MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-208C18
Chromosome	7 (Build37)
Map Location	5,919,162 - 5,920,231
singlet/doublet	singlet
Overlap gene	LOC100041666
Upstream gene	Gm1078, Zfp579, Fiz1, Zfp524, 6430526N21Rik, 4632433K11Rik, Zfp784, Zfp580, Ccdc106, U2af2, Epn1, Rfpl4, Rasl2-9, EG665126, V1rd5, V1rd3, EG665150, Nlrp2, EG272350, V1rd4, EG665163, V1rd10, EG630071, EG665255, EG636697, EG636705, LOC636731, LOC673215, V1rd2, LOC100041627, LOC100041637, V1rd1, LOC100041647, V1rd11
Downstream gene	V1rd6, EG384525, EG269859, Nlrp4c, Zfp787, Zfp444, Galp, Zfp371, EG627821, Zfp667, Zfp583, LOC100042467, LOC100042459, Zfp78, Zfp28, LOC100042450, Olfr1344, GA_x5J8B7W3DQU-679632-679375, Olfr1336, Olfr1346, Olfr5, Olfr1347, Olfr1348, Olfr1349, LOC665328, Olfr1350, Zim2, Zim1, Peg3, Usp29, LOC627961
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm1078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381835 MGI:2685924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	Zfp579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68490 MGI:1915740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fiz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23877 MGI:1344336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66056 MGI:1916740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430526N21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319748 MGI:2442656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632433K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77043 MGI:1924293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654801 MGI:3606042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp580 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68992 MGI:1916242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs, 3 Proteins

name	Ccdc106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232821 MGI:2385900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	U2af2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22185 MGI:98886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13854 MGI:1333763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfpl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192658 MGI:2149590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasl2-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19428 MGI:104605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665126 MGI:3643242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1239 ESTs, 28 Proteins pseudo : _no_value

name	V1rd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384522 MGI:3033474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	V1rd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81015 MGI:3033472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665150 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665150 MGI:3646165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins pseudo : _no_value

name	Nlrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232827 MGI:3041206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG272350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272350 MGI:3643170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	V1rd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81014 MGI:3033473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665163 MGI:3649034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	V1rd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404284 MGI:3033479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630071 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630071 MGI:3645676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665255 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665255 MGI:3645468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG636697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636697 MGI:3645244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG636705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636705 MGI:3646079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC636731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 29 Proteins pseudo : _no_value

name	LOC673215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	V1rd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81016 MGI:3033471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041627 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	V1rd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041647 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81013 MGI:3033475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins

name	EG269859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269859 MGI:3647769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Nlrp4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83564 MGI:1890518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp787 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67109 MGI:1914359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72667 MGI:1923365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232836 MGI:2663979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170734 MGI:2159640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627821 MGI:3643580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	Zfp667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384763 MGI:2442757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213011 MGI:2682297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfp78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22690 MGI:99175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Olfr1344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257882 MGI:3031178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3DQU-679632-679375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257846
definition	note : olfactory receptor GA_x5J8B7W3DQU-679632-679375 pseudo : _no_value

name	Olfr1336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258917 MGI:3031170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258918 MGI:3031180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18349 MGI:106685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258383 MGI:3031181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1348 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258915 MGI:3031182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269862 MGI:3031183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr1350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258384 MGI:3031184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76637 MGI:1923887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Zim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22776 MGI:1341879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Peg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gm1078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256089 GeneID:381835 MGI:2685924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : gene model 1078, (NCBI) transcript_id : XM_355840.6

name	Zfp579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832844 GeneID:68490 MGI:1915740
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 579 transcript_id : NM_026741.2

name	Fiz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981387 GeneID:23877 MGI:1344336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Flt3 interacting zinc finger protein 1 transcript_id : NM_011813.2

name	Zfp524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352944 GeneID:66056 MGI:1916740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 524 transcript_id : NM_025324.2

name	6430526N21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353262 GeneID:319748 MGI:2442656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430526N21 gene transcript_id : NM_001033383.2

name	4632433K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379355 GeneID:77043 MGI:1924293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632433K11 gene transcript_id : NM_029849.2

name	Zfp784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299614 GeneID:654801 MGI:3606042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 784 transcript_id : NM_001039532.1

name	Zfp580 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379332 GeneID:68992 MGI:1916242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : zinc finger protein 580, transcript variant 2 transcript_id : XM_900964.2

name	Ccdc106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122720 GeneID:232821 MGI:2385900
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 106 transcript_id : NM_146178.1

name	U2af2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526823 GeneID:22185 MGI:98886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 transcript_id : NM_133671.1

name	Epn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129927 GeneID:13854 MGI:1333763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epsin 1 transcript_id : NM_010147.3

name	Rfpl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801974 GeneID:192658 MGI:2149590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ret finger protein-like 4 transcript_id : NM_138954.2

name	Rasl2-9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145657 GeneID:19428 MGI:104605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 2, locus 9 transcript_id : NM_009028.2

name	V1rd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903053 GeneID:384522 MGI:3033474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : vomeronasal 1 receptor, D5 transcript_id : XM_357688.2

name	V1rd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507703 GeneID:81015 MGI:3033472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D3 transcript_id : NM_030740.1

name	Nlrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821676 GeneID:232827 MGI:3041206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 2 transcript_id : NM_177690.3

name	V1rd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431361 GeneID:81014 MGI:3033473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D4 transcript_id : NM_030739.2

name	V1rd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430545 GeneID:404284 MGI:3033479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D10 transcript_id : NM_207543.1

name	EG630071 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83006585 GeneID:630071 MGI:3645676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG630071 transcript_id : XM_895257.1

name	EG665255 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487152 GeneID:665255 MGI:3645468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG665255 transcript_id : NM_001081405.1

name	EG636697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256098 GeneID:636697 MGI:3645244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG636697 transcript_id : XM_001476622.1

name	V1rd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507705 GeneID:81016 MGI:3033471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D2 transcript_id : NM_030741.1

name	V1rd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507707 GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D1 transcript_id : NM_030742.1

name	V1rd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430540 GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D11 transcript_id : NM_207544.1

name	V1rd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507699 GeneID:81013 MGI:3033475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D6 transcript_id : NM_030738.1

name	EG384525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256134 GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : predicted gene, EG384525 transcript_id : XM_357690.4

name	Nlrp4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878218 GeneID:83564 MGI:1890518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4C transcript_id : NM_031389.1

name	Zfp787 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846114 GeneID:67109 MGI:1914359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 787 transcript_id : NM_001013012.1

name	Zfp444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344196 GeneID:72667 MGI:1923365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 444 transcript_id : NM_028316.2

name	Galp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342456 GeneID:232836 MGI:2663979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin-like peptide precursor transcript_id : NM_178028.2

name	Zfp371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83025106 GeneID:170734 MGI:2159640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 371 transcript_id : NM_133204.2

name	EG627821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379341 GeneID:627821 MGI:3643580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : predicted gene, EG627821 transcript_id : XM_892523.2

name	Zfp667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853589 GeneID:384763 MGI:2442757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 667 transcript_id : NM_001024928.2

name	Zfp583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376695 GeneID:213011 MGI:2682297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 583 transcript_id : NM_001033249.2

name	LOC100042467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256145 GeneID:100042467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042467 transcript_id : XM_001478575.1

name	LOC100042459 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256143 GeneID:100042459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042459 transcript_id : XM_001478563.1

name	Zfp78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448538 GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 78 transcript_id : NM_001025163.1

name	Zfp78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802063 GeneID:330463 MGI:107783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 78 transcript_id : NM_177888.3

name	Zfp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364313 GeneID:22690 MGI:99175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 28 transcript_id : NM_175247.2

name	LOC100042450 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256139 GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042450, transcript variant 1 transcript_id : XM_001478530.1

name	LOC100042450 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256141 GeneID:100042450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042450, transcript variant 2 transcript_id : XM_001478546.1

name	Olfr1344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676556 GeneID:257882 MGI:3031178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1344 transcript_id : NM_177061.3

name	Olfr1336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129060 GeneID:258917 MGI:3031170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1336 transcript_id : NM_146915.1

name	Olfr1346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129062 GeneID:258918 MGI:3031180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1346 transcript_id : NM_146916.1

name	Olfr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165409 GeneID:18349 MGI:106685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 5 transcript_id : NM_146914.1

name	Olfr1347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129530 GeneID:258383 MGI:3031181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1347 transcript_id : NM_146385.1

name	Olfr1348 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129066 GeneID:258915 MGI:3031182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1348 transcript_id : NM_146913.1

name	Olfr1349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828667 GeneID:269862 MGI:3031183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1349 transcript_id : NM_207136.1

name	Olfr1350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239059 GeneID:258384 MGI:3031184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1350 transcript_id : NM_146389.1

name	Zim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379350 GeneID:76637 MGI:1923887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, imprinted 2 transcript_id : XM_489216.4

name	Zim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734480 GeneID:22776 MGI:1341879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, imprinted 1 transcript_id : NM_011769.3

name	Peg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331165 GeneID:18616 MGI:104748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paternally expressed 3 transcript_id : NM_008817.2

name	Usp29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145572 GeneID:57775 MGI:1888998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 29 transcript_id : NM_021323.2

name	Gm1078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256090 GeneID:381835 MGI:2685924
definition	codon_start : 1 product : similar to Putative uncharacterized serine/threonine-protein kinase SgK110 (Sugen kinase 110) protein_id : XP_355840.4

name	Zfp579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955864 GeneID:68490 MGI:1915740
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 579 protein_id : NP_081017.1

name	Fiz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981388 CCDS:CCDS20751.1 GeneID:23877 MGI:1344336
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] [Evidence IPI]; GO:0005102 - receptor binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Flt3 interacting zinc finger protein 1 protein_id : NP_035943.2

name	Zfp524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384694 CCDS:CCDS20752.1 GeneID:66056 MGI:1916740
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 524 protein_id : NP_079600.1

name	6430526N21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677466 CCDS:CCDS20753.1 GeneID:319748 MGI:2442656
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC319748 protein_id : NP_001028555.1

name	4632433K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313332 GeneID:77043 MGI:1924293
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77043 protein_id : NP_084125.1

name	Zfp784 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299615 CCDS:CCDS20755.1 GeneID:654801 MGI:3606042
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA C730049F21 protein_id : NP_001034621.1

name	Zfp580 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903065 GeneID:68992 MGI:1916242
definition	codon_start : 1 product : zinc finger protein 580 isoform 2 protein_id : XP_906057.1

name	Ccdc106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122721 CCDS:CCDS20757.1 GeneID:232821 MGI:2385900
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 106 protein_id : NP_666290.1

name	U2af2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526824 GeneID:22185 MGI:98886
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 65 kDa; splicing factor U2AF product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 protein_id : NP_598432.1

name	Epn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195711 CCDS:CCDS20758.1 GeneID:13854 MGI:1333763
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : epsin 1 protein_id : NP_034277.1

name	Rfpl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20336740 CCDS:CCDS20759.1 GeneID:192658 MGI:2149590
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ret finger protein-like 4 protein_id : NP_620404.1

name	Rasl2-9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677677 CCDS:CCDS20760.1 GeneID:19428 MGI:104605
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAS-like, family 2, locus 9 protein_id : NP_033054.1

name	V1rd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903054 GeneID:384522 MGI:3033474
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD10 protein_id : XP_357688.2

name	V1rd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507704 CCDS:CCDS20761.1 GeneID:81015 MGI:3033472
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R3 product : vomeronasal 1 receptor, D3 protein_id : NP_109665.1

name	Nlrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821677 GeneID:232827 MGI:3041206
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : NACHT, leucine rich repeat and PYD containing 2 protein_id : NP_808358.2

name	V1rd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431362 GeneID:81014 MGI:3033473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R4 product : vomeronasal 1 receptor, D4 protein_id : NP_109664.2

name	V1rd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430546 CCDS:CCDS20763.1 GeneID:404284 MGI:3033479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D10 protein_id : NP_997426.1

name	EG630071 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83006586 GeneID:630071 MGI:3645676
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 protein_id : XP_900350.1

name	EG665255 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487153 GeneID:665255 MGI:3645468
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 product : predicted gene, EG665255 protein_id : NP_001074874.1

name	EG636697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256099 GeneID:636697 MGI:3645244
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD8 protein_id : XP_001476672.1

name	V1rd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507706 GeneID:81016 MGI:3033471
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : pheromone receptor V3R2 product : vomeronasal 1 receptor, D2 protein_id : NP_109666.1

name	V1rd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507708 CCDS:CCDS20765.1 GeneID:81017 MGI:3033470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R1 product : vomeronasal 1 receptor, D1 protein_id : NP_109667.1

name	V1rd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430541 CCDS:CCDS20766.1 GeneID:404285 MGI:3033480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D11 protein_id : NP_997427.1

name	V1rd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507700 CCDS:CCDS20767.1 GeneID:81013 MGI:3033475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R6 product : vomeronasal 1 receptor, D6 protein_id : NP_109663.1

name	EG384525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085727 GeneID:384525 MGI:3645266
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_357690.1

name	Nlrp4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878219 GeneID:83564 MGI:1890518
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ribonuclease/angiogenin inhibitor 2; NACHT, leucine rich repeat and PYD containing 4C product : VNACHT, leucine rich repeat and PYD containing 4C protein_id : NP_113566.1

name	Zfp787 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846115 CCDS:CCDS20769.1 GeneID:67109 MGI:1914359
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 787 protein_id : NP_001013030.1

name	Zfp444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037297 CCDS:CCDS20770.1 GeneID:72667 MGI:1923365
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 444 protein_id : NP_082592.1

name	Galp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794256 CCDS:CCDS20771.1 GeneID:232836 MGI:2663979
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : galanin-like peptide precursor protein_id : NP_821171.1

name	Zfp371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83025107 CCDS:CCDS20772.1 GeneID:170734 MGI:2159640
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger gonad protein 1 product : zinc finger protein 371 protein_id : NP_573467.2

name	EG627821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903229 GeneID:627821 MGI:3643580
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897616.1

name	Zfp667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972433 CCDS:CCDS20773.1 GeneID:384763 MGI:2442757
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 667 protein_id : NP_001020099.1

name	Zfp583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701750 GeneID:213011 MGI:2682297
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 583 protein_id : NP_001028421.1

name	LOC100042467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256146 GeneID:100042467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478625.1

name	LOC100042459 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256144 GeneID:100042459
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478613.1

name	Zfp78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448539 CCDS:CCDS20774.1 GeneID:330463 MGI:107783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 78 isoform 1 protein_id : NP_001020334.1

name	Zfp78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244508 CCDS:CCDS20775.1 GeneID:330463 MGI:107783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 78 isoform 2 protein_id : NP_808556.1

name	Zfp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504577 GeneID:22690 MGI:99175
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 28 protein_id : NP_780456.1

name	LOC100042450 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256140 GeneID:100042450
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001478580.1

name	LOC100042450 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256142 GeneID:100042450
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001478596.1

name	Olfr1344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676557 CCDS:CCDS20776.1 GeneID:257882 MGI:3031178
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3169916-3170881; olfactory receptor MOR124-1 product : olfactory receptor 1344 protein_id : NP_796035.2

name	Olfr1336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129061 CCDS:CCDS20777.1 GeneID:258917 MGI:3031170
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3190370-3191314; olfactory receptor MOR103-7 product : olfactory receptor 1336 protein_id : NP_667126.1

name	Olfr1346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129063 CCDS:CCDS20778.1 GeneID:258918 MGI:3031180
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3203957-3204898; olfactory receptor MOR103-6 product : olfactory receptor 1346 protein_id : NP_667127.1

name	Olfr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165410 GeneID:18349 MGI:106685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3210997-3210059 product : olfactory receptor 5 protein_id : NP_667125.1

name	Olfr1347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129531 CCDS:CCDS20779.1 GeneID:258383 MGI:3031181
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3218686-3217748; MOR103-19_i; olfactory receptor MOR103-11 product : olfactory receptor 1347 protein_id : NP_666497.1

name	Olfr1348 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129067 GeneID:258915 MGI:3031182
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3232059-3231121; olfactory receptor MOR103-9 product : olfactory receptor 1348 protein_id : NP_667124.1

name	Olfr1349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828668 CCDS:CCDS20780.1 GeneID:269862 MGI:3031183
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3245761-3244808; olfactory receptor MOR232-8 product : olfactory receptor 1349 protein_id : NP_997019.1

name	Olfr1350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239060 CCDS:CCDS20781.1 GeneID:258384 MGI:3031184
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QGBW-3300391-3301317; olfactory receptor MOR222-3 product : olfactory receptor 1350 protein_id : NP_666501.1

name	Zim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903235 GeneID:76637 MGI:1923887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489216.2

name	Zim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734481 CCDS:CCDS20782.1 GeneID:22776 MGI:1341879
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, imprinted 1 protein_id : NP_035899.3

name	Peg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331166 CCDS:CCDS20783.1 GeneID:18616 MGI:104748
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : granule cell antiserum positive 4; paternally expressed gene 3 product : paternally expressed 3 protein_id : NP_032843.2

name	Usp29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145573 CCDS:CCDS20784.1 GeneID:57775 MGI:1888998
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ossification center-associated transcript product : ubiquitin specific protease 29 protein_id : NP_067298.2

name	EG665163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665163
definition	number : 1 pseudo : _no_value

name	EG636705 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636705
definition	number : 1 pseudo : _no_value

name	LOC673215 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673215
definition	number : 1 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 2 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 1 pseudo : _no_value

name	LOC100041637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041637
definition	number : 1 pseudo : _no_value

name	LOC100041647 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041647
definition	number : 1 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 2 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 1 pseudo : _no_value

name	EG269859 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269859
definition	number : 1 pseudo : _no_value

name	LOC665328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665328
definition	number : 1 pseudo : _no_value

name	LOC627961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627961
definition	number : 1 pseudo : _no_value

name	EG665126 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256094 GeneID:665126 MGI:3643242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1239 ESTs, 28 Proteins product : predicted gene, EG665126 pseudo : _no_value transcript_id : XR_001694.2

name	EG665150 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256095 GeneID:665150 MGI:3646165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : predicted gene, EG665150 pseudo : _no_value transcript_id : XR_032817.1

name	EG272350 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256073 GeneID:272350 MGI:3643170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG272350 pseudo : _no_value transcript_id : XR_035152.1

name	LOC636731 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256100 GeneID:636731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 29 Proteins product : similar to vomeronasal receptor V1RD8 pseudo : _no_value transcript_id : XR_032865.1

clone name	MSMg01-465H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455A06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-208C18.b	B6Ng01-208C18.g
ACC	GA027120	GA027121
length	1,211	1,075
definition	B6Ng01-208C18.b	B6Ng01-208C18.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcagaaaatcaaataaccccattaaaaaatggggctcagaactgaa caaagaattctcacctgagtcataccgaatggcagagaagcacctgaaaa aatgctcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctg agattccacctcacaccagtcagaatgtctaagatcaaaaattcaggtga cagcagatgctggcgaggatgtggagaaagaggaacactcctccattgtt ggtgggattgcaggcttgtacaaccactctggaaatctgtctggcggttc ctcagaaaattggacatagtactaccggaggatccagcaatacctctcct gggcatatatccagaagatgccccaactggtaagaaggacacatgctcca ctatgttcatagcagccttatttataatagccagaagccggaaagaaccc agatgcccctcaacagaggaatggatacagaaaatgtggtacatctacac aatggagtactactcagctattaaaaagaatgaatttatgaaattcctag ccaaatggatggacctggagggcatcatcctgagtgaggtaacacattca caaaggaactcacacaatatgtactcactgataagtggatattagcccaa aacctaggatacccaagatataagatacaatttcctaaacacatgaaact caagaaaaatgaagactgaagtgtggacactatgcccctccttagaagtg ggaacaaaacacccttggaaggagttacagagacaaagtttggagctgag atgaaaggatggaccatgtagagactgccttatccagggatccaccccat aatcagcatccaaacgatgacaccattgcatacactagcaagattttatc gaaagggacccagatgtagctgtctcttgtgagactatgccggggcctag caaacatagaagtggatgttcacagtcagctaatggatgggatcacaggc ttcccaatgggaggagctagagaaagtacctaagagctaaagggatctgc acctatagtgatcaacattatgactaccagtacccgagctctggactcta gcgcattatgtatcaagatggcctagttcggcaatcctgaagaatgctca atggaacatccaactttattgatccctagaatcagggtaatgtccctaga gatgtcctgat	gaattcagaaatacaaattcagtgttggagatatggttcaagatctagtg acctctgctctcctttttaccactgcattcatgtatttcccaccatacat gtgagaaaaacagtcataggaatacaataattaagtataactttcaaaaa tagaatgcagggctggagagatggctcagtggttaagagcatttggctat tctatcagaggatctgggttcagttccaaaatctgaaatggcagctcaca acagtctgtgactccaattctaggctatctgacaccttcacagtcataca tgtaggcaaaacaaatgtgtgtgtgtgtttccttaaaatataaagaaatt caaaatttataaatcataatagaatatgactgtgtgatggtttgtatatt cttgaatcagggagtgggaccatctgaaggtgtggccttgttggaatagg tgtgacctggttgaaatgggtgtgtcactgtgggtgtgggtataagatcc tcaccctagttgactggaagtcagtcttccactagcagactttggatgaa gatatagaactctcagctcctcctgtgtcatggatactgccatgctctca ccttgatgataatggactgaacctctgaacctgtaagccagccccaaata aatgttgttttttataagacttgccttggtcatggtgtctgttcacagca gtaaaaccctaactaagacagactgaaatatgtttccccaaataatctat cttctgttgttataattttacactcctcatcatagtgatataatgcaata tatataatgcaatataatgatgatatttcaaaaatgtcaccagtgttata ttcacccattacggaccttgatttacacatatatcatctatgtggaaaaa agtctaagtgacccaaccactcttttgatttataagttttttgactttta tcttggtttctagggattgagtgcatggacacataccagaatgcatcatc agcttcatcacccacaatcaattaacatcatcacttgttgaagtctttgc acacgaaaataattgaatgtcagtg
quality values	Open. Hide. 58 31 21 25 43 33 10 9 22 14 14 20 24 27 26 26 33 34 26 22 26 26 26 30 25 51 43 45 41 41 45 45 23 20 39 23 27 30 13 30 16 16 13 46 27 28 39 40 43 30 34 30 30 40 19 40 26 28 34 27 43 39 30 41 43 43 51 49 30 49 41 39 43 41 41 37 37 43 34 30 50 34 23 23 13 38 17 29 34 19 30 24 39 43 43 44 38 40 49 43 43 35 43 59 34 34 39 31 30 34 39 49 46 43 38 27 30 31 30 34 34 50 35 43 24 59 43 49 49 49 43 51 30 34 24 34 46 43 34 31 43 41 49 41 41 49 43 43 43 44 46 30 49 41 40 40 34 18 34 31 23 56 34 34 31 41 34 24 27 27 34 24 18 50 34 43 51 39 35 35 40 41 39 59 50 34 30 24 23 23 24 30 41 34 21 21 49 34 39 39 30 24 19 41 30 26 49 43 51 43 49 51 43 24 19 49 34 36 43 49 51 38 48 36 46 39 50 49 43 34 50 30 43 50 43 43 40 43 39 43 41 41 34 34 23 34 37 49 62 46 56 51 40 56 51 51 59 46 46 50 41 34 30 59 40 30 30 36 18 18 30 34 34 30 34 23 40 34 41 39 46 40 43 34 49 49 43 43 49 41 41 43 51 51 30 34 30 18 27 25 27 30 49 30 18 50 34 34 39 34 43 51 43 49 40 34 40 34 35 34 43 34 23 30 30 24 24 24 51 24 43 38 39 34 34 23 23 30 23 31 39 34 41 41 40 40 43 34 34 30 51 39 50 27 30 41 34 41 43 43 43 49 30 30 51 39 30 49 49 56 46 49 49 49 34 34 43 38 45 34 22 32 34 24 46 45 39 56 51 34 30 34 24 43 51 34 34 41 34 34 34 41 30 34 45 34 38 39 41 51 45 30 43 34 30 51 51 51 45 43 41 30 30 24 31 24 32 35 42 25 35 51 38 26 51 35 26 35 35 35 51 50 38 42 35 56 51 62 42 42 35 22 44 38 50 38 38 38 39 42 42 26 26 42 32 20 51 26 31 38 31 31 51 30 42 34 31 42 34 32 56 42 42 56 38 36 27 33 22 20 23 33 28 42 39 31 23 42 24 33 30 27 39 50 39 43 30 33 42 42 28 27 27 28 32 27 19 28 38 34 30 30 23 19 17 17 41 27 52 45 43 50 52 42 50 46 38 35 32 27 42 35 30 35 41 39 32 32 39 26 32 38 32 46 35 42 40 34 34 29 42 46 35 29 27 28 33 21 43 35 52 41 26 34 42 42 39 42 35 35 33 40 46 35 24 52 47 34 41 32 25 25 42 27 33 24 35 46 40 32 42 32 34 39 32 50 52 38 41 52 39 23 32 32 32 28 40 34 42 41 46 40 37 46 39 39 24 31 35 46 41 52 38 37 32 35 50 46 41 37 33 32 28 29 15 15 21 20 19 16 19 35 27 37 32 46 13 35 37 32 37 32 27 24 20 17 29 47 31 25 22 20 24 19 52 41 39 40 31 30 40 50 39 30 40 39 37 33 28 40 35 53 42 50 50 50 31 38 37 39 37 32 21 24 40 27 28 30 34 41 52 54 50 52 35 20 40 51 41 37 33 39 53 40 16 11 37 33 32 39 39 37 40 40 36 33 35 41 38 32 34 42 36 31 34 40 42 26 41 33 31 53 52 29 32 23 40 40 27 29 28 21 32 35 32 15 21 29 47 39 19 44 38 26 42 37 29 45 26 29 51 31 45 35 13 33 51 36 32 45 37 38 32 38 24 45 53 32 39 17 20 26 45 37 45 40 32 53 26 26 34 52 33 20 25 26 28 28 33 30 24 30 31 26 31 31 31 26 29 18 31 41 19 14 31 25 13 25 18 8 14 31 31 28 30 32 28 26 24 42 26 42 32 38 31 31 31 36 34 32 31 30 32 25 31 31 37 32 32 30 18 21 30 31 18 31 24 30 31 23 27 18 32 16 26 25 25 14 28 37 15 11 24 19 46 43 32 24 21 20 31 41 41 31 13 38 7 27 20 31 28 15 23 41 31 31 31 31 14 20 33 30 16 27 27 26 16 18 25 18 33 31 11 31 18 33 32 37 21 21 15 18 32 38 21 15 13 26 31 28 31 26 41 21 20 24 38 32 21 28 33 24 20 14 9 19 12 20 10 34 32 26 28 12 10 27 25 11 26 34 31 29 32 12 18 17 5 13 17 48 14 31 24 22 14 12 4 4 6 11 21 17 26 39 13 10 17 13 28 29 12 14 12 20 23 9 22 24 16 22 28 7 8 27 11 9 21 23 27 18 5 21 8 27 3 5 19 28 9 29 17 10 47 21 10 9 14 24 28 10 8 5 5 3 7 14 11 14 5 11 18 23 9 25 9 14 7 24 12 9 10 11 24 6 13 11 9 14 10 13 11 8 24 11 5 5 9 4 6 6 6 5 5 10 18 6 16 13 7 8 3 3 5 12 13 9 6 4 12 7 4 8 12 8 16 7 7 9 8 6 11 5 8 13 17 5 5 12 6 10 9 17 4 5 12 8 7 5 2 5 2 6 9 6 5 3 1 3 5 5 4 9 4 3 1 5 6 5 4 2 3 3 16 10 17 28 5 20 6 13 5 1 5 25 25 11 1 4 9 4 2 1 3 1 2 20 19 4 5 11 1 1 1 12 30 4 4 4 6 4 7 7 4 10 8 22 8 4 1 3 3	Open. Hide. 62 59 59 44 51 43 20 12 51 41 24 13 13 24 10 10 13 24 34 25 20 27 23 51 34 34 43 39 46 31 49 39 51 59 40 43 26 30 27 23 27 43 49 49 34 32 30 23 34 51 39 39 41 40 43 39 40 36 46 49 30 34 24 34 25 25 28 28 30 39 34 30 39 39 49 27 24 41 43 39 24 43 49 36 18 34 34 34 30 34 34 30 34 41 30 34 34 43 26 40 51 34 39 34 19 36 30 31 34 43 34 27 36 25 39 34 43 34 24 41 51 41 41 34 41 31 34 30 31 24 34 34 31 41 24 39 34 43 34 41 49 50 34 34 34 31 31 34 43 43 40 41 24 49 34 34 51 41 34 23 51 43 30 43 43 51 38 39 43 30 43 43 49 40 43 49 43 34 18 27 51 34 31 41 30 49 24 51 34 40 24 34 43 41 49 39 30 43 39 46 46 40 34 30 34 30 24 19 56 34 49 49 39 34 40 49 43 41 24 24 30 14 16 18 30 24 24 30 36 46 49 49 49 24 30 34 25 25 23 51 34 24 30 24 40 39 41 30 34 30 24 24 17 17 13 24 24 34 18 30 27 46 34 35 51 18 43 34 41 41 24 24 19 34 18 30 39 40 43 43 43 51 34 30 43 34 30 30 30 19 41 26 30 24 34 24 40 34 41 24 41 43 30 41 26 43 30 30 40 43 43 50 23 30 24 30 43 24 39 30 43 30 49 30 43 30 43 34 30 30 34 34 30 30 30 34 34 41 34 39 43 22 24 19 13 28 23 30 30 34 45 41 23 36 30 34 34 30 24 43 34 34 30 34 34 34 34 34 30 34 36 18 32 39 43 43 39 43 44 43 45 56 34 43 34 30 34 24 34 24 19 30 22 35 19 32 29 25 26 22 24 22 25 26 37 29 35 42 26 16 51 31 24 22 26 42 32 35 39 24 25 14 27 23 21 32 50 38 31 43 31 51 31 39 31 24 42 18 16 27 10 18 20 24 27 31 34 30 20 39 29 46 33 39 42 33 38 31 39 16 34 39 31 39 33 27 23 38 27 30 19 33 15 30 15 15 27 22 35 42 31 34 23 22 29 42 23 28 24 18 21 21 28 19 27 14 33 31 24 22 23 22 28 24 23 22 27 21 23 19 21 32 38 27 35 42 28 31 27 20 26 27 35 31 33 39 30 27 27 39 20 16 14 9 7 14 27 19 39 27 40 29 27 33 34 40 39 27 35 27 13 39 30 31 34 32 13 24 25 24 34 27 31 39 18 13 35 39 32 33 31 32 25 27 40 28 31 21 23 30 30 37 24 33 33 27 34 30 39 19 29 28 32 38 39 42 46 26 52 37 21 33 27 26 35 35 46 58 49 52 50 58 48 58 44 51 33 44 41 41 41 37 58 58 54 54 48 58 51 50 58 54 58 44 42 50 50 50 28 29 25 27 24 21 26 28 26 37 32 58 51 36 39 47 32 31 37 23 28 31 32 21 19 26 25 22 27 32 53 28 43 24 44 41 50 27 16 25 19 21 37 26 24 32 24 23 35 29 37 42 32 25 21 21 16 34 24 28 34 51 6 32 21 23 29 31 29 27 21 18 32 16 27 42 25 39 28 51 23 37 23 40 23 25 31 26 31 37 32 30 22 30 17 21 37 35 32 22 25 17 13 37 31 32 40 32 38 29 22 37 52 23 32 34 25 34 27 31 34 16 9 32 23 30 31 26 24 16 23 27 26 32 35 45 40 29 21 34 24 28 31 31 36 20 17 12 23 25 29 30 24 16 25 16 29 29 23 23 25 29 26 25 34 34 34 17 31 30 43 15 24 24 23 19 24 23 30 31 31 26 29 32 37 31 18 12 31 22 30 11 9 26 28 25 33 42 30 28 26 29 25 25 26 9 28 25 25 7 34 22 31 18 21 11 46 18 15 9 10 6 23 6 8 16 26 18 17 21 15 11 6 10 21 12 17 24 15 20 11 24 13 11 10 11 22 31 30 31 14 20 24 29 26 20 14 13 21 16 12 5 8 31 20 27 28 22 15 19 22 18 33 25 32 30 27 18 14 20 9 23 15 19 18 33 28 20 19 32 28 37 24 13 21 8 14 24 32 17 17 25 17 10 11 22 11 34 36 36 21 17 14 20 15 9 18 6 6 16 14 17 13 6 9 6 6 4 5 8 14 7 4 4 10 17 10 21 11 20 8 5 9 5 11 12 7 7 6 7 6 6 28 16 18 16 20 24 12 5 6 18 6 9 5 16 11 5 7 4 7 10 6 17 9 12 9 7 17 10 16 7 15 10 7 14 9 13 9 19 20 27 12 7 10 7 7 6 8 4 30 11 20 13 6 3 5 17 17 4 4 6 8 4 7 7 4 8 14 12 6 4 17 8 12 5 4 7 17 6 7 11 10 18 4 3 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_5919162_5920231
seq2: B6Ng01-208C18.g_63_1137

seq1  GAATTCAGAAATACAAATTCAGTGTTGGAGATATGGTTCAAGATCTAGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGAAATACAAATTCAGTGTTGGAGATATGGTTCAAGATCTAGTG  50

seq1  ACCTCTGCTCTCCTTTTTACCACTGCATTCATGTATTTCCCACCATACAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCTGCTCTCCTTTTTACCACTGCATTCATGTATTTCCCACCATACAT  100

seq1  GTGAGAAAAACAGTCATAGGAATACAATAATTAAGTATAACTTTCAAAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGAAAAACAGTCATAGGAATACAATAATTAAGTATAACTTTCAAAAA  150

seq1  TAGAATGCAGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCATTTGGCTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATGCAGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCATTTGGCTAT  200

seq1  TCTATCAGAGGATCTGGGTTCAGTTCCAAAATCTGAAATGGCAGCTCACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCAGAGGATCTGGGTTCAGTTCCAAAATCTGAAATGGCAGCTCACA  250

seq1  ACAGTCTGTGACTCCAATTCTAGGCTATCTGACACCTTCACAGTCATACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTCTGTGACTCCAATTCTAGGCTATCTGACACCTTCACAGTCATACA  300

seq1  TGTAGGCAAAACAAATGTGTGTGTGTGTTTCCTTAAAATATAAAGAAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGGCAAAACAAATGTGTGTGTGTGTTTCCTTAAAATATAAAGAAATT  350

seq1  CAAAATTTATAAATCATAATAGAATATGACTGTGTGATGGTTTGTATATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAATTTATAAATCATAATAGAATATGACTGTGTGATGGTTTGTATATT  400

seq1  CTTGAATCAGGGAGTGGGACCATCTGAAGGTGTGGCCTTGTTGGAATAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAATCAGGGAGTGGGACCATCTGAAGGTGTGGCCTTGTTGGAATAGG  450

seq1  TGTGACCTGGTTGAAATGGGTGTGTCACTGTGGGTGTGGGTATAAGATCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACCTGGTTGAAATGGGTGTGTCACTGTGGGTGTGGGTATAAGATCC  500

seq1  TCACCCTAGTTGACTGGAAGTCAGTCTTCCACTAGCAGACTTTGGATGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCCTAGTTGACTGGAAGTCAGTCTTCCACTAGCAGACTTTGGATGAA  550

seq1  GATATAGAACTCTCAGCTCCTCCTGTGTCATGGATACTGCCATGCTCTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATAGAACTCTCAGCTCCTCCTGTGTCATGGATACTGCCATGCTCTCA  600

seq1  CCTTGATGATAATGGACTGAACCTCTGAACCTGTAAGCCAGCCCCAAATA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGATGATAATGGACTGAACCTCTGAACCTGTAAGCCAGCCCCAAATA  650

seq1  AATGTTGTTTTTTATAAGACTTGCCTTGGTCATGGTGTCTGTTCACAGCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTTGTTTTTTATAAGACTTGCCTTGGTCATGGTGTCTGTTCACAGCA  700

seq1  GTAAAACCCTAACTAAGACAGACTGAAATATGTTTCCCCAAATAATCTAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAACCCTAACTAAGACAGACTGAAATATGTTTCCCCAAATAATCTAT  750

seq1  CTTCTGTTGTTATAATTTTACACTCCTCATCATAGTGATATAATGCAATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGTTGTTATAATTTTACACTCCTCATCATAGTGATATAATGCAATA  800

seq1  TATATAATGCAATATAATGATGATATTTCAAAAATGTCACCAGTGTTATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATAATGCAATATAATGATGATATTTCAAAAATGTCACCAGTGTTATA  850

seq1  TTCACCCA-GAAGGACCTTGATTTACACATATATCATCTATGTGGAAAAA  899
      ||||||||  | ||||||||||||||||||||||||||||||||||||||
seq2  TTCACCCATTACGGACCTTGATTTACACATATATCATCTATGTGGAAAAA  900

seq1  AGTCTAAGTGACCCAACCACTCTTTTGATTTATAAG-TTTTTGAATTTTA  948
      |||||||||||||||||||||||||||||||||||| ||||||| |||||
seq2  AGTCTAAGTGACCCAACCACTCTTTTGATTTATAAGTTTTTTGACTTTTA  950

seq1  TCTGGTTTTCTAAGGAATTGAGTGC-TGGACACATACCTG-ATGCATCTC  996
      ||| | ||||| ||| ||||||||| |||||||||||| | |||||||  
seq2  TCTTGGTTTCT-AGGGATTGAGTGCATGGACACATACCAGAATGCATCAT  999

seq1  CAGCTTTAATCACCCACAATCAA-TAACATCATCAC-TGTTAAAGTCTTT  1044
      |||| || ||||||||||||||| |||||||||||| |||| ||||||||
seq2  CAGC-TTCATCACCCACAATCAATTAACATCATCACTTGTTGAAGTCTTT  1048

seq1  GCACAC-AAAATATTTGAAAGTCAGTG  1070
      |||||| |||||| ||||| |||||||
seq2  GCACACGAAAATAATTGAATGTCAGTG  1075

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information