MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-189N04
Chromosome	7 (Build37)
Map Location	132,380,386 - 132,518,393
singlet/doublet	doublet
Overlap gene	4933440M02Rik
Upstream gene	EG628779, EG545999, LOC670828
Downstream gene	LOC100043014, Jmjd5, Nsmce1, EG244214, Il4ra, Il21r, Gtf3c1, D430042O09Rik, Gsg1l, Xpo6, Sbk1, LOC100043495, Lat, 2210013K02Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG628779 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628779 MGI:3645059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins

name	EG545999 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545999 MGI:3646831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 80 ESTs

name	LOC670828 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	4933440M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71208 MGI:1918458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Jmjd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77035 MGI:1924285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsmce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67711 MGI:1914961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244214 MGI:3643455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 15 Proteins pseudo : _no_value

name	Il4ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16190 MGI:105367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il21r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60504 MGI:1890475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233863 MGI:107887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430042O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233865 MGI:2442760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsg1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269994 MGI:2685483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 5 Proteins

name	Xpo6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74204 MGI:2429950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins

name	Lat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16797 MGI:1342293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210013K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73658 MGI:1920908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628779 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257778 GeneID:628779 MGI:3645059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : predicted gene, EG628779 transcript_id : XM_893564.3

name	EG545999 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381018 GeneID:545999 MGI:3646831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 80 ESTs product : predicted gene, EG545999 transcript_id : XM_620562.3

name	LOC100043014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257709 GeneID:100043014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001479314.1

name	Jmjd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374090 GeneID:77035 MGI:1924285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 5 transcript_id : NM_029842.2

name	Nsmce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328290 GeneID:67711 MGI:1914961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC element 1 homolog (S. cerevisiae) transcript_id : NM_026330.2

name	Il4ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186475 GeneID:16190 MGI:105367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 4 receptor, alpha transcript_id : NM_001008700.3

name	Il21r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11230785 GeneID:60504 MGI:1890475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 21 receptor transcript_id : NM_021887.1

name	Gtf3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402234 GeneID:233863 MGI:107887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor III C 1 transcript_id : NM_207239.1

name	D430042O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486627 GeneID:233865 MGI:2442760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430042O09 gene transcript_id : NM_001081022.1

name	Gsg1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381025 GeneID:269994 MGI:2685483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 5 Proteins product : GSG1-like transcript_id : XM_194378.6

name	Xpo6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537528 GeneID:74204 MGI:2429950
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 6 transcript_id : NM_028816.2

name	Sbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130171 GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-binding kinase 1 transcript_id : NM_145587.2

name	LOC100043495 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257781 GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480108.1

name	Lat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475924 GeneID:16797 MGI:1342293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : linker for activation of T cells transcript_id : NM_010689.2

name	2210013K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963794 GeneID:73658 MGI:1920908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210013K02 gene transcript_id : NM_023712.1

name	EG628779 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257779 GeneID:628779 MGI:3645059
definition	codon_start : 1 product : similar to heparan sulfate D-glucosaminyl 3-O-sulfotransferase 4 protein_id : XP_898657.3

name	EG545999 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63562014 GeneID:545999 MGI:3646831
definition	codon_start : 1 product : similar to glutamate dehydrogenase (NAD(P)+) protein_id : XP_620562.1

name	LOC100043014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257710 GeneID:100043014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479364.1

name	Jmjd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313318 CCDS:CCDS21821.1 GeneID:77035 MGI:1924285
definition	codon_start : 1 product : jumonji domain containing 5 protein_id : NP_084118.1

name	Nsmce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328291 CCDS:CCDS21822.1 GeneID:67711 MGI:1914961
definition	codon_start : 1 product : non-SMC element 1 homolog protein_id : NP_080606.2

name	Il4ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56785428 GeneID:16190 MGI:105367
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : IL-4 receptor alpha chain product : interleukin 4 receptor, alpha protein_id : NP_001008700.1

name	Il21r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230786 CCDS:CCDS21823.1 GeneID:60504 MGI:1890475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA] [Evidence ISS]; GO:0004907 - interleukin receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 product : interleukin 21 receptor protein_id : NP_068687.1

name	Gtf3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402235 GeneID:233863 MGI:107887
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : general transcription factor III C 1 protein_id : NP_997122.1

name	D430042O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486628 GeneID:233865 MGI:2442760
definition	codon_start : 1 product : hypothetical protein LOC233865 protein_id : NP_001074491.1

name	Gsg1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51761966 GeneID:269994 MGI:2685483
definition	codon_start : 1 product : GSG1-like protein_id : XP_194378.4

name	Xpo6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537529 GeneID:74204 MGI:2429950
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006611 - protein export from nucleus [Evidence ISS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RAN binding protein 20 product : exportin 6 protein_id : NP_083092.2

name	Sbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704180 CCDS:CCDS21824.1 GeneID:104175 MGI:2135937
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : CG4945-like product : SH3-binding kinase 1 protein_id : NP_663562.1

name	LOC100043495 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257782 GeneID:100043495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480158.1

name	Lat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754510 CCDS:CCDS21825.1 GeneID:16797 MGI:1342293
definition	GO_component : GO:0001772 - immunological synapse [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005057 - receptor signaling protein activity [Evidence TAS]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0019722 - calcium-mediated signaling [Evidence ISS]; GO:0006968 - cellular defense response [Evidence TAS]; GO:0006955 - immune response [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0043303 - mast cell degranulation [Evidence IEA]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0050863 - regulation of T cell activation [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 note : linker protein product : linker for activation of T cells protein_id : NP_034819.1

name	2210013K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963795 CCDS:CCDS21826.1 GeneID:73658 MGI:1920908
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : spinster-like protein product : spinster protein_id : NP_076201.1

name	LOC670828 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670828
definition	number : 1 pseudo : _no_value

name	4933440M02Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257780 GeneID:71208 MGI:1918458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4933440M02 gene transcript_id : XR_035453.1

name	EG244214 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257711 GeneID:244214 MGI:3643455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 15 Proteins product : predicted gene, EG244214 pseudo : _no_value transcript_id : XR_002216.2

clone name	MSMg01-496J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059E21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-189N04.b	B6Ng01-189N04.g
ACC	GA013741	GA013742
length	1,156	1,062
definition	B6Ng01-189N04.b	B6Ng01-189N04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(132,380,386 - 132,381,547)	(132,517,331 - 132,518,393)
sequence	gaattcagctgacctagtctgagagctgaatgcatcaaaatgctagaaga aaacaagcaaacctgcctgatttggactcatgtgggagtttcctctgagg ttaaccttctatcttggaaggagactcataaacacaagaagtaaacaagt caaaagagcttcaggaagtcccttgaaactggtaggattcactaggccct tccctccccaagagtggatataagcagtaggaagtgctggaagtcactca cagatcagtcaacctgcccagaagactctctaacatgctgagttgcctaa aagagagtcagaccagctgagtcaccaagagggtacaaagattagccaag ctgcctagaataagcagagagcagccaagtgatctggtcaaagctcagac gaatagagctatctgcagagaagactcttcaactgtttgagctgcctgtg agctgtgtagtgagctccaggtttctcgctttggtaagctgtcactcacg ctgggtgggctttggtgatacagctgtcttaaagtcctctctgtccctcc atgaagcccttaccaatacacctgtaagtaatgccaataaacccattgtt tcaccaagttggacttaggtgatatccttcctttggtctgtctttggttc tctgtctgagagaagagacatttgttctcatctccccaggaattgtgtca aaaatcaggatgaaggctacagtttcttcaaagacatcaaaaaacattgg agaaattttgtttttactccgttttttaaatggtgtctgctgaatctctc tgtaagtattgttcatatgactgtgaacccagaaaatgtataacacatat tgctggtctccttatatttgaattttgtgaaactttagcaatgctgtcaa ctttggaaaaaggtatcctaagttacctttgttgagttgacgttacagaa tgaacatccatgcttgttctaacaaacttaaactttaaacatatttttcc atttgtacatgggtaactcattgtattaaatatgtaaagtctgattatgt tggttctgttacgaggccattaaacaatctctaatggggaaaattgaccc aaaggtaatgattaacattcatccaaccttaatgttggtatgttacaaag agttag	gaattcactccctcttggttggggaaggcagtgcagagtggctctagctg gggtgatgtgattgagtgacctaagcttttcacatcatggttaactagaa agcagagcacacaggctggaactctggggtggatataaccttcaaaggcc tacccctaacaacctatgtctaccagtcagggactacttcctaaaggccc cacagccttcaaaacgttaccgcaagcagaggatagaacattgaatcccc agtcctccctcatcactgacctccttggggtacagcctggagatctcacc tgagaactcagctcaggctagcttttggaggagccagcctgaggcactgt cctctcccttcctacatgcattgagcttctggctcaggaggagtcagtgg gggagctgttaggaccttccatccagagcaacaggtccttcaacaaagga caaagacaaagtgccatcctggctgcgggatgaggccaagggtgaattta ggaagggaggccatgtttagatacccagctccctggccctgtaggttttt cgtttttttttttcaccccaggttcatgaggtctactggctggccacctt tcccactttcccattttatgtctatacagagtcttggggtcttcttagtc tgctggccagagagaactggcaaacagctcttcctccagctcagttaata attcaggagccagcacctacagccacccattactctaagcccattgacac cctcaatgctggggcaatggacaggaaaggaaaaaaaatcacctgtctac ttaaacaaatagacctcccctcacgtgcttgcctggtccctctgctgggg tgggagggaccctgagcacctgtggcatcacactgcactctaggcctggg aagtgcagcttgcttcttagatttggccaattatccctccctccatcttt ctgttcaaggatgctgaagacccagaacgagtgttgaagaaggtgagaga tgagttcttctcaagctgcaagcacccatgccttaggcaggaagaaaaga ggggttctatgt
quality values	Open. Hide. 58 33 32 39 58 36 21 54 58 58 58 28 47 58 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 42 25 42 28 20 20 21 21 24 43 30 25 24 38 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 49 59 62 54 54 42 54 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 42 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 54 43 62 58 54 58 58 58 58 58 58 58 54 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 41 58 58 58 58 54 54 58 58 58 58 54 54 45 42 58 58 58 58 58 58 58 54 54 54 54 58 54 58 52 58 54 58 49 58 46 58 58 54 58 54 58 47 41 52 58 58 58 58 58 58 51 50 48 49 43 58 58 58 58 58 58 58 49 58 42 42 36 58 50 58 42 35 58 53 58 58 58 58 58 54 51 58 58 58 58 52 58 53 58 50 54 49 58 58 58 35 37 54 58 50 58 53 58 46 58 49 58 58 39 48 33 58 58 39 58 32 58 42 35 53 51 51 58 39 58 49 50 51 36 51 53 53 52 58 54 50 52 41 58 58 31 26 58 58 53 58 52 49 26 53 58 51 33 41 49 43 17 58 46 41 47 49 54 32 58 30 51 41 41 39 53 54 54 45 51 42 50 41 32 49 49 45 50 30 30 46 35 18 54 54 54 54 32 42 33 53 51 46 42 54 25 54 54 39 34 54 54 46 28 19 54 54 54 19 19 42 53 42 51 40 51 54 54 54 54 52 31 54 54 40 51 54 24 54 42 53 36 53 45 53 53 37 54 42 52 45 42 40 45 32 47 31 36 32 29 32 43 53 31 53 24 42 41 25 39 31 42 35 45 32 45 52 40 53 46 41 31 32 19 12 30 53 53 53 31 23 53 24 31 36 31 31 31 31 45 31 42 31 31 31 45 36 39 33 36 25 31 31 31 38 33 36 31 30 31 35 51 33 12 29 27 31 47 47 30 42 29 33 33 48 28 15 31 46 31 31 23 42 31 24 31 42 25 38 36 13 22 14 20 27 31 46 31 41 38 38 46 46 46 26 19 44 18 23 27 30 30 15 13 46 31 20 33 31 19 31 14 41 10 14 18 25 32 38 31 27 20 22 26 24 14 32 7 9 26 11 14 29 14 17 31 31 18 25 22 24 30 29 27 27 38 11 7 7 17 27 11 21 18 13 7 9 19 48 24 25 31 44 18 44 35 30 22 38 30 18 44 28 31 22 9 9 30 40 43 48 32 14 23 20 24 48 28 32 17 24 32 16 14 19 40 29 18 19 15 34 22 9 7 25 10 6 4 9 5 31 24 43 11 31 28 28 32 11 15 21 17 17 19 21 14 5 9 13 16 11 7 8 5 7 20 6 3 9 21 13 28 11 24 6 11 7 6 4 13 4 5 14 5 5 11 21 21 10 8 7 24 12 5 5 11 7 3 3 10 47 47 16 3 20 19 4 1 6 8 6 6 8 3 3 14 23 6 6 13 3 6 5 7 15 7 4 2 3 6 4 5 7 16 6 10 8 8 17 17 5 6 13 6 11 8 5 13 9 13 8 8 7 5 10 8 4 6 5 7 4 2 4 4 18 4 3 8 8 7	Open. Hide. 62 38 39 39 62 54 56 47 62 62 62 62 34 43 27 27 31 23 28 34 38 38 38 46 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 56 33 43 54 49 54 56 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 54 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 45 54 62 54 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 46 49 58 58 58 49 58 54 58 58 58 58 54 58 52 58 54 54 58 58 45 45 58 58 58 58 58 58 58 58 45 47 58 58 58 58 58 52 54 58 54 58 58 58 58 54 54 54 58 54 58 58 58 58 58 58 58 58 54 32 54 58 58 58 37 54 58 54 58 47 52 58 58 58 46 58 49 58 58 51 51 58 49 49 53 53 58 58 52 58 40 47 58 58 58 47 54 58 41 36 47 58 58 51 50 58 43 41 53 58 58 30 40 48 58 50 50 52 53 53 42 53 50 50 58 46 51 52 49 51 58 58 58 49 42 52 51 48 50 51 21 39 25 41 53 51 51 39 51 58 50 23 48 50 37 49 34 53 34 58 40 28 52 58 44 23 50 51 50 50 39 50 54 37 52 51 51 50 50 49 39 50 32 39 50 53 39 39 26 36 41 37 28 28 32 31 52 53 39 39 29 49 54 20 51 46 39 45 42 31 32 51 39 42 53 26 37 49 39 39 39 51 51 37 53 51 37 31 39 42 39 26 53 32 50 54 27 27 51 45 42 33 40 27 20 54 42 53 42 35 22 27 47 33 45 53 54 54 30 31 34 35 38 51 46 33 32 28 12 54 42 54 51 24 37 42 54 52 49 46 49 51 52 36 35 34 29 52 33 53 31 31 32 31 28 31 46 22 51 16 28 44 52 36 32 32 30 31 44 32 42 34 47 40 33 23 29 31 32 31 23 32 27 31 31 29 12 21 12 28 35 26 26 51 33 24 31 31 42 25 35 31 51 51 46 27 32 37 28 29 22 46 20 30 24 42 33 27 31 14 6 4 12 19 46 22 35 30 31 31 22 23 19 25 19 35 26 31 15 12 12 23 34 31 21 17 12 15 25 18 16 18 7 31 8 25 12 10 8 32 26 14 17 24 41 9 27 27 33 34 29 11 11 10 6 37 14 46 25 23 32 13 28 11 9 14 14 20 12 13 48 38 26 23 37 22 11 8 33 19 34 30 10 44 10 32 13 31 18 28 22 11 10 31 29 10 18 27 25 20 29 17 10 6 21 6 6 6 5 8 4 20 23 13 22 8 22 31 25 6 24 5 20 7 14 31 13 18 21 21 21 6 12 7 21 12 14 32 7 24 15 12 5 19 34 7 17 7 16 24 27 28 28 18 7 18 15 4 3 6 27 9 13 13 12 9 23 5 28 14 15 15 8 17 6 8 5 9 4 3 5 10 11 6 13 5 6 11 15 11 10 9 19 8 5 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_132380386_132381547
seq2: B6Ng01-189N04.b_44_1199

seq1  GAATTCAGCTGACCTAGTCTGAGAGCTGAATGCATCAAAATGCTAGAAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCTGACCTAGTCTGAGAGCTGAATGCATCAAAATGCTAGAAGA  50

seq1  AAACAAGCAAACCTGCCTGATTTGGACTCATGTGGGAGTTTCCTCTGAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAGCAAACCTGCCTGATTTGGACTCATGTGGGAGTTTCCTCTGAGG  100

seq1  TTAACCTTCTATCTTGGAAGGAGACTCATAAACACAAGAAGTAAACAAGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACCTTCTATCTTGGAAGGAGACTCATAAACACAAGAAGTAAACAAGT  150

seq1  CAAAAGAGCTTCAGGAAGTCCCTTGAAACTGGTAGGATTCACTAGGCCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGAGCTTCAGGAAGTCCCTTGAAACTGGTAGGATTCACTAGGCCCT  200

seq1  TCCCTCCCCAAGAGTGGATATAAGCAGTAGGAAGTGCTGGAAGTCACTCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCCCCAAGAGTGGATATAAGCAGTAGGAAGTGCTGGAAGTCACTCA  250

seq1  CAGATCAGTCAACCTGCCCAGAAGACTCTCTAACATGCTGAGTTGCCTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATCAGTCAACCTGCCCAGAAGACTCTCTAACATGCTGAGTTGCCTAA  300

seq1  AAGAGAGTCAGACCAGCTGAGTCACCAAGAGGGTACAAAGATTAGCCAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAGTCAGACCAGCTGAGTCACCAAGAGGGTACAAAGATTAGCCAAG  350

seq1  CTGCCTAGAATAAGCAGAGAGCAGCCAAGTGATCTGGTCAAAGCTCAGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTAGAATAAGCAGAGAGCAGCCAAGTGATCTGGTCAAAGCTCAGAC  400

seq1  GAATAGAGCTATCTGCAGAGAAGACTCTTCAACTGTTTGAGCTGCCTGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGAGCTATCTGCAGAGAAGACTCTTCAACTGTTTGAGCTGCCTGTG  450

seq1  AGCTGTGTAGTGAGCTCCAGGTTTCTCGCTTTGGTAAGCTGTCACTCACG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGTGTAGTGAGCTCCAGGTTTCTCGCTTTGGTAAGCTGTCACTCACG  500

seq1  CTGGGTGGGCTTTGGTGATACAGCTGTCTTAAAGTCCTCTCTGTCCCTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTGGGCTTTGGTGATACAGCTGTCTTAAAGTCCTCTCTGTCCCTCC  550

seq1  ATGAAGCCCTTACCAATACACCTGTAAGTAATGCCAATAAACCCATTGTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGCCCTTACCAATACACCTGTAAGTAATGCCAATAAACCCATTGTT  600

seq1  TCACCAAGTTGGACTTAGGTGATATCCTTCCTTTGGTCTGTCTTTGGTTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCAAGTTGGACTTAGGTGATATCCTTCCTTTGGTCTGTCTTTGGTTC  650

seq1  TCTGTCTGAGAGAAGAGACATTTGTTCTCATCTCCCCAGGAATTGTGTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTGAGAGAAGAGACATTTGTTCTCATCTCCCCAGGAATTGTGTCA  700

seq1  AAAATCAGGATGAAGGCTACAGTTTCTTCAAAGACATCAAAAAACATTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCAGGATGAAGGCTACAGTTTCTTCAAAGACATCAAAAAACATTGG  750

seq1  AGAAATTTTGTTTTTACTCCGTTTTTTAAATGGTGTCTGCTGAATCTCTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATTTTGTTTTTACTCCGTTTTTTAAATGGTGTCTGCTGAATCTCTC  800

seq1  TGTAAGTATTGTTCATATGACTGTGAACCCAGAAAATGTATAACACATAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAGTATTGTTCATATGACTGTGAACCCAGAAAATGTATAACACATAT  850

seq1  TGCTGGTCTCCTTATATTTGAATTTTGTGAAACTTTAGCAATGCTGTCAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGTCTCCTTATATTTGAATTTTGTGAAACTTTAGCAATGCTGTCAA  900

seq1  CTTTGGAAAAAGGTATCCTAAGTTACC-TTGTTGAGTTGACGTTTACAGA  949
      ||||||||||||||||||||||||||| |||||||||||||| |||||| 
seq2  CTTTGGAAAAAGGTATCCTAAGTTACCTTTGTTGAGTTGACG-TTACAG-  948

seq1  AATGAACATCCATGC-TGTTCT-ACAAACTTTAAACTTTAAACATATTTT  997
      ||||||||||||||| |||||| |||||| ||||||||||||||||||||
seq2  AATGAACATCCATGCTTGTTCTAACAAAC-TTAAACTTTAAACATATTTT  997

seq1  TCCATTTGTACAT-GGTAACTCATTGTATTAAATATGTAAAGTCTTGATT  1046
      ||||||||||||| |||||||||||||||||||||||||||||| |||||
seq2  TCCATTTGTACATGGGTAACTCATTGTATTAAATATGTAAAGTC-TGATT  1046

seq1  ATGTGGGTTCTGTTACAGAGGCCAATAAAACATTCTCTAGTGGGGAAAAA  1096
      |||| ||||||||||| |||||| || ||||| |||||| ||||| ||||
seq2  ATGTTGGTTCTGTTAC-GAGGCC-ATTAAACAATCTCTAATGGGG-AAAA  1093

seq1  ATGACACAAAAAGTTAATGAATTAGACA-TCATCAAACTTTAAATGTT-G  1144
       |||| |  |||| ||||| |||| ||| ||||| ||| || |||||| |
seq2  TTGACCC--AAAGGTAATG-ATTA-ACATTCATCCAACCTT-AATGTTGG  1138

seq1  TATGTTACAAAGAGTTAG  1162
      ||||||||||||||||||
seq2  TATGTTACAAAGAGTTAG  1156

seq1: chr7_132517331_132518393
seq2: B6Ng01-189N04.g_66_1127 (reverse)

seq1  ACATAGAACCCCTCTCTCCTTCCTGCCTAAGGCATGGGTGCTTGCAGCTT  50
      ||||||||||||||| | ||||||||||||||||||||||||||||||||
seq2  ACATAGAACCCCTCTTTTCTTCCTGCCTAAGGCATGGGTGCTTGCAGCTT  50

seq1  GAGGAAGAACTCATCTCTCACC-TCTCCAACACTCGTTCTGTGTCTTCAG  99
      || ||||||||||||||||||| ||| |||||||||||||| ||||||||
seq2  GA-GAAGAACTCATCTCTCACCTTCTTCAACACTCGTTCTGGGTCTTCAG  99

seq1  CATCCCTGAACAG-AAGATGGAGGGAGGGATAAATGGCCAAATCTAAAGA  148
      ||||| ||||||| ||||||||||||||||||| ||||||||||| ||||
seq2  CATCCTTGAACAGAAAGATGGAGGGAGGGATAATTGGCCAAATCT-AAGA  148

seq1  AGCAAGCTGCACCTTCCAAGGCCTAGAGTGCAGTGTGATGCCACAGGTGC  198
      ||||||||||| ||||| ||||||||||||||||||||||||||||||| 
seq2  AGCAAGCTGCA-CTTCCCAGGCCTAGAGTGCAGTGTGATGCCACAGGTG-  196

seq1  CTCAGGGTCCCTCCCACCCCAGCAGAGGGACCAGGCAAGCACGTGAGGGG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGGTCCCTCCCACCCCAGCAGAGGGACCAGGCAAGCACGTGAGGGG  246

seq1  AGGTCTATTTG-TTAAGTAGACAGGTGATTTTTTTTCCTTTCCTGTCCAT  297
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AGGTCTATTTGTTTAAGTAGACAGGTGATTTTTTTTCCTTTCCTGTCCAT  296

seq1  TGCCCCAGCATTGAGGGTGTCAATGGGCTTAGAGTAATGGGTGGCTGTAG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCCAGCATTGAGGGTGTCAATGGGCTTAGAGTAATGGGTGGCTGTAG  346

seq1  GTGCTGGCTCCTGAATTATTAACTGAGCTGGAGGAAGAGCTGTTTGCCAG  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGGCTCCTGAATTATTAACTGAGCTGGAGGAAGAGCTGTTTGCCAG  396

seq1  TTCTCTCTGGCCAGCAGACTAAGAAGACCCCAAGACTCTGTATAGACATA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTCTGGCCAGCAGACTAAGAAGACCCCAAGACTCTGTATAGACATA  446

seq1  AAATGGGAAAGTGGGAAAGGTGGCCAGCCAGTAGACCTCATGAACCTGGG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGGGAAAGTGGGAAAGGTGGCCAGCCAGTAGACCTCATGAACCTGGG  496

seq1  GTGAAAAAAAAAAACGAAAAACCTACAGGGCCAGGGAGCTGGGTATCTAA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAAAAAAAAAACGAAAAACCTACAGGGCCAGGGAGCTGGGTATCTAA  546

seq1  ACATGGCCTCCCTTCCTAAATTCACCCTTGGCCTCATCCCGCAGCCAGGA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGGCCTCCCTTCCTAAATTCACCCTTGGCCTCATCCCGCAGCCAGGA  596

seq1  TGGCACTTTGTCTTTGTCCTTTGTTGAAGGACCTGTTGCTCTGGATGGAA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACTTTGTCTTTGTCCTTTGTTGAAGGACCTGTTGCTCTGGATGGAA  646

seq1  GGTCCTAACAGCTCCCCCACTGACTCCTCCTGAGCCAGAAGCTCAATGCA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCTAACAGCTCCCCCACTGACTCCTCCTGAGCCAGAAGCTCAATGCA  696

seq1  TGTAGGAAGGGAGAGGACAGTGCCTCAGGCTGGCTCCTCCAAAAGCTAGC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGGAAGGGAGAGGACAGTGCCTCAGGCTGGCTCCTCCAAAAGCTAGC  746

seq1  CTGAGCTGAGTTCTCAGGTGAGATCTCCAGGCTGTACCCCAAGGAGGTCA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCTGAGTTCTCAGGTGAGATCTCCAGGCTGTACCCCAAGGAGGTCA  796

seq1  GTGATGAGGGAGGACTGGGGATTCAATGTTCTATCCTCTGCTTGCGGTAA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGAGGGAGGACTGGGGATTCAATGTTCTATCCTCTGCTTGCGGTAA  846

seq1  CGTTTTGAAGGCTGTGGGGCCTTTAGGAAGTAGTCCCTGACTGGTAGACA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTTTGAAGGCTGTGGGGCCTTTAGGAAGTAGTCCCTGACTGGTAGACA  896

seq1  TAGGTTGTTAGGGGTAGGCCTTTGAAGGTTATATCCACCCCAGAGTTCCA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTGTTAGGGGTAGGCCTTTGAAGGTTATATCCACCCCAGAGTTCCA  946

seq1  GCCTGTGTGCTCTGCTTTCTAGTTAACCATGATGTGAAAAGCTTAGGTCA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGTGTGCTCTGCTTTCTAGTTAACCATGATGTGAAAAGCTTAGGTCA  996

seq1  CTCAATCACATCACCCCAGCTAGAGCCACTCTGCACTGCCTTCCCCAACC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAATCACATCACCCCAGCTAGAGCCACTCTGCACTGCCTTCCCCAACC  1046

seq1  AAGAGGGAGTGAATTC  1063
      ||||||||||||||||
seq2  AAGAGGGAGTGAATTC  1062

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information