.1

name	Sycn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754042 CCDS:CCDS21048.1 GeneID:68416 MGI:1915666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : syncollin protein_id : NP_080992.2

name	1190020J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487435 GeneID:233038 MGI:2685009
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233038 protein_id : NP_001074584.1

name	Pak4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336032 CCDS:CCDS21049.1 GeneID:70584 MGI:1917834
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : p21-activated protein kinase 4 protein_id : NP_081746.1

name	C330005M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425000 CCDS:CCDS21050.1 GeneID:101744 MGI:2142121
definition	codon_start : 1 product : hypothetical protein LOC101744 protein_id : NP_780528.1

name	Fbxo27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402223 CCDS:CCDS21051.1 GeneID:233040 MGI:2685007
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box only protein 27 protein_id : NP_997121.1

name	Fbxo17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657081 GeneID:50760 MGI:1354707
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 17 product : F-box protein 17 protein_id : NP_056611.1

name	Mrps12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755360 CCDS:CCDS21052.1 GeneID:24030 MGI:1346333
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, S12; mitoribosomal protein s12 product : mitochondrial ribosomal protein S12 protein_id : NP_036015.1

name	Sars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963765 CCDS:CCDS21053.1 GeneID:71984 MGI:1919234
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004828 - serine-tRNA ligase activity [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006434 - seryl-tRNA aminoacylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : seryl-aminoacyl-tRNA synthetase 2 protein_id : NP_076126.1

name	EG624918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380083 GeneID:624918 MGI:3645242
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903616.2

name	Nfkbib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24111253 CCDS:CCDS21054.1 GeneID:18036 MGI:104752
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : I(Kappa)B(beta) product : nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta protein_id : NP_035038.2

name	Sirt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982681 CCDS:CCDS21055.1 GeneID:64383 MGI:1927664
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] [Evidence ISS] GO_function : GO:0035035 - histone acetyltransferase binding [Evidence ISS]; GO:0042826 - histone deacetylase binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017136 - NAD-dependent histone deacetylase activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0042903 - tubulin deacetylase activity [Evidence ISS]; GO:0043130 - ubiquitin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0045843 - negative regulation of striated muscle development [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006980 - redox signal response [Evidence ISS]; GO:0007096 - regulation of exit from mitosis [Evidence ISS]; GO:0042325 - regulation of phosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : silent mating type information regulation 2, (S.cerevisiae, homolog)-like product : sirtuin 2 (silent mating type information regulation 2, homolog) 2 protein_id : NP_071877.2

name	5830482F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893141 CCDS:CCDS21056.1 GeneID:320435 MGI:2444024
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320435 protein_id : NP_796132.1

name	Hnrpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33667042 GeneID:15388 MGI:104816
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0045120 - pronucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein L protein_id : NP_796275.2

name	Ech1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949037 CCDS:CCDS21057.1 GeneID:51798 MGI:1858208
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : peroxisomal/mitochondrial dienoyl-CoA isomerase product : enoyl coenzyme A hydratase 1, peroxisomal protein_id : NP_058052.1

name	Lgals4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849705 CCDS:CCDS21058.1 GeneID:16855 MGI:107536
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : lectin, galactose binding, soluble 4 protein_id : NP_034836.1

name	Lgals7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543120 CCDS:CCDS21060.1 GeneID:16858 MGI:1316742
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : lectin, galactose binding, soluble 7 protein_id : NP_032522.2

name	Capn12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230800 GeneID:60594 MGI:1891369
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 function : protease product : calpain 12 protein_id : NP_068694.1

name	Actn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230802 CCDS:CCDS21061.1 GeneID:60595 MGI:1890773
definition	GO_component : GO:0030863 - cortical cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0031143 - pseudopodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence TAS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051271 - negative regulation of cell motility [Evidence IDA]; GO:0051272 - positive regulation of cell motility [Evidence IDA] [Evidence IMP]; GO:0048549 - positive regulation of pinocytosis [Evidence IMP] codon_start : 1 function : cytoskeleton protein product : actinin alpha 4 protein_id : NP_068695.1

name	Eif3s12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312044 CCDS:CCDS21062.1 GeneID:73830 MGI:1921080
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 3, subunit 12 protein_id : NP_082935.1

name	Map4k1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101944153 GeneID:26411 MGI:1346882
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0045610 - regulation of hemocyte differentiation [Evidence IEP]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : hematopoietic progenitor kinase 1 product : mitogen activated protein kinase kinase kinase kinase 1 protein_id : NP_032305.2

name	Ryr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046267 GeneID:20190 MGI:99659
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0030314 - junctional membrane complex [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005219 - ryanodine-sensitive calcium-release channel activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IEA]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006937 - regulation of muscle contraction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : skeletal muscle ryanodine receptor; calcium release channel product : ryanodine receptor 1, skeletal muscle protein_id : NP_033135.2

name	Rasgrp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043802 GeneID:233046 MGI:2386851
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS guanyl releasing protein 4 protein_id : NP_660131.2

name	1110006G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312032 GeneID:73833 MGI:1921083
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73833 protein_id : NP_082937.1

name	Spred3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254390 CCDS:CCDS21065.1 GeneID:101809 MGI:2142186
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005173 - stem cell factor receptor binding [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0000188 - inactivation of MAPK activity [Evidence IMP]; GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Sprouty-related EVH1 domain-containing protein protein_id : NP_891557.2

name	Ggn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173829 GeneID:243897 MGI:2181461
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence NAS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007276 - gametogenesis [Evidence IEP]; GO:0006461 - protein complex assembly [Evidence NAS]; GO:0008104 - protein localization [Evidence IEP] [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : gametogenetin isoform 1 protein_id : NP_874353.2

name	Ggn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33186865 CCDS:CCDS21067.1 GeneID:243897 MGI:2181461
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence NAS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007276 - gametogenesis [Evidence IEP]; GO:0006461 - protein complex assembly [Evidence NAS]; GO:0008104 - protein localization [Evidence IEP] [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : gametogenetin isoform 3 protein_id : NP_874355.1

name	Psmd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229063 GeneID:57296 MGI:1888669
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proteasome 26S non-ATPase subunit 8 protein_id : NP_080821.2

name	A230107C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886437 GeneID:320225 MGI:2443617
definition	codon_start : 1 product : hypothetical protein LOC320225 protein_id : NP_001034810.1

name	Kcnk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370290 CCDS:CCDS21068.1 GeneID:52150 MGI:1891291
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TWIK-2 two-pore-domain K+ channel product : potassium inwardly-rectifying channel, subfamily K, member 6 protein_id : NP_001028697.1

name	Yif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62339417 CCDS:CCDS21069.1 GeneID:77254 MGI:1924504
definition	codon_start : 1 exception : mismatches in translation product : Yip1 interacting factor homolog B protein_id : NP_084163.1

name	Spint2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139427 GeneID:20733 MGI:1338031
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : serine protease inhibitor, Kunitz type 2 isoform b protein_id : NP_001076017.1

name	Spint2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563278 GeneID:20733 MGI:1338031
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : serine protease inhibitor, Kunitz type 2 isoform a protein_id : NP_035594.1

name	Ppp1r14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754044 CCDS:CCDS21070.1 GeneID:68458 MGI:1931139
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 14A protein_id : NP_081007.2

name	Neud4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305309 CCDS:CCDS21071.1 GeneID:29861 MGI:1352748
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : neuro-d4 product : neuronal d4 domain family member protein_id : NP_038902.1

name	Sipa1l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486630 GeneID:74206 MGI:1921456
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : signal-induced proliferation-associated 1 like 3 protein_id : NP_001074497.1

name	LOC100043791 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256676 GeneID:100043791
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481112.1

name	1700067C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810284 GeneID:76718 MGI:1923968
definition	codon_start : 1 product : hypothetical protein LOC76718 protein_id : NP_083990.1

name	Zfp84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789231 CCDS:CCDS21074.1 GeneID:74352 MGI:107780
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 69 product : zinc finger protein 84 protein_id : NP_076239.1

name	LOC100043794 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256678 GeneID:100043794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481116.1

name	Zfp30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305645 CCDS:CCDS21075.1 GeneID:22693 MGI:99178
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 30 protein_id : NP_038733.1

name	EG625349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256496 GeneID:625349 MGI:3643038
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895009.3

name	6330581L23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122723 GeneID:233056 MGI:1923431
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233056 protein_id : NP_666297.1

name	BC027344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424581 GeneID:233057 MGI:2446235
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233057 protein_id : NP_776099.1

name	Zfp420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256680 GeneID:233058 MGI:2444666
definition	codon_start : 1 product : zinc finger protein 420 isoform 1 protein_id : XP_001481120.1

name	Zfp420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256682 GeneID:233058 MGI:2444666
definition	codon_start : 1 product : zinc finger protein 420 isoform 2 protein_id : XP_001481121.1

name	Zfp27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83416319 CCDS:CCDS21076.1 GeneID:22689 MGI:99174
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 27 protein_id : NP_001032796.1

name	Zfp27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83416321 CCDS:CCDS21076.1 GeneID:22689 MGI:99174
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 27 protein_id : NP_035884.2

name	Zfp74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410002 GeneID:72723 MGI:107784
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 74 protein_id : NP_848471.1

name	LOC100043796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256684 GeneID:100043796
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor isoform 1 protein_id : XP_001481125.1

name	LOC100043796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256686 GeneID:100043796
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor isoform 2 protein_id : XP_001481126.1

name	Zfp568 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701844 CCDS:CCDS21077.1 GeneID:243905 MGI:2142347
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 568 protein_id : NP_001028527.1

name	Zfp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699450 GeneID:243906 MGI:99160
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 14 protein_id : NP_035878.1

name	Zfp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520165 GeneID:243906 MGI:99160
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 14 protein_id : NP_848848.1

name	LOC100043798 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256688 GeneID:100043798
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481133.1

name	Zfp82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83423530 GeneID:330502 MGI:1890753
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 82 protein_id : NP_808557.2

name	Zfp566 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779907 GeneID:72556 MGI:1919806
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 566 protein_id : NP_690027.1

name	Zfp260 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544063 CCDS:CCDS21078.1 GeneID:26466 MGI:1347071
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 260 protein_id : NP_036111.2

name	Zfp382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486594 GeneID:233060 MGI:3588204
definition	codon_start : 1 product : zinc finger protein 382 protein_id : NP_001074476.1

name	Zfp146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756047 CCDS:CCDS21079.1 GeneID:26465 MGI:1347092
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : zinc finger protein 146 protein_id : NP_036110.1

name	EG330503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702043 CCDS:CCDS21080.1 GeneID:330503 MGI:3644651
definition	codon_start : 1 product : hypothetical protein B430201F14 protein_id : NP_001028712.1

name	Cox7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753504 CCDS:CCDS21081.1 GeneID:12865 MGI:1316714
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005751 - respiratory chain complex IV (sensu Eukaryota) [Evidence ISS] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence ISS] [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0045333 - cellular respiration [Evidence ISS]; GO:0006118 - electron transport [Evidence ISS] [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit VIIa 1 protein_id : NP_034074.1

name	Capns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227381 CCDS:CCDS21082.1 GeneID:12336 MGI:88266
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IMP] codon_start : 1 note : calpain 4 product : calpain, small subunit 1 protein_id : NP_033925.2

name	Tbcb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384976 CCDS:CCDS21083.1 GeneID:66411 MGI:1913661
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytoskeleton-associated protein 1 protein_id : NP_079824.1

name	Polr2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625757 CCDS:CCDS21084.1 GeneID:69920 MGI:1917170
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006354 - RNA elongation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide I protein_id : NP_081535.1

name	Ovol3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256498 GeneID:381867 MGI:2388075
definition	codon_start : 1 product : OVO homolog-like 3 protein_id : XP_355880.5

name	Wdr62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904867 GeneID:233064 MGI:1923696
definition	codon_start : 1 product : WD repeat domain 62 isoform 2 protein_id : XP_896469.1

name	1700020L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380106 GeneID:75629 MGI:1922879
definition	codon_start : 1 product : hypothetical protein LOC75629 protein_id : XP_001000510.1

name	Clip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487425 GeneID:76686 MGI:1923936
definition	codon_start : 1 product : CLIP-170-related protein protein_id : NP_001074583.1

name	Alkbh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38569508 CCDS:CCDS21085.1 GeneID:233065 MGI:2142037
definition	codon_start : 1 product : alkB, alkylation repair homolog 6 protein_id : NP_932144.2

name	AI428936 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956370 CCDS:CCDS21086.1 GeneID:233066 MGI:2141950
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233066 protein_id : NP_705805.1

name	0610010E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815822 GeneID:68332 MGI:1915582
definition	codon_start : 1 product : hypothetical protein LOC68332 protein_id : NP_001028312.2

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 4 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 3 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 2 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 1 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 1 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 2 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 3 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 4 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 5 pseudo : _no_value

name	1700028B04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256491 GeneID:70001 MGI:1917251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : RIKEN cDNA 1700028B04 gene transcript_id : XR_034419.1

name	4932431P20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256493 GeneID:114675 MGI:2149781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : RIKEN cDNA 4932431P20 gene transcript_id : XR_035432.1

name	4930432E11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256494 GeneID:243900 MGI:3045259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : RIKEN cDNA 4930432E11 gene transcript_id : XR_035433.1

name	EG668354 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256689 GeneID:668354 MGI:3644977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 4 Proteins product : predicted gene, EG668354 pseudo : _no_value transcript_id : XR_002251.2

clone name	MSMg01-118N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-065D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297M06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-143G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059A22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-195I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-270K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-442A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-188E03.b	B6Ng01-188E03.g
ACC	GA012602	GA012603
length	1,045	918
definition	B6Ng01-188E03.b	B6Ng01-188E03.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcataactcgcgtgcatgtgtgtgtgtgtgtgtacaatgttcaatc ctgtcagtcagaaaaatggaaattaagctgatggtgtggtcatacatgcc tgtaatcacagcactcacgaggcatggacaaggaggattagaaatattag gctatcctcagctacatagtgtgaggctagcctgggctacatcacatcac atcgcatcacaacataacataacatacatctttctaaataaataaatgaa tgaatacgtgagttcagtgggattgaattaaaagaaagagacaaagaaaa tgacacagtgacagcactctaagtccaccccaggagcccagatagaaagg cttaaggacatacggccatagagtgcttctatgtcactggtgggtgtgga aatggttcagcactttggggtatagtttggtgcagtttcttataaagtca aatacacaatctagctgttttacactaggaagacactcacagagagacac tcctaagcagcctcaaactggtccccgtagcatccctcaagtaccagagt ggggtgtactcagacaacggaagagtagatgcagaaatcccacgctacat ccagtcgtgtggctgcctgcactagcatgacaccaagtcccagaatccag aagcacataaacaaagtagacatggcgtggctttatagtctacacggccc aaacgcagctgagaagggaggtcacctgtgccttctcagggagaagccct tgggaagcggcagggggtgttggggcttacctggttttgggcgctccatg gtgctctcctggctggtcaggccacctgatgaggagtcaccgctggacat cccatcgtgcataaagtgagggtcaaacgacagcagagggtgtggggcag ctgcgtacctgcagagcagagagtgaacaaagtcccggagggacagcacc gcgtgagcccattgcccgcttgccagtggctttttaaccatccaggagac ctcctgctggtggatggggaggcaaggagctgcctggccaaggct	gaattcaccccacaaaccatacaaacatggatctcagttaagcaagaata gtttattgaatgcacaacccaagacttattgatcgcagccaccaaaaaaa aaacccaaaaacctgggagcataattgtggtaccagtctgttcttatcgc aggcttttttataggaaaagccaagttcagaagttcagaaggcaaggctg actagacaaagaattatcaactagcttttaggctgattggtcctgcatga ggaaaggagtggtggatgggtggtgaacaggggagtctcggagcactggg gtgactgagcctgagaattacaaccacagagctatgcccttttaggagaa gttgtcagtgtcatctgtgcgtaattccctgagaacctgaactgaatttc atcttctgagcaaaatggagactgaatacaaaatggctgcagttatgttc aaaggagctggcctccacagtagctgagggagggagcctatagcccgttt cccacaatcccttaactgctactttccagttaggatccaccagaggggga gactctggtgagaaattagaaaagcaggaagaagaagacgtagtctgcct ggttctgacagtagagaccagtctggccaccccatcagcaccaggaatgg gtataatgggtttcaggagtcccggtaggtccagctctgcctccggcaat tctacaccaacagtgggtgggcactagcatgaagctgctgatccaccaag cttgcctcctggggtccacaaggctcacacctccagttttgtttctctta ccctactccctctccttccctccctccctccctctccttttccctctctc cctctccctcctctccctcctctctctcactcctctctctctctctctct ctctctcaccccttcatt
quality values	Open. Hide. 49 26 27 22 58 14 14 47 58 58 62 62 62 62 62 62 62 62 47 47 36 62 62 62 62 54 49 49 49 49 49 49 44 62 37 37 49 59 62 62 62 62 62 62 62 59 43 62 62 62 62 62 49 49 54 59 62 62 62 59 62 62 62 62 54 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 46 62 62 54 56 62 62 62 62 62 62 62 62 54 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 58 58 58 58 58 58 58 54 58 58 58 54 58 58 54 58 58 54 58 58 58 58 58 58 58 52 54 45 58 58 58 58 58 58 52 58 58 44 58 58 58 54 58 33 58 58 54 54 41 54 58 54 52 58 58 58 58 58 58 54 52 58 52 58 58 58 58 52 58 58 54 49 52 54 58 54 58 58 54 58 45 47 58 58 49 58 51 58 58 37 58 58 58 50 58 52 58 58 54 47 48 44 58 30 58 58 54 47 49 58 58 45 58 49 50 49 48 40 51 58 49 47 44 23 37 48 58 50 58 51 49 28 49 58 27 19 15 12 29 21 20 44 58 58 51 53 50 51 28 47 58 58 58 46 50 39 50 50 51 50 46 48 40 53 46 58 52 58 42 32 58 41 47 50 51 38 32 54 54 43 58 18 58 51 31 58 39 37 22 44 31 50 33 21 41 50 58 41 53 28 44 50 53 53 41 41 39 25 54 41 35 19 36 53 26 53 50 35 42 33 27 26 22 51 53 35 50 47 37 32 32 37 54 54 54 54 30 32 13 47 52 54 54 44 32 39 33 23 40 33 41 47 33 26 54 54 39 28 54 30 35 51 47 49 27 40 25 40 32 51 19 52 32 54 38 34 35 52 40 52 49 35 39 30 49 24 40 31 40 45 18 33 16 14 33 34 45 39 36 40 53 22 43 53 17 31 32 24 23 23 21 31 32 23 40 31 35 30 41 15 32 12 30 40 37 44 24 31 31 30 37 33 51 31 32 24 30 40 25 37 33 26 40 31 30 32 31 31 51 31 43 30 33 32 13 46 16 41 38 26 30 32 31 47 47 31 26 34 20 32 36 31 30 17 27 28 20 27 31 38 36 22 10 41 21 34 31 17 46 19 37 23 34 32 31 22 9 19 32 20 29 21 21 46 39 30 28 35 28 46 21 25 26 24 24 43 31 41 41 26 38 23 11 25 31 19 30 46 12 11 25 17 29 32 47 37 17 20 33 32 27 14 27 24 14 17 27 25 19 32 48 47 44 31 18 14 6 13 12 32 30 38 31 21 9 17 9 10 6 7 20 8 21 24 20 32 9 7 7 8 7 17 4 11 21 39 43 7 21 8 25 20 20 10 30 22 24 14 27 31 12 16 10 15 16 28 6 16 19 18 11 21 8 8	Open. Hide. 62 49 42 41 62 47 42 49 62 62 54 62 56 56 56 49 56 45 44 62 62 62 62 62 62 59 59 62 62 62 46 59 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 46 43 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 56 56 62 62 62 62 62 62 45 62 62 62 62 62 62 62 52 46 62 62 54 62 42 45 62 62 52 62 62 62 62 46 62 62 52 54 58 58 46 49 41 58 58 58 58 54 41 54 33 58 58 58 58 49 54 58 54 54 58 58 44 42 54 54 54 58 58 58 58 54 52 58 54 58 58 58 46 58 54 52 58 58 52 58 26 58 54 49 52 58 58 54 45 39 58 54 58 58 52 58 52 52 54 46 40 50 53 53 58 27 58 53 45 33 58 49 54 41 51 53 58 58 20 41 40 41 58 58 44 50 53 53 53 37 52 40 50 48 51 47 49 58 53 42 58 58 58 52 47 39 51 51 50 58 49 48 50 58 51 46 50 40 58 32 29 40 52 54 41 50 43 33 42 28 58 32 46 44 37 53 41 39 41 50 51 50 49 50 50 40 50 58 31 41 31 50 53 42 50 38 50 30 32 39 42 51 49 42 53 34 54 54 54 40 49 26 34 31 32 35 53 53 28 39 42 39 53 38 44 33 32 49 49 32 52 53 42 40 37 47 24 39 39 30 46 39 38 37 35 54 38 49 31 25 40 28 37 54 54 54 29 25 47 20 30 30 47 27 54 17 38 32 34 34 34 35 32 41 30 28 23 22 32 53 53 32 46 16 53 32 45 32 35 42 25 29 21 53 49 26 32 26 53 26 47 31 33 40 33 31 31 31 46 37 51 31 22 27 51 32 30 30 51 43 31 31 51 46 23 30 31 29 24 29 32 32 32 24 40 37 38 25 16 19 22 25 40 31 31 32 42 31 26 16 22 30 27 27 31 31 31 37 21 16 33 22 13 18 8 22 32 25 16 6 9 15 9 7 13 11 22 21 31 31 31 24 16 18 29 29 29 23 26 29 38 29 37 17 32 17 28 9 29 13 7 6 7 10 4 7 5 5 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_30138294_30139331
seq2: B6Ng01-188E03.b_45_1089

seq1  GAATTCATAACTCGCGTGCATGTGTGTGTGTGTGTGTACAATGTTCAATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATAACTCGCGTGCATGTGTGTGTGTGTGTGTACAATGTTCAATC  50

seq1  CTGTCAGTCAGAAAAATGGAAATTAAGCTGATGGTGTGGTCATACATGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCAGTCAGAAAAATGGAAATTAAGCTGATGGTGTGGTCATACATGCC  100

seq1  TGTAATCACAGCACTCACGAGGCATGGACAAGGAGGATTAGAAATATTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAATCACAGCACTCACGAGGCATGGACAAGGAGGATTAGAAATATTAG  150

seq1  GCTATCCTCAGCTACATAGTGTGAGGCTAGCCTGGGCTACATCACATCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATCCTCAGCTACATAGTGTGAGGCTAGCCTGGGCTACATCACATCAC  200

seq1  ATCGCATCACAACATAACATAACATACATCTTTCTAAATAAATAAATGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGCATCACAACATAACATAACATACATCTTTCTAAATAAATAAATGAA  250

seq1  TGAATACGTGAGTTCAGTGGGATTGAATTAAAAGAAAGAGACAAAGAAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATACGTGAGTTCAGTGGGATTGAATTAAAAGAAAGAGACAAAGAAAA  300

seq1  TGACACAGTGACAGCACTCTAAGTCCACCCCAGGAGCCCAGATAGAAAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACACAGTGACAGCACTCTAAGTCCACCCCAGGAGCCCAGATAGAAAGG  350

seq1  CTTAAGGACATACGGCCATAGAGTGCTTCTATGTCACTGGTGGGTGTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAGGACATACGGCCATAGAGTGCTTCTATGTCACTGGTGGGTGTGGA  400

seq1  AATGGTTCAGCACTTTGGGGTATAGTTTGGTGCAGTTTCTTATAAAGTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGTTCAGCACTTTGGGGTATAGTTTGGTGCAGTTTCTTATAAAGTCA  450

seq1  AATACACAATCTAGCTGTTTTACACTAGGAAGACACTCACAGAGAGACAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACACAATCTAGCTGTTTTACACTAGGAAGACACTCACAGAGAGACAC  500

seq1  TCCTAAGCAGCCTCAAACTGGTCCCCGTAGCATCCCTCAAGTACCAGAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTAAGCAGCCTCAAACTGGTCCCCGTAGCATCCCTCAAGTACCAGAGT  550

seq1  GGGGTGTACTCAGACAACGGAAGAGTAGATGCAGAAATCCCACGCTACAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTGTACTCAGACAACGGAAGAGTAGATGCAGAAATCCCACGCTACAT  600

seq1  CCAGTCGTGTGGCTGCCTGCACTAGCATGACACCAAGTCCCAGAATCCAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTCGTGTGGCTGCCTGCACTAGCATGACACCAAGTCCCAGAATCCAG  650

seq1  AAGCACATAAACAAAGTAGACATGGCGTGGCTTTATAGTCTACACGGCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACATAAACAAAGTAGACATGGCGTGGCTTTATAGTCTACACGGCCC  700

seq1  AAACGCAGCTGAGAAGGGAGGTCACCTGTGCCTTCTCAGGGAGAAGCCCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGCAGCTGAGAAGGGAGGTCACCTGTGCCTTCTCAGGGAGAAGCCCT  750

seq1  TGGGAAGCGGCAGGGGGTGTTGGGGCTTACCTGGTTTTGGGCGCTCCATG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAAGCGGCAGGGGGTGTTGGGGCTTACCTGGTTTTGGGCGCTCCATG  800

seq1  GTGCTCTCCTGGCTGGTCAGGCCACCTGATGAGGAGTCACCGCTGGACAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTCTCCTGGCTGGTCAGGCCACCTGATGAGGAGTCACCGCTGGACAT  850

seq1  CCCATCGTGCATAAAGTGAGGGTCAAACGACAGCAGAGGGTGTGGGGCAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCGTGCATAAAGTGAGGGTCAAACGACAGCAGAGGGTGTGGGGCAG  900

seq1  CTGCGTACCTGCAGAGCAGAGAGTGAACAAAGTCCCGGAGGGACAGCACC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCGTACCTGCAGAGCAGAGAGTGAACAAAGTCCCGGAGGGACAGCACC  950

seq1  GCGTGAGCCCATTGCCCGCTTGCCAGTGGCTTTTTAA-CATCCAGGAGAC  999
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  GCGTGAGCCCATTGCCCGCTTGCCAGTGGCTTTTTAACCATCCAGGAGAC  1000

seq1  --TCTGCT-GTGGAT-GGGAGGCAAGGAGCTG-CTGG-CAAGGCT  1038
         ||||| |||||| |||||||||||||||| |||| |||||||
seq2  CTCCTGCTGGTGGATGGGGAGGCAAGGAGCTGCCTGGCCAAGGCT  1045

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information