MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-197O16
Chromosome	7 (Build37)
Map Location	9,109,962 - 9,267,152
singlet/doublet	doublet
Overlap gene	EG628145, EG545909, LOC100042039, LOC100042781
Upstream gene	LOC100042681, LOC100042688, LOC100042695, LOC100041956, LOC100041961, LOC100042703, LOC100041967, LOC100042724, LOC100041977, LOC100041983, LOC100041989, LOC100041998, LOC100042009, LOC100042754, V2r14, EG628128, EG434109, LOC434110
Downstream gene	LOC665539, LOC100042795, LOC100042060, EG665552, LOC100042790, LOC100042803, LOC665598, LOC100042810, LOC665593, EG665582, EG434113, EG665577, LOC665571, LOC100042083, Gm1961, V2r4, LOC100042848, LOC100042096, LOC100042870, LOC100042105, LOC100042859, LOC100042113, LOC100042120, LOC100042126, LOC100042139
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 4 ESTs, 20 Proteins

name	LOC100042695 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	LOC100041956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	LOC100041967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 22 Proteins

name	LOC100041977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100041983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC100041989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	LOC100042009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100042754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	V2r14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22305 MGI:1316711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG434109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	LOC434110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 23 Proteins

name	EG628145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	EG545909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins

name	LOC100042039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 23 Proteins

name	LOC665539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC100042795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins pseudo : _no_value

name	LOC100042790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042803 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 Proteins pseudo : _no_value

name	LOC665598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins pseudo : _no_value

name	LOC100042810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 34 Proteins

name	LOC665593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665582 MGI:3645958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins pseudo : _no_value

name	EG434113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	EG665577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665577 MGI:3649133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC665571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	LOC100042083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Gm1961 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381838 MGI:3037819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V2r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22310 MGI:1316666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 21 Proteins

name	LOC100042096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins pseudo : _no_value

name	LOC100042113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC100042120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100042126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	LOC100042139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256201 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478937.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256199 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478933.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256203 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478952.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256206 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478969.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256208 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 10 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478976.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256210 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 6 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478984.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256214 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478989.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256216 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478996.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256218 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479004.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256222 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479014.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256224 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479020.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256226 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479025.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256240 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479046.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256242 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479051.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256238 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479040.1

name	LOC100041983 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256110 GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477335.1

name	V2r14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734848 GeneID:22305 MGI:1316711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 14 transcript_id : NM_009489.2

name	EG628128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379363 GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG628128 transcript_id : XM_892854.2

name	EG434109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256112 GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG434109, transcript variant 1 transcript_id : XM_485851.4

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379383 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_485852.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256264 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_899084.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903094 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_899075.1

name	EG545909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379372 GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins product : predicted gene, EG545909 transcript_id : XM_620411.3

name	LOC100042039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256115 GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to putative pheromone receptor transcript_id : XM_001477445.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256269 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479133.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256271 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479139.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256267 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479128.1

name	LOC665539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256117 GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477467.1

name	LOC100042795 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256279 GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479193.1

name	LOC100042060 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256119 GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477489.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256273 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479158.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256275 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479164.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256277 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479175.1

name	LOC100042810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256282 GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 30 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001479213.1

name	LOC100042810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256284 GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 15 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001479218.1

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379392 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 Proteins product : predicted gene, EG434113, transcript variant 1 transcript_id : XM_485855.3

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256286 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : predicted gene, EG434113, transcript variant 3 transcript_id : XM_899167.3

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903100 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG434113, transcript variant 2 transcript_id : XM_899156.1

name	EG665577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256287 GeneID:665577 MGI:3649133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG665577 transcript_id : XM_977912.2

name	LOC100042083 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256121 GeneID:100042083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to 2810047C21Rik protein transcript_id : XM_001477536.1

name	Gm1961 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383352 GeneID:381838 MGI:3037819
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1961, (NCBI) transcript_id : NM_198961.2

name	V2r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678542 GeneID:22310 MGI:1316666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 4 transcript_id : NM_009493.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256292 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479301.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256294 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479307.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256290 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479298.1

name	LOC100042870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256300 GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479319.1

name	LOC100042105 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256123 GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477579.1

name	LOC100042120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256126 GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 14 transcript_id : XM_001477597.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256202 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478987.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256200 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478983.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256204 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479002.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256207 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479019.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256209 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479026.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256211 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479034.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256215 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479039.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256217 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479046.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256219 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479054.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256223 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479064.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256225 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479070.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256227 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479075.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256239 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479090.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256241 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479096.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256243 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479101.1

name	LOC100041983 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256111 GeneID:100041983
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477385.1

name	V2r14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734849 CCDS:CCDS20787.1 GeneID:22305 MGI:1316711
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 14 product : vomeronasal 2, receptor, 14 protein_id : NP_033515.2

name	EG628128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379364 GeneID:628128 MGI:3643130
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_897947.2

name	EG434109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256113 GeneID:434109 MGI:3646061
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485851.4

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903099 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904177.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903095 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904168.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903097 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485852.2

name	EG545909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555338 GeneID:545909 MGI:3704108
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_620411.1

name	LOC100042039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256116 GeneID:100042039
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477495.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256268 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479178.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256270 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479183.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256272 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479189.1

name	LOC665539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256118 GeneID:665539
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477517.1

name	LOC100042795 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256280 GeneID:100042795
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479243.1

name	LOC100042060 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256120 GeneID:100042060
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477539.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256274 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479208.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256276 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479214.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256278 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479225.1

name	LOC100042810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256283 GeneID:100042810
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001479263.1

name	LOC100042810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256285 GeneID:100042810
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001479268.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903105 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904260.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903101 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904249.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903103 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485855.2

name	EG665577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379381 GeneID:665577 MGI:3649133
definition	codon_start : 1 product : similar to CDNA sequence BC023179 protein_id : XP_983006.1

name	LOC100042083 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256122 GeneID:100042083
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001477586.1

name	Gm1961 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080207 CCDS:CCDS20789.1 GeneID:381838 MGI:3037819
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 product : EC2-V2R pheromone receptor protein_id : NP_945199.1

name	V2r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678543 CCDS:CCDS20788.1 GeneID:22310 MGI:1316666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 4 product : vomeronasal 2, receptor, 4 protein_id : NP_033519.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256291 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479348.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256293 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479351.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256295 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479357.1

name	LOC100042870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256301 GeneID:100042870
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479369.1

name	LOC100042105 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256124 GeneID:100042105
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477629.1

name	LOC100042120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256127 GeneID:100042120
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 protein_id : XP_001477647.1

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 1 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 2 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 3 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 4 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 5 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 6 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 1 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 2 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 3 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 1 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 2 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 3 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 5 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 1 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 2 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 3 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 4 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 5 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 1 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 2 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 3 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 4 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 5 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 6 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 8 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 9 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 10 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 11 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 12 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 13 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 1 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 2 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 3 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 4 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 5 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 6 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 7 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 1 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 2 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 3 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 4 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 5 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 6 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 1 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 2 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 3 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 4 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 5 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 6 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 1 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 2 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 3 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 4 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 5 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 6 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 1 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 2 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 3 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 4 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 5 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 6 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 7 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 1 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 2 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 3 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 4 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 5 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 7 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 5 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 4 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 3 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 2 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 1 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 13 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 12 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 11 pseudo : _no_value

name	LOC100042754 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256258 GeneID:100042754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_034040.1

name	EG628145 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256114 GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG628145 pseudo : _no_value transcript_id : XR_033222.1

name	EG665552 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379373 GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins product : predicted gene, EG665552 pseudo : _no_value transcript_id : XR_001747.1

name	LOC665598 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256281 GeneID:665598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_034098.1

name	EG665582 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379382 GeneID:665582 MGI:3645958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : predicted gene, EG665582 pseudo : _no_value transcript_id : XR_002292.1

name	LOC100042859 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256296 GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_034147.1

name	LOC100042113 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256125 GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15 pseudo : _no_value transcript_id : XR_033289.1

clone name	MSMg01-384L21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-120B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-197O16.b	B6Ng01-197O16.g
ACC	GA019654	GA019655
length	1,080	1,111
definition	B6Ng01-197O16.b	B6Ng01-197O16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(9,109,962 - 9,111,044)	(9,266,052 - 9,267,152)
sequence	gaattcaatgctaacagggtctacagacagagttccatggacagccaggg agggctacatggagagatcctgcctcaaacaacaacaaaaacaacacaac ttcaaacaaaaatacaatgacagtcagaagacataacactctagcacgtt ggttctcaacatgtggatcatgatcttttaggggatatgtaagaccatca ggaaacacagatatttacactaagattcatgacagtagtgaaactacagt tatgaggtagaaatgataatttatggctggggatcaccataactagagga actgtgataaagggtcctaggattagaaagagtgagcaccactgctcttg cacatggttgcctaaagtggaaatccagcatgagtgatatgataaggtgg aaagcagctacataaatttaatcatctgaatcgacatggtaggtgaaaaa aagtgacttttccaaattgtactctgacttgcataagtgtagggacatac acacgcacaccccttttttaggtgagtaagaactcatgaatttattgtct tcattacaaaatcagcatagaactagatcactgtgcattggtgtttgcta catctctgtctgcatctgtctctttgtctctctctgtctctcagtcactc tggttggtttgttttttgtttgctttttgagacagggtttctctgtgtag ctctggctgtcctgaaactcactctgtagtccaggctggccttgaacttt atcatctgcctgacatgtgtgccactgccacatggctgcaaacaaaatct ttataagagtaaaattaataaataaataggactgtaagactggatcacta tcagggacatcagccctctgcctgggcttaggacccacacaccagggtgc tgcaacaaccaggtaagctaagaattctctgctaccacatccagcatcaa caggccagcagacagggatgttcagagggcacatgatagggcgtttgtac ccaagccttagaccagtatatgtgtgtgcagactttagtctgtatcagct tccagggaaatcctttttctctctccttct	gaattcattccctatgacactttgagcctctgacttctactgggaaaaga tgtataataggtactggagaatttactagctcaaacttgttgacacagaa acaacacagaattgaacaggtaggctgtatgtatatatacatacttatat gtgtgagttcatgtgaaggtagatattgcattattgtatttaagtgattc ctgtcataagtcataggaagaaggtggaatatgagaggaaatataatgtt tatgtttgaatagtagaaaatattaatgaaataagccctaagatgtttcc tcatctggcaatcattaatcaaaagttctggttattgttcatgatgtgca ctcattttagcactgaaggaaaaatatctctgtagatactttgtactaaa agttccttcaccttgattccttcttcatatggaaagctgaatactttaat ccttgcctcacctccatttgtatgagaatcaaagatgaaatcagtgctga gaaacagaatgagcaaaatcacagaggaatcctctggaaagggaggtaac ccagatggtttgtgataagcaattatactccattctaaaattgtaatccc caacatggtaacaacatgaacagtgattgcaattgcacttaatttccaag tcatttcagagaatgttgatgtgcttccttggttttcagaattcttatct acaacaatgcatttgtggacaaatattatttgataagttgcctaagagcc taagaagttaaattagatataaatagaatatgtttgttctaccagagaat ctgagtttcagatctcagtacccatgacagatatctcacaagtaaatatt aaattttaatgacagtagtattatttgctcatatgtgcacgtgttttatg tgtttatccacctccaacacacttaagcaaataatgcaataaaatatttt atggaatttttgtatttaattttgaatgtacatattaaatttttttacgt ctaatacaatttgtaactttttaaatttgtttcaagttacagtataatgt ttaaaatgtatgacttcaaagacaacttagttgattgctgttttacctcc atgcatcatgg
quality values	Open. Hide. 58 31 22 39 62 24 24 47 47 62 62 54 62 62 47 47 62 49 49 62 62 62 46 56 47 62 49 62 59 62 59 62 62 59 59 59 39 56 62 46 26 59 59 62 62 59 59 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 58 58 58 54 58 58 58 58 58 58 49 58 54 58 58 54 58 52 58 58 58 58 58 54 48 58 58 58 58 52 58 58 54 58 58 58 58 54 54 54 54 58 58 58 58 58 54 54 58 58 58 54 58 52 58 58 54 42 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 39 58 58 58 58 58 58 58 58 58 58 58 58 51 58 58 58 58 58 58 58 58 58 49 58 58 58 58 41 41 50 58 58 53 46 58 58 58 58 51 50 58 54 46 50 58 58 58 35 58 58 58 58 58 58 50 58 58 49 53 53 58 58 58 51 54 58 50 51 49 50 49 49 32 41 54 36 41 53 51 58 58 52 58 51 54 50 46 46 50 53 49 41 37 37 58 49 51 58 50 53 52 58 42 50 51 40 37 40 54 49 29 44 39 53 28 53 49 25 27 42 54 50 50 54 51 39 37 28 26 37 54 32 31 54 54 42 45 45 40 42 42 40 41 53 39 32 35 37 51 21 27 31 52 38 53 42 51 47 37 37 37 29 33 37 39 32 36 30 39 47 49 52 53 40 45 28 47 28 32 32 52 52 32 32 52 35 53 42 31 32 33 53 25 51 24 31 34 49 49 32 25 33 29 47 32 32 52 33 27 19 46 36 32 32 33 19 34 19 31 45 26 24 32 16 43 20 31 33 23 30 34 31 31 32 30 33 38 36 7 10 32 11 29 17 34 42 42 29 26 33 48 33 27 29 29 31 15 46 29 28 46 46 29 30 28 26 18 13 24 27 31 22 15 25 32 31 24 18 33 20 7 46 44 36 35 31 31 31 32 21 29 31 22 16 32 26 25 12 21 36 30 30 16 32 38 15 30 19 38 29 31 35 38 35 31 34 36 31 27 18 8 38 25 32 13 29 27 31 29 27 30 24 31 25 36 10 18 20 17 14 26 14 23 15 18 17 13 16 7 22 30 48 10 8 16 14 8 9 37 14 12 14 6 37 10 10 10 27 27 32 10 16 4 4 6 4 7 12 15 30 48 24 10 7 21 24 30 22 8 10 21 7 11 27 11 12 6 16 13 21 13 5 20 12 11 8 26 10 6 25 4 15 5 12 20 24 12 32 10 15 29 13 25 13 10 31 12 20 6 8 27 23 24 12 19 24 8 12 19 20 25 28 24 15 28 17 12 11 15 11 28 28 29 11 6 6 18 9 5 18 13 17 5 8 7 11	Open. Hide. 62 47 31 39 62 47 31 62 62 62 62 62 51 56 56 56 44 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 59 56 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 56 59 59 56 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 47 54 62 62 62 62 62 47 62 62 62 62 62 62 38 62 62 62 62 62 62 54 47 62 62 62 62 38 52 62 62 62 62 62 52 52 52 54 58 54 58 58 54 54 52 50 58 52 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 45 28 49 37 52 52 52 54 54 52 48 58 54 54 45 34 43 54 58 54 58 47 52 45 54 52 54 54 54 54 54 50 54 54 58 54 54 58 54 54 58 58 53 58 58 58 49 46 47 58 32 58 51 52 58 54 54 58 52 50 51 50 54 58 58 53 50 49 51 52 46 45 41 58 52 45 49 51 42 38 25 36 33 39 52 54 50 42 53 58 51 51 51 47 58 58 58 50 50 39 44 50 46 49 23 44 52 51 42 39 47 49 51 34 27 37 58 29 49 50 37 54 30 25 35 39 33 40 50 52 37 36 41 50 50 58 32 35 35 26 38 58 39 52 33 19 28 31 39 28 39 53 42 29 29 32 29 31 53 16 47 39 23 41 38 49 34 37 32 38 54 49 37 54 35 42 31 29 54 54 39 42 33 13 41 41 33 44 40 41 32 37 49 37 37 39 33 16 44 28 19 54 31 51 26 49 37 34 52 39 22 33 34 19 11 15 29 54 35 40 51 33 40 28 17 30 33 39 49 21 52 35 52 51 32 31 45 32 39 30 51 8 11 25 26 53 26 25 40 53 21 12 51 31 32 22 11 21 19 25 39 10 29 53 9 11 24 26 51 36 31 37 31 26 8 7 9 30 51 31 19 24 26 18 22 26 28 31 18 31 31 42 35 39 24 18 13 51 30 23 32 46 20 31 16 7 21 27 42 31 17 42 42 10 31 7 19 38 33 31 16 9 9 11 9 30 32 31 42 30 30 46 25 31 20 21 22 15 24 14 31 32 26 26 26 19 30 14 10 16 11 6 5 6 8 9 19 21 31 10 46 16 13 21 31 36 7 20 8 21 20 31 12 8 20 14 11 8 26 8 14 10 26 16 25 24 41 33 10 7 31 12 29 14 8 44 22 33 32 38 14 6 18 21 33 36 11 9 5 13 24 32 21 22 31 31 33 16 18 10 29 20 39 27 19 24 7 31 21 15 21 23 27 14 33 13 6 19 6 8 32 14 37 10 39 9 24 34 48 48 48 48 32 22 33 8 12 6 5 17 29 11 6 18 10 17 14 29 7 5 3 5 6 8 9 13 28 10 5 14 30 8 28 28 7 8 22 40 26 17 6 15 6 7 13 5 27 8 16 10 5 16 11 10 7 18 11 28 8 15 22 28 18 7 6 3 3 8 6 8 5 8 7 21 5 14 3 7 6 4 9 12 15 7 15 7 5 1 1 3 6 12 10 7 7 7 3 1 4 29 18 4 7 6 4 11 15 4 7 19 16 16 16 16 12 5 22 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_9109962_9111044
seq2: B6Ng01-197O16.b_44_1123

seq1  GAATTCAATGCTAACAGGGTCTACAGACAGAGTTCCATGGACAGCCAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATGCTAACAGGGTCTACAGACAGAGTTCCATGGACAGCCAGGG  50

seq1  AGGGCTACATGGAGAGATCCTGCCTCAAACAACAACAAAAACAACACAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCTACATGGAGAGATCCTGCCTCAAACAACAACAAAAACAACACAAC  100

seq1  TTCAAACAAAAATACAATGACAGTCAGAAGACATAACACTCTAGCACGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAACAAAAATACAATGACAGTCAGAAGACATAACACTCTAGCACGTT  150

seq1  GGTTCTCAACATGTGGATCATGATCTTTTAGGGGATATGTAAGACCATCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCTCAACATGTGGATCATGATCTTTTAGGGGATATGTAAGACCATCA  200

seq1  GGAAACACAGATATTTACACTAAGATTCATGACAGTAGTGAAACTACAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAACACAGATATTTACACTAAGATTCATGACAGTAGTGAAACTACAGT  250

seq1  TATGAGGTAGAAATGATAATTTATGGCTGGGGATCACCATAACTAGAGGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAGGTAGAAATGATAATTTATGGCTGGGGATCACCATAACTAGAGGA  300

seq1  ACTGTGATAAAGGGTCCTAGGATTAGAAAGAGTGAGCACCACTGCTCTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTGATAAAGGGTCCTAGGATTAGAAAGAGTGAGCACCACTGCTCTTG  350

seq1  CACATGGTTGCCTAAAGTGGAAATCCAGCATGAGTGATATGATAAGGTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGGTTGCCTAAAGTGGAAATCCAGCATGAGTGATATGATAAGGTGG  400

seq1  AAAGCAGCTACATAAATTTAATCATCTGAATCGACATGGTAGGTGAAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCAGCTACATAAATTTAATCATCTGAATCGACATGGTAGGTGAAAAA  450

seq1  AAGTGACTTTTCCAAATTGTACTCTGACTTGCATAAGTGTAGGGACATAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGACTTTTCCAAATTGTACTCTGACTTGCATAAGTGTAGGGACATAC  500

seq1  ACACGCACACCCCTTTTTTAGGTGAGTAAGAACTCATGAATTTATTGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACGCACACCCCTTTTTTAGGTGAGTAAGAACTCATGAATTTATTGTCT  550

seq1  TCATTACAAAATCAGCATAGAACTAGATCACTGTGCATTGGTGTTTGCTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTACAAAATCAGCATAGAACTAGATCACTGTGCATTGGTGTTTGCTA  600

seq1  CATCTCTGTCTGCATCTGTCTCTTTGTCTCTCTCTGTCTCTCAGTCACTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTCTGTCTGCATCTGTCTCTTTGTCTCTCTCTGTCTCTCAGTCACTC  650

seq1  TGGTTGGTTTGTTTTTTGTTTGCTTTTTGAGACAGGGTTTCTCTGTGTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTGGTTTGTTTTTTGTTTGCTTTTTGAGACAGGGTTTCTCTGTGTAG  700

seq1  CTCTGGCTGTCCTGAAACTCACTCTGTAGTCCAGGCTGGCCTTGAACTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGCTGTCCTGAAACTCACTCTGTAGTCCAGGCTGGCCTTGAACTTT  750

seq1  ATCATCTGCCTGACATGTGTGCCACTGCCACATGGCTGCAAACAAAATCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTGCCTGACATGTGTGCCACTGCCACATGGCTGCAAACAAAATCT  800

seq1  TTATAAGAGTAAAATTAATAAATAAATAGGACTGTAAGACTGGATCACTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAGAGTAAAATTAATAAATAAATAGGACTGTAAGACTGGATCACTA  850

seq1  TCAGGGACATCAGCCCTCTGCCTGGGCTTAGGACCCACACACCAGGGTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGACATCAGCCCTCTGCCTGGGCTTAGGACCCACACACCAGGGTGC  900

seq1  TGCAACAACCAGGTAAGCTAAGAATTCTCTGCTACCACATCCAGCATCAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAACAACCAGGTAAGCTAAGAATTCTCTGCTACCACATCCAGCATCAA  950

seq1  CAGGCCAGCAGACAGGGATGTCCAGAGGGGCACATGAATAGGGGCGTTTG  1000
      ||||||||||||||||||||| |||| ||||||||| ||| |||||||||
seq2  CAGGCCAGCAGACAGGGATGTTCAGA-GGGCACATG-ATA-GGGCGTTTG  997

seq1  TACCCAAGGCTTAGACCAGTTATATTGTGGTGGTGCAGACTTTAGTCCTG  1050
      |||||||| |||||||||| |||| ||||   |||||||||||||| |||
seq2  TACCCAAGCCTTAGACCAG-TATA-TGTG--TGTGCAGACTTTAGT-CTG  1042

seq1  TATCAGCTCCAGGGGAAATCCTTT-----TCTCCTTCT  1083
      |||||||| |  ||||||||||||     |||||||||
seq2  TATCAGCTTCCAGGGAAATCCTTTTTCTCTCTCCTTCT  1080

seq1: chr7_9266052_9267152
seq2: B6Ng01-197O16.g_68_1178 (reverse)

seq1  CCATGATGCATGGA-GTAAAACCAAGCAATCTACTAAGTTGTCTTTTGAA  49
      |||||||||||||| |||||||  ||||||| ||||||||||| ||||||
seq2  CCATGATGCATGGAGGTAAAAC--AGCAATCAACTAAGTTGTC-TTTGAA  47

seq1  GTCATACATTTT-AACA-TATACTGT-ACTTGAAAACAAATTT--AAAGT  94
      |||||||||||| |||| |||||||| ||||| ||||||||||  |||||
seq2  GTCATACATTTTAAACATTATACTGTAACTTG-AAACAAATTTAAAAAGT  96

seq1  ATACAAAATTGTATTAGACGTAAAAAAA-TTAATATGTACA-TCAAAATT  142
       ||| ||||||||||||||||||||||| |||||||||||| ||||||||
seq2  -TAC-AAATTGTATTAGACGTAAAAAAATTTAATATGTACATTCAAAATT  144

seq1  AAATACAAAAATTCCATAAAATATTTTATTGCATTATTTGCTTAAGTGTG  192
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACAAAAATTCCATAAAATATTTTATTGCATTATTTGCTTAAGTGTG  194

seq1  -TGGA-GTGGAT-AACACAT-ATACACGTGCACATATGAGCAAATAATAC  238
       |||| |||||| ||||||| | |||||||||||||||||||||||||||
seq2  TTGGAGGTGGATAAACACATAAAACACGTGCACATATGAGCAAATAATAC  244

seq1  TACTGTCATTAAA--TTTATATTTACTTGTGAGATATCTGTCATGGGTAC  286
      |||||||||||||  || ||||||||||||||||||||||||||||||||
seq2  TACTGTCATTAAAATTTAATATTTACTTGTGAGATATCTGTCATGGGTAC  294

seq1  TGAGATCTG-AACTCAGATTCTCTGGTAGAAC-AACATATTCTATTTATA  334
      ||||||||| |||||||||||||||||||||| |||||||||||||||||
seq2  TGAGATCTGAAACTCAGATTCTCTGGTAGAACAAACATATTCTATTTATA  344

seq1  TCTAATTTAACTTCTTAGGCTCTTAGGCAACTTATCAAATAATATTTGTC  384
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAATTTAACTTCTTAGGCTCTTAGGCAACTTATCAAATAATATTTGTC  394

seq1  CACAAATGCATTGTTGTAGATAAGAATTCTGAAAACCAAGGAAGCACATC  434
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAATGCATTGTTGTAGATAAGAATTCTGAAAACCAAGGAAGCACATC  444

seq1  AACATTCTCTGAAATGACTTGGAAATTAAGTGCAATTGCAATCACTGTTC  484
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTCTCTGAAATGACTTGGAAATTAAGTGCAATTGCAATCACTGTTC  494

seq1  ATGTTGTTACCATGTTGGGGATTACAATTTTAGAATGGAGTATAATTGCT  534
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTGTTACCATGTTGGGGATTACAATTTTAGAATGGAGTATAATTGCT  544

seq1  TATCACAAACCATCTGGGTTACCTCCCTTTCCAGAGGATTCCTCTGTGAT  584
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCACAAACCATCTGGGTTACCTCCCTTTCCAGAGGATTCCTCTGTGAT  594

seq1  TTTGCTCATTCTGTTTCTCAGCACTGATTTCATCTTTGATTCTCATACAA  634
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCTCATTCTGTTTCTCAGCACTGATTTCATCTTTGATTCTCATACAA  644

seq1  ATGGAGGTGAGGCAAGGATTAAAGTATTCAGCTTTCCATATGAAGAAGGA  684
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGTGAGGCAAGGATTAAAGTATTCAGCTTTCCATATGAAGAAGGA  694

seq1  ATCAAGGTGAAGGAACTTTTAGTACAAAGTATCTACAGAGATATTTTTCC  734
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGGTGAAGGAACTTTTAGTACAAAGTATCTACAGAGATATTTTTCC  744

seq1  TTCAGTGCTAAAATGAGTGCACATCATGAACAATAACCAGAACTTTTGAT  784
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGTGCTAAAATGAGTGCACATCATGAACAATAACCAGAACTTTTGAT  794

seq1  TAATGATTGCCAGATGAGGAAACATCTTAGGGCTTATTTCATTAATATTT  834
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGATTGCCAGATGAGGAAACATCTTAGGGCTTATTTCATTAATATTT  844

seq1  TCTACTATTCAAACATAAACATTATATTTCCTCTCATATTCCACCTTCTT  884
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACTATTCAAACATAAACATTATATTTCCTCTCATATTCCACCTTCTT  894

seq1  CCTATGACTTATGACAGGAATCACTTAAATACAATAATGCAATATCTACC  934
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATGACTTATGACAGGAATCACTTAAATACAATAATGCAATATCTACC  944

seq1  TTCACATGAACTCACACATATAAGTATGTATATATACATACAGCCTACCT  984
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACATGAACTCACACATATAAGTATGTATATATACATACAGCCTACCT  994

seq1  GTTCAATTCTGTGTTGTTTCTGTGTCAACAAGTTTGAGCTAGTAAATTCT  1034
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAATTCTGTGTTGTTTCTGTGTCAACAAGTTTGAGCTAGTAAATTCT  1044

seq1  CCAGTACCTATTATACATCTTTTCCCAGTAGAAGTCAGAGGCTCAAAGTG  1084
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTACCTATTATACATCTTTTCCCAGTAGAAGTCAGAGGCTCAAAGTG  1094

seq1  TCATAGGGAATGAATTC  1101
      |||||||||||||||||
seq2  TCATAGGGAATGAATTC  1111

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information