MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-198K18
Chromosome	7 (Build37)
Map Location	9,953,348 - 10,074,861
singlet/doublet	doublet
Overlap gene	LOC100042848, LOC100042096, LOC100042870, LOC100042105, LOC100042859, LOC100042113
Upstream gene	V2r14, EG628128, EG434109, LOC434110, EG628145, EG545909, LOC100042039, LOC100042781, LOC665539, LOC100042795, LOC100042060, EG665552, LOC100042790, LOC100042803, LOC665598, LOC100042810, LOC665593, EG665582, EG434113, EG665577, LOC665571, LOC100042083, Gm1961, V2r4
Downstream gene	LOC100042120, LOC100042126, LOC100042139, LOC100042894, Vmn2r47, 2810047C21Rik, LOC665625, LOC545911, EG625580, LOC100042163, LOC625605, EG434117, EG628152, LOC100042921, Vmn2r52, LOC665663, V1re11, LOC628521, LOC628525, LOC100042206, Nlrp4d, LOC100042214, V1re10, Zik1
Link	Open Mouse BAC browser

Click to get alignment info.

name	V2r14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22305 MGI:1316711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG434109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	LOC434110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 23 Proteins

name	EG628145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	EG545909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins

name	LOC100042039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 23 Proteins

name	LOC665539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC100042795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins pseudo : _no_value

name	LOC100042790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042803 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 Proteins pseudo : _no_value

name	LOC665598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins pseudo : _no_value

name	LOC100042810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 34 Proteins

name	LOC665593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665582 MGI:3645958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins pseudo : _no_value

name	EG434113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	EG665577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665577 MGI:3649133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC665571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	LOC100042083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Gm1961 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381838 MGI:3037819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V2r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22310 MGI:1316666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 21 Proteins

name	LOC100042096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins pseudo : _no_value

name	LOC100042113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC100042120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100042126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	LOC100042139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	Vmn2r47 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 4 ESTs, 13 Proteins

name	2810047C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72716 MGI:1919966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC665625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC545911 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545911
definition	note : ring finger protein 127 pseudogene pseudo : _no_value

name	EG625580 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625580 MGI:3647749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins

name	LOC100042163 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC625605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 31 Proteins

name	EG434117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434117 MGI:3643086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins

name	EG628152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628152 MGI:3646739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 34 Proteins

name	Vmn2r52 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	LOC665663 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V1re11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171264 MGI:2159633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC628525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042206 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Nlrp4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384752 MGI:3056574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1re10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171263 MGI:2159632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zik1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22775 MGI:108070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V2r14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734848 GeneID:22305 MGI:1316711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 14 transcript_id : NM_009489.2

name	EG628128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379363 GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG628128 transcript_id : XM_892854.2

name	EG434109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256112 GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG434109, transcript variant 1 transcript_id : XM_485851.4

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379383 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_485852.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256264 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_899084.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903094 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_899075.1

name	EG545909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379372 GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins product : predicted gene, EG545909 transcript_id : XM_620411.3

name	LOC100042039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256115 GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to putative pheromone receptor transcript_id : XM_001477445.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256269 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479133.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256271 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479139.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256267 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479128.1

name	LOC665539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256117 GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477467.1

name	LOC100042795 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256279 GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479193.1

name	LOC100042060 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256119 GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477489.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256273 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479158.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256275 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479164.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256277 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479175.1

name	LOC100042810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256282 GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 30 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001479213.1

name	LOC100042810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256284 GeneID:100042810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 15 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001479218.1

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379392 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 Proteins product : predicted gene, EG434113, transcript variant 1 transcript_id : XM_485855.3

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256286 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : predicted gene, EG434113, transcript variant 3 transcript_id : XM_899167.3

name	EG434113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903100 GeneID:434113 MGI:3643088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG434113, transcript variant 2 transcript_id : XM_899156.1

name	EG665577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256287 GeneID:665577 MGI:3649133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG665577 transcript_id : XM_977912.2

name	LOC100042083 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256121 GeneID:100042083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to 2810047C21Rik protein transcript_id : XM_001477536.1

name	Gm1961 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383352 GeneID:381838 MGI:3037819
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1961, (NCBI) transcript_id : NM_198961.2

name	V2r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678542 GeneID:22310 MGI:1316666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 4 transcript_id : NM_009493.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256292 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479301.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256294 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479307.1

name	LOC100042848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256290 GeneID:100042848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479298.1

name	LOC100042870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256300 GeneID:100042870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479319.1

name	LOC100042105 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256123 GeneID:100042105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477579.1

name	LOC100042120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256126 GeneID:100042120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 14 transcript_id : XM_001477597.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256313 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479362.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256311 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479351.1

name	LOC100042894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256315 GeneID:100042894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479369.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256305 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 9 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 1 transcript_id : XM_001479327.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256307 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 7 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 2 transcript_id : XM_001479336.1

name	Vmn2r47 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256309 GeneID:100042891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : vomeronasal receptor Vmn2r47, transcript variant 3 transcript_id : XM_001479343.1

name	2810047C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256319 GeneID:72716 MGI:1919966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 2810047C21 gene, transcript variant 2 transcript_id : XM_899317.3

name	EG625580 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256321 GeneID:625580 MGI:3647749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins product : predicted gene, EG625580, transcript variant 1 transcript_id : XM_890962.3

name	LOC625605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379400 GeneID:625605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 27 Proteins product : similar to putative pheromone receptor, transcript variant 1 transcript_id : XM_890970.2

name	EG434117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379391 GeneID:434117 MGI:3643086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins product : predicted gene, EG434117 transcript_id : XM_485858.3

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256325 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479416.1

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256323 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479408.1

name	LOC100042921 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256327 GeneID:100042921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479422.1

name	Vmn2r52 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903126 GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : vomeronasal receptor Vmn2r52, transcript variant 2 transcript_id : XM_899367.1

name	Vmn2r52 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903128 GeneID:384534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins product : vomeronasal receptor Vmn2r52, transcript variant 1 transcript_id : XM_891019.1

name	V1re11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098144 GeneID:171264 MGI:2159633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E11 transcript_id : NM_134230.2

name	Nlrp4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256128 GeneID:384752 MGI:3056574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : NLR family, pyrin domain containing 4D transcript_id : XM_001481310.1

name	V1re10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717774 GeneID:171263 MGI:2159632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E10 transcript_id : NM_134229.1

name	Zik1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374193 GeneID:22775 MGI:108070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein interacting with K protein 1 transcript_id : NM_009577.3

name	V2r14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734849 CCDS:CCDS20787.1 GeneID:22305 MGI:1316711
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 14 product : vomeronasal 2, receptor, 14 protein_id : NP_033515.2

name	EG628128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379364 GeneID:628128 MGI:3643130
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_897947.2

name	EG434109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256113 GeneID:434109 MGI:3646061
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485851.4

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903099 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904177.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903095 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904168.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903097 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485852.2

name	EG545909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555338 GeneID:545909 MGI:3704108
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_620411.1

name	LOC100042039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256116 GeneID:100042039
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477495.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256268 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479178.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256270 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479183.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256272 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479189.1

name	LOC665539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256118 GeneID:665539
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477517.1

name	LOC100042795 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256280 GeneID:100042795
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479243.1

name	LOC100042060 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256120 GeneID:100042060
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477539.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256274 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479208.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256276 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479214.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256278 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479225.1

name	LOC100042810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256283 GeneID:100042810
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001479263.1

name	LOC100042810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256285 GeneID:100042810
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001479268.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903105 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904260.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903101 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904249.1

name	EG434113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903103 GeneID:434113 MGI:3643088
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485855.2

name	EG665577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379381 GeneID:665577 MGI:3649133
definition	codon_start : 1 product : similar to CDNA sequence BC023179 protein_id : XP_983006.1

name	LOC100042083 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256122 GeneID:100042083
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001477586.1

name	Gm1961 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080207 CCDS:CCDS20789.1 GeneID:381838 MGI:3037819
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 product : EC2-V2R pheromone receptor protein_id : NP_945199.1

name	V2r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678543 CCDS:CCDS20788.1 GeneID:22310 MGI:1316666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 4 product : vomeronasal 2, receptor, 4 protein_id : NP_033519.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256291 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479348.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256293 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479351.1

name	LOC100042848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256295 GeneID:100042848
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479357.1

name	LOC100042870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256301 GeneID:100042870
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479369.1

name	LOC100042105 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256124 GeneID:100042105
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477629.1

name	LOC100042120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256127 GeneID:100042120
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 protein_id : XP_001477647.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256314 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479412.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256312 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479401.1

name	LOC100042894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256316 GeneID:100042894
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479419.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256308 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479386.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256306 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479377.1

name	Vmn2r47 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256310 GeneID:100042891
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479393.1

name	2810047C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256320 GeneID:72716 MGI:1919966
definition	codon_start : 1 product : hypothetical protein LOC72716 isoform 2 protein_id : XP_904410.3

name	EG625580 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256322 GeneID:625580 MGI:3647749
definition	codon_start : 1 product : similar to putative pheromone receptor isoform 1 protein_id : XP_896055.3

name	LOC625605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903123 GeneID:625605
definition	codon_start : 1 product : similar to putative pheromone receptor isoform 1 protein_id : XP_896063.1

name	EG434117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51742862 GeneID:434117 MGI:3643086
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_485858.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256326 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479466.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256324 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479458.1

name	LOC100042921 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256328 GeneID:100042921
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479472.1

name	Vmn2r52 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903127 GeneID:384534
definition	codon_start : 1 product : similar to predicted gene, EG665255 isoform 2 protein_id : XP_904460.1

name	Vmn2r52 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903129 GeneID:384534
definition	codon_start : 1 product : similar to predicted gene, EG665255 isoform 1 protein_id : XP_896112.1

name	V1re11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098145 CCDS:CCDS20790.1 GeneID:171264 MGI:2159633
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 E3 product : vomeronasal 1 receptor, E11 protein_id : NP_598991.2

name	Nlrp4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256129 GeneID:384752 MGI:3056574
definition	codon_start : 1 note : overriding stop codons product : NLR family, pyrin domain containing 4D protein_id : XP_001481360.1 transl_except : (pos:complement(10967341..10967343),aa:OTHER) transl_except : (pos:complement(10967335..10967337),aa:OTHER) transl_except : (pos:complement(10967314..10967316),aa:OTHER) transl_except : (pos:complement(10967266..10967268),aa:OTHER) transl_except : (pos:complement(10967239..10967241),aa:OTHER) transl_except : (pos:complement(10967236..10967238),aa:OTHER) transl_except : (pos:complement(10967233..10967235),aa:OTHER) transl_except : (pos:complement(10967221..10967223),aa:OTHER) transl_except : (pos:complement(10967203..10967205),aa:OTHER) transl_except : (pos:complement(10967146..10967148),aa:OTHER) transl_except : (pos:complement(10967122..10967124),aa:OTHER) transl_except : (pos:complement(10966789..10966791),aa:OTHER) transl_except : (pos:complement(10966756..10966758),aa:OTHER) transl_except : (pos:complement(10966747..10966749),aa:OTHER) transl_except : (pos:complement(10966723..10966725),aa:OTHER) transl_except : (pos:complement(10966663..10966665),aa:OTHER) transl_except : (pos:complement(10966600..10966602),aa:OTHER) transl_except : (pos:complement(10966570..10966572),aa:OTHER) transl_except : (pos:complement(10966564..10966566),aa:OTHER) transl_except : (pos:complement(10966543..10966545),aa:OTHER) transl_except : (pos:complement(10966489..10966491),aa:OTHER) transl_except : (pos:complement(10966477..10966479),aa:OTHER) transl_except : (pos:complement(10966450..10966452),aa:OTHER) transl_except : (pos:complement(10966408..10966410),aa:OTHER) transl_except : (pos:complement(10966390..10966392),aa:OTHER) transl_except : (pos:complement(10966357..10966359),aa:OTHER) transl_except : (pos:complement(10966354..10966356),aa:OTHER) transl_except : (pos:complement(10963708..10963710),aa:OTHER) transl_except : (pos:complement(10963657..10963659),aa:OTHER) transl_except : (pos:complement(10963201..10963203),aa:OTHER) transl_except : (pos:complement(10963192..10963194),aa:OTHER) transl_except : (pos:complement(10963156..10963158),aa:OTHER) transl_except : (pos:complement(10963138..10963140),aa:OTHER) transl_except : (pos:complement(10963129..10963131),aa:OTHER) transl_except : (pos:complement(10963093..10963095),aa:OTHER) transl_except : (pos:complement(10963075..10963077),aa:OTHER) transl_except : (pos:complement(10960385..10960387),aa:OTHER) transl_except : (pos:complement(10960373..10960375),aa:OTHER) transl_except : (pos:complement(10960370..10960372),aa:OTHER) transl_except : (pos:complement(10960316..10960318),aa:OTHER) transl_except : (pos:complement(10957517..10957519),aa:OTHER) transl_except : (pos:complement(10957493..10957495),aa:OTHER) transl_except : (pos:complement(10957484..10957486),aa:OTHER) transl_except : (pos:complement(10957442..10957444),aa:OTHER) transl_except : (pos:complement(10957430..10957432),aa:OTHER) transl_except : (pos:complement(10957409..10957411),aa:OTHER) transl_except : (pos:complement(10957360..10957362),aa:OTHER) transl_except : (pos:complement(10957345..10957347),aa:OTHER) transl_except : (pos:complement(10949606..10949608),aa:OTHER) transl_except : (pos:complement(10949585..10949587),aa:OTHER) transl_except : (pos:complement(10949534..10949536),aa:OTHER) transl_except : (pos:complement(10949528..10949530),aa:OTHER) transl_except : (pos:complement(10949501..10949503),aa:OTHER) transl_except : (pos:complement(10948291..10948293),aa:OTHER) transl_except : (pos:complement(10948285..10948287),aa:OTHER) transl_except : (pos:complement(10948264..10948266),aa:OTHER) transl_except : (pos:complement(10948234..10948236),aa:OTHER) transl_except : (pos:complement(10948216..10948218),aa:OTHER) transl_except : (pos:complement(10948195..10948197),aa:OTHER) transl_except : (pos:complement(10948186..10948188),aa:OTHER) transl_except : (pos:complement(10948171..10948173),aa:OTHER)

name	V1re10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717775 GeneID:171263 MGI:2159632
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : vomeronasal 1 receptor, E10 protein_id : NP_598990.1

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 1 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 2 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 3 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 4 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 5 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 6 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 1 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 2 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 3 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 4 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 5 pseudo : _no_value

name	LOC665593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665593
definition	number : 6 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 1 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 2 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 3 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 4 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 5 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 6 pseudo : _no_value

name	LOC665571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665571
definition	number : 7 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 1 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 2 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 3 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 4 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 5 pseudo : _no_value

name	LOC100042096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042096
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 7 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 6 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 5 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 4 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 3 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 2 pseudo : _no_value

name	LOC100042126 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042126
definition	number : 1 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 13 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 12 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 11 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 10 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 9 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 8 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 7 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 6 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 5 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 4 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 3 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 2 pseudo : _no_value

name	LOC100042139 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042139
definition	number : 1 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 8 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 7 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 6 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 5 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 4 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 3 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 2 pseudo : _no_value

name	LOC665625 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665625
definition	number : 1 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 6 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 5 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 4 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 3 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 2 pseudo : _no_value

name	LOC100042163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042163
definition	number : 1 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 7 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 6 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 5 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 4 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 3 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 2 pseudo : _no_value

name	EG628152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628152
definition	number : 1 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 6 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 5 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 4 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 3 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 2 pseudo : _no_value

name	LOC665663 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665663
definition	number : 1 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 3 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 2 pseudo : _no_value

name	LOC628521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628521
definition	number : 1 pseudo : _no_value

name	LOC628525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628525
definition	number : 1 pseudo : _no_value

name	LOC100042206 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042206
definition	number : 1 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 4 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 3 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 2 pseudo : _no_value

name	LOC100042214 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042214
definition	number : 1 pseudo : _no_value

name	EG628145 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256114 GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG628145 pseudo : _no_value transcript_id : XR_033222.1

name	EG665552 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379373 GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins product : predicted gene, EG665552 pseudo : _no_value transcript_id : XR_001747.1

name	LOC665598 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256281 GeneID:665598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_034098.1

name	EG665582 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379382 GeneID:665582 MGI:3645958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 16 Proteins product : predicted gene, EG665582 pseudo : _no_value transcript_id : XR_002292.1

name	LOC100042859 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256296 GeneID:100042859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 25 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_034147.1

name	LOC100042113 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256125 GeneID:100042113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15 pseudo : _no_value transcript_id : XR_033289.1

clone name	MSMg01-367O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117L02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-198K18.b	B6Ng01-198K18.g
ACC	GA020208	GA020209
length	1,138	1,172
definition	B6Ng01-198K18.b	B6Ng01-198K18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(9,953,348 - 9,954,474)	(10,073,662 - 10,074,861)
sequence	gaattcactctggaaagaagcatttcaggtgaagtgagtgttgcaaaacc ttcaaggacaactgcttccttgttactcatcagcgagttcacacagagga gacacttttacatggactaaacgtggcaagtcatacattaacagatccag tattttgactgcacgtatatgtgaatactaagtgcataactaatgcctat gagagaccccccaaatgcattggattcctggaacaggacatacagatggg tatgaagcagtctgtttcctggaaatgaaaccccggtcctctaccatagc agaatatggacttacaagctgaaccctctctaaaatccatgttttacatt tttaagaagttactagattttgttctaaaaggctgtgtgtttcagttttc ctcctgttgcacatcagataccagtttgtcacatcctgacattttccaag tcgtgaggtattcactttaacaattttagtaactatgttggctcaggcat gatggtgcaggctttaatcccagcactcaggaggcagaggcagctgtagt cagtgagttcaaggtcgtcatggtctaggagttccagatccttgtatacc tttaagtgaatgctgtgaattgaaccaaagttatttgcaataagagtatg tgctgttattcagtgagccattttcctgaccctgtatctatgtttccttt tttgtttatatacagtcttaggatgttggtttggctagcttgttttctct ctgtatcacaagttgtcctagaactcatagacctaccatattctgggttc tgagtgctggtattaaagacatacccctctgggagatcaaaataaaccgg tgttttcctgccttaaccattgccctgagtagattttgggtgctaggtct gcacccaaccacacaacaccagaggatgctggacaacacaggtgttctaa tacacccatgatcataggatcacagctttctttgggaatttgatcatgcc aggatttcaggatcctagaggcacttgaactcccaggcactcttacatgc cagattttcaggatcaatggcatcacaggtgacagcttgacttcttgaag gagctctgataagtccaggaaaaacaggatggaacaag	gaattcctggccaatgataactcacacgcagagataagaagctgtccagg tacatccagaaacttaaagatacatcccacttgggtcctgaaagctgaaa tgaacacatagtctcttcattacagaaataattaggaatagggctttgtt ttttttttatgaaataaatatggtgtaggtgttacagtttttccatcaca aaggcccaaagtgtatcttataatcaaagacatatttggtaaaagatcag gatttctgttgatttcatccattgcaaacaccaatgccaaagcatatttg tggtttttagttgtttttctgtaaaagaatacagtgtttattatggacag atgattatacatgagcatttgtactcaatagaagcactacactatactgg aagtttctgcatctgacatctaaagacgggaacaaatggcttttgttata agattggattgacagatggacctggaaaatagaaagcactttaaaaattt atgacagtgttggtcccataattaagagatggtattgacctcatccacag agataatttccatttttgtttttgagtgcttgatcagaaggaaaagagat aaccacagatattgacaaaacagtaattctgatcatgtcttcattttgaa attattgagcaataaatgtatttgttattagagccactgagttcatgata ttttctcgtgaaattaactgaattggttaaggaaatgaaaccatagccag gagtggtgtcattctcctttaatcccagcacttgggatgcagaagcaggt ggatttctgagtttgaggccagcctggtctacaaagtgagttcccggaga gccagagctatacagagaaaccctatctcaaaaaaaaaaaaagaaagaaa agaaaggaaatagaataaagtaagaaggaccgaaggaaggagagaaggga aagaaaaaaaggaagaaagaagagagaaataatcatactaataatattaa taatgaaccgtgatttataatgcataacggtctctctcttcagcaacaat tggattctgtactatatcattaacagtagaagtcaaaattcctgaccaat tcgttcaatctatcctcatgctgtaatttcatctttatgaaataaaatat ttctctaagggtctatttttaa
quality values	Open. Hide. 49 22 33 35 58 35 24 42 58 58 58 49 62 47 62 62 52 62 62 62 56 62 47 62 62 47 41 62 62 62 62 44 39 30 27 32 24 35 34 38 32 38 38 50 59 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 46 54 59 49 50 56 56 59 59 62 62 62 62 62 62 62 62 62 54 54 62 59 59 59 62 62 59 62 62 62 59 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 51 62 62 62 62 62 62 62 54 54 43 62 62 47 62 62 56 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 62 62 49 62 62 62 46 62 62 62 49 62 62 62 62 54 52 52 62 62 52 62 52 62 62 54 62 62 62 62 47 58 54 39 58 58 54 52 54 25 58 58 58 58 58 54 54 58 58 54 58 54 54 58 58 58 54 48 58 58 54 54 58 58 58 54 58 54 54 58 52 58 58 58 58 54 54 54 48 58 49 39 58 52 52 52 52 39 58 54 54 58 58 58 58 54 39 46 50 48 43 52 52 58 58 58 58 58 54 58 58 40 58 49 58 58 51 58 58 53 53 58 58 58 47 49 58 50 58 58 50 48 58 49 38 58 58 51 52 51 46 54 58 58 49 45 33 51 50 49 58 49 58 51 58 58 51 50 50 51 58 50 35 28 43 58 41 46 48 43 43 49 58 58 51 32 52 51 58 51 32 58 58 50 58 39 51 49 52 52 58 47 54 54 58 38 50 58 34 58 58 58 58 58 58 50 58 42 53 50 53 53 39 51 40 39 18 39 58 41 30 6 44 46 32 54 31 51 54 58 29 46 33 54 30 35 47 33 25 30 34 33 54 13 54 54 34 28 34 29 49 54 40 54 33 44 52 34 33 33 40 51 52 53 48 40 28 32 54 37 51 12 32 42 26 47 40 33 53 53 32 34 19 19 47 37 32 38 35 53 37 33 31 30 24 54 54 33 25 41 35 40 40 53 17 33 52 28 40 51 53 26 31 32 35 33 52 33 32 30 25 29 34 27 31 32 31 25 27 27 26 32 46 22 19 19 35 17 31 32 51 51 41 31 21 51 41 27 30 30 38 26 45 38 51 51 42 31 11 19 30 20 30 24 35 33 41 18 14 13 31 30 45 30 46 39 31 33 31 20 25 20 22 42 21 48 48 31 43 46 46 30 31 24 31 43 33 46 13 20 27 31 28 24 31 40 31 24 7 21 25 26 33 19 15 11 21 17 7 13 13 30 26 39 15 13 18 16 36 21 27 26 25 8 5 14 6 11 9 27 27 36 44 30 31 28 21 27 27 33 15 12 7 5 5 8 28 22 26 19 16 18 19 20 20 31 33 36 22 34 32 28 23 17 10 32 10 7 44 18 31 18 44 38 12 44 9 31 30 23 48 21 16 19 10 11 16 21 34 13 28 14 12 11 32 23 48 13 10 17 26 11 33 14 11 19 6 10 4 4 4 10 10 11 6 4 4 21 15 10 24 21 27 29 20 20 8 15 18 13 20 28 15 18 29 11 16 9 28 22 10 9 9 3 10 8 29 34 21 7 7 21 10 11 16 26 13 18 13 16 17 4 6 8 5 7 13 9 5 4 5 3 11 9 8 15 7 10 7 3 3 3 6 4 10 8 16 10 7 10 11 8 8 4 4 6 12 20 6 5 9 12 3 1 2 11 15 12 12 12 10 28 16 22 4 8 19 6 13 22 6 7 16 9 8 6 4 17 6	Open. Hide. 62 47 62 47 62 62 62 62 62 62 32 31 19 21 21 24 14 28 27 28 43 38 44 59 62 62 62 62 59 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 59 49 48 42 43 48 62 62 59 62 62 54 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 49 54 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 54 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 52 47 62 62 62 62 62 62 58 54 58 58 58 54 58 54 58 58 58 54 58 47 58 54 54 39 58 58 54 54 45 58 58 54 45 52 54 54 46 54 54 52 42 49 58 58 54 42 42 49 54 54 42 58 58 54 54 52 58 58 58 58 58 58 54 58 58 58 58 54 58 52 54 54 35 58 58 58 54 49 54 39 42 58 58 20 58 53 58 58 58 53 58 53 42 41 51 51 45 39 47 58 50 47 45 50 50 45 58 58 58 58 51 58 58 58 58 51 58 58 51 41 37 58 52 51 54 47 39 53 53 51 58 52 51 51 58 53 46 58 58 58 40 58 41 49 50 51 50 50 35 48 54 53 50 53 51 51 41 31 58 49 51 58 38 40 41 58 58 39 31 26 50 31 51 58 46 58 50 46 43 33 39 41 41 33 31 58 33 42 34 41 58 58 41 47 30 58 54 38 44 47 47 40 52 49 42 54 24 20 39 38 39 40 49 46 36 28 39 47 54 44 37 37 50 39 29 54 31 54 33 32 51 37 47 41 30 42 24 42 33 32 46 42 30 46 49 46 34 33 54 52 26 51 37 37 32 32 16 24 40 32 40 40 54 31 30 21 37 32 53 29 26 34 42 31 31 31 35 46 49 31 32 28 45 33 37 29 33 20 18 34 28 12 46 26 52 43 21 18 49 31 34 45 31 33 15 38 51 33 30 43 31 34 29 31 11 16 12 33 27 30 31 31 37 31 31 21 28 40 23 26 30 31 31 36 42 37 31 40 30 30 31 31 9 29 20 21 25 23 23 42 7 25 31 28 31 15 31 19 29 42 25 32 28 19 22 32 25 31 29 37 29 32 25 34 46 32 12 32 31 39 41 39 36 37 37 32 24 28 37 25 32 18 31 23 18 19 16 32 18 6 6 31 32 29 31 7 37 38 31 7 26 36 20 9 21 16 21 31 35 44 12 9 35 6 17 23 29 43 8 7 15 17 7 8 26 20 24 22 24 33 16 36 14 21 44 24 11 7 36 27 31 22 30 10 5 12 12 10 14 14 21 11 19 10 8 11 8 6 6 8 12 31 9 24 9 5 9 5 4 7 8 4 9 9 4 5 6 8 7 5 4 3 5 5 11 4 6 3 6 25 25 17 7 3 4 17 26 20 29 25 14 20 4 8 16 28 16 20 28 8 9 23 21 18 7 17 13 7 7 8 20 11 13 17 20 20 19 9 15 8 9 6 8 12 20 6 9 23 19 8 13 4 10 8 19 10 22 6 6 13 6 13 8 21 23 5 5 4 3 1 3 6 11 7 9 20 6 7 14 29 26 11 14 13 8 5 17 11 6 5 17 4 6 11 4 5 2 3 8 9 4 2 2 3 6 13 8 17 15 5 6 11 8 23 12 4 10 7 4 4 8 5 3 5 2 1 3 5 20 13 3 4 4 3 14 4 5 10 29 26 6 4 4 14 18 7 6 5 5 6 18 15 4 6 2 3 1 4 17 12 22 18 20 13 6 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_9953348_9954474
seq2: B6Ng01-198K18.b_46_1183

seq1  GAATTCACTCTGGAAAGAAGCATTTCAGGTGAAGTGAGTGTTGCAAAACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTGGAAAGAAGCATTTCAGGTGAAGTGAGTGTTGCAAAACC  50

seq1  TTCAAGGACAACTGCTTCCTTGTTACTCATCAGCGAGTTCACACAGAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAGGACAACTGCTTCCTTGTTACTCATCAGCGAGTTCACACAGAGGA  100

seq1  GACACTTTTACATGGACTAAACGTGGCAAGTCATACATTAACAGATCCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACTTTTACATGGACTAAACGTGGCAAGTCATACATTAACAGATCCAG  150

seq1  TATTTTGACTGCATGTATATGTGAATACTAAGTGCATAACTAATGCCTAT  200
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TATTTTGACTGCACGTATATGTGAATACTAAGTGCATAACTAATGCCTAT  200

seq1  GAGAGACCCCCCAAATGCATTGGATTCCTGGAACAGGACATACAGATGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGACCCCCCAAATGCATTGGATTCCTGGAACAGGACATACAGATGGG  250

seq1  TATGAAGCAGTCTGTTTCCTGGAAATGAAACCCCGGTCCTCTACCATAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAGCAGTCTGTTTCCTGGAAATGAAACCCCGGTCCTCTACCATAGC  300

seq1  AGAATATGGACTTACACGCTGAACCCTCTCTAAAATCCATGTTTTACATT  350
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  AGAATATGGACTTACAAGCTGAACCCTCTCTAAAATCCATGTTTTACATT  350

seq1  TTTAAGAAGTTACTAGATTTTGTTCTAAAAGGCTGTGTGTTTCAGTTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGAAGTTACTAGATTTTGTTCTAAAAGGCTGTGTGTTTCAGTTTTC  400

seq1  CTCCTGTTGCACATCAGATACCAGTTTGTCACATCCTGACATTTTCCAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGTTGCACATCAGATACCAGTTTGTCACATCCTGACATTTTCCAAG  450

seq1  TCGTGAGGTATTCACTTTAACAATTTTAGTAACTATGTTGGCTCAGGCAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTGAGGTATTCACTTTAACAATTTTAGTAACTATGTTGGCTCAGGCAT  500

seq1  GATGGTGCAGGCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGCTGTAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGTGCAGGCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGCTGTAGT  550

seq1  CAGTGAGTTCAAGGTCGTCATGGTCTAGGAGTTCCAGATCCTTGTATACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGAGTTCAAGGTCGTCATGGTCTAGGAGTTCCAGATCCTTGTATACC  600

seq1  TTTAAGTGAATGCTGTGAATTGAACCAAAGTTATTTGCAATAAGAGTATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGTGAATGCTGTGAATTGAACCAAAGTTATTTGCAATAAGAGTATG  650

seq1  TGCTGTTATTCAGTGAGCCATTTTCCTGACCCTGTATCTATGTTTCCTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTTATTCAGTGAGCCATTTTCCTGACCCTGTATCTATGTTTCCTTT  700

seq1  TTTGTTTATATACAGTCTTAGGATGTTGGTTTGGCTAGCTTG-TTTCTCT  749
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TTTGTTTATATACAGTCTTAGGATGTTGGTTTGGCTAGCTTGTTTTCTCT  750

seq1  CTGTATCACAAGTTGTCCTAGAACTCATAGACCTACCATATTCTGGGTTC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTATCACAAGTTGTCCTAGAACTCATAGACCTACCATATTCTGGGTTC  800

seq1  TGAGTGCTGGTATTAAAGACATACCCCTCTGGGAGATCAAAATAAACCGG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTGCTGGTATTAAAGACATACCCCTCTGGGAGATCAAAATAAACCGG  850

seq1  TGTTTTCCTGCCTTAACCATTGCCCTGAGTAGATTTTGGGTGCTAGGTCT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTCCTGCCTTAACCATTGCCCTGAGTAGATTTTGGGTGCTAGGTCT  900

seq1  GCACCCAACCACACAACACCCAGAGGATGCTGGAC-ACACAGGTGTTCTA  948
      |||||||||||||||||| |||||||||||||||| ||||||||||||||
seq2  GCACCCAACCACACAACA-CCAGAGGATGCTGGACAACACAGGTGTTCTA  949

seq1  ATACACCCATGATCATAGGATCACAGC-TTCTTT-GGAATTTGATCATGC  996
      ||||||||||||||||||||||||||| |||||| |||||||||||||||
seq2  ATACACCCATGATCATAGGATCACAGCTTTCTTTGGGAATTTGATCATGC  999

seq1  CAGGATTTCAGGATCCTAGAGGCACCTTGACTCCCAGGCACTCTTACATG  1046
      ||||||||||||||||||||||||| |  |||||||||||||||||||||
seq2  CAGGATTTCAGGATCCTAGAGGCACTTGAACTCCCAGGCACTCTTACATG  1049

seq1  -CAGAATTTCAGGATCAATGG-ATCACA-GAGACAGCTGGAC-TCT--GA  1090
       |||| ||||||||||||||| |||||| | ||||||| ||| |||   |
seq2  CCAGATTTTCAGGATCAATGGCATCACAGGTGACAGCTTGACTTCTTGAA  1099

seq1  GGAGCTCTGATAAATCCAGG-AAAACAAGATGG-ACAAG  1127
      ||||||||||||| |||||| |||||| ||||| |||||
seq2  GGAGCTCTGATAAGTCCAGGAAAAACAGGATGGAACAAG  1138

seq1: chr7_10073662_10074861
seq2: B6Ng01-198K18.g_68_1239 (reverse)

seq1  TTAAAAATAAAACTTTAGA-AAATATTTTATTTCAATAAAAGATTGAAAA  49
      ||||||||| | | ||||| |||||||||||||| |||||     ||  |
seq2  TTAAAAATAGACCCTTAGAGAAATATTTTATTTC-ATAAA-----GATGA  44

seq1  AATAACAGCATGAGGATAGATATGAAGGGATGTGTCAAGAATTTTGACCT  99
      ||| ||||||||||||||||| |||| | ||  |||| |||||||||| |
seq2  AATTACAGCATGAGGATAGAT-TGAACGAATTGGTCAGGAATTTTGACTT  93

seq1  CTAATTGTAAATGATTATAAGTACAGGAATCAAATGTTGCTGAAGAGAGA  149
      || | ||| ||||| ||| ||||||| |  ||| ||||||||||||||||
seq2  CT-ACTGTTAATGA-TAT-AGTACAGAATCCAATTGTTGCTGAAGAGAGA  140

seq1  GACCGTTATGCATTAATAAATCATGGTTTCATTTATTTATTTATTTATTT  199
      |||||||||||||| |||||||| || ||||             ||||| 
seq2  GACCGTTATGCATT-ATAAATCACGG-TTCA-------------TTATTA  175

seq1  ATTTATTTATTTATTTATTTATTTCTCTCTTTCTTTCTTCCTTTTTTTCT  249
      ||    |||||  | |  ||||||||||| ||||||||||||||||||||
seq2  AT---ATTATTAGTATGATTATTTCTCTC-TTCTTTCTTCCTTTTTTTCT  221

seq1  TT-CCTTCTCTCTTTCTTTCGTTCTTTCTTACTTTTTTCTATTTTCTTTT  298
      || ||||||||| ||| |||| || |||||||||| |||||||| |  ||
seq2  TTCCCTTCTCTCCTTCCTTCGGTCCTTCTTACTTTATTCTATTTCC--TT  269

seq1  TCTTTTCTTTCTTTCTTTTTTTTTTGAGATAGGGTTTCTCTGTATAGCTC  348
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TCTTTTCTTTCTTT-TTTTTTTTTTGAGATAGGGTTTCTCTGTATAGCTC  318

seq1  TGGCTCTCCGGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCTCCGGGAACTCACTTTGTAGACCAGGCTGGCCTCAAACTCAGAA  368

seq1  ATCCACCTGCTTCTGCATCCCAAGTGCTGGGATTAAAGGAGAATGACACC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCACCTGCTTCTGCATCCCAAGTGCTGGGATTAAAGGAGAATGACACC  418

seq1  ACTCCTGGCTATGGTTTCATTTCCTTAACCAATTCAGTTAATTTCACGAG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCTGGCTATGGTTTCATTTCCTTAACCAATTCAGTTAATTTCACGAG  468

seq1  AAAATATCATGAACTCAGTGGCTCTAATAACAAATACATTTATTGCTCAA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATATCATGAACTCAGTGGCTCTAATAACAAATACATTTATTGCTCAA  518

seq1  TAATTTCAAAATGAAGACATGATCAGAATTACTGTTTTGTCAATATCTGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTCAAAATGAAGACATGATCAGAATTACTGTTTTGTCAATATCTGT  568

seq1  GGTTATCTCTTTTCCTTCTGATCAAGCACTCAAAAACAAAAATGGAAATT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTATCTCTTTTCCTTCTGATCAAGCACTCAAAAACAAAAATGGAAATT  618

seq1  ATCTCTGTGGATGAGGTCAATACCATCTCTTAATTATGGGACCAACACTG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTGTGGATGAGGTCAATACCATCTCTTAATTATGGGACCAACACTG  668

seq1  TCATAAATTTTTAAAGTGCTTTCTATTTTCCAGGTCCATCTGTCAATCCA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAAATTTTTAAAGTGCTTTCTATTTTCCAGGTCCATCTGTCAATCCA  718

seq1  ATCTTATAACAAAAGCCATTTGTTCCCGTCTTTAGATGTCAGATGCAGAA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTATAACAAAAGCCATTTGTTCCCGTCTTTAGATGTCAGATGCAGAA  768

seq1  ACTTCCAGTATAGTGTAGTGCTTCTATTGAGTACAAATGCTCATGTATAA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCCAGTATAGTGTAGTGCTTCTATTGAGTACAAATGCTCATGTATAA  818

seq1  TCATCTGTCCATAATAAACACTGTACTCTTTTACAGAAAAACAACTAAAA  898
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TCATCTGTCCATAATAAACACTGTATTCTTTTACAGAAAAACAACTAAAA  868

seq1  ACCAC-AATATGCTTTGGCATTGGTGTTTGCAATGGATGAAATCAACAGA  947
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACAAATATGCTTTGGCATTGGTGTTTGCAATGGATGAAATCAACAGA  918

seq1  AATCCTGATCTTTTACCAAATATGTCTTTGATTATAAGATACACTTTGGG  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCTGATCTTTTACCAAATATGTCTTTGATTATAAGATACACTTTGGG  968

seq1  CCTTTGTGATGGAAAAACTGTAACACCTACACCATATTTATTTCAT-AAA  1046
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  CCTTTGTGATGGAAAAACTGTAACACCTACACCATATTTATTTCATAAAA  1018

seq1  AAAAAACAAAGCCCTATTCCTAATTATTTCTGTAATGAAGAGACTATGTG  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACAAAGCCCTATTCCTAATTATTTCTGTAATGAAGAGACTATGTG  1068

seq1  TTCATTTCAGCTTTCAGGACCCAAGTGGGATGTATCTTTAAGTTTCTGGA  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTTCAGCTTTCAGGACCCAAGTGGGATGTATCTTTAAGTTTCTGGA  1118

seq1  TGTACCTGGACAGCTTCTTATCTCTGCGTGTGAGTTATCATTGGCCAGGA  1196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACCTGGACAGCTTCTTATCTCTGCGTGTGAGTTATCATTGGCCAGGA  1168

seq1  ATTC  1200
      ||||
seq2  ATTC  1172

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information