MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-208H17
Chromosome	7 (Build37)
Map Location	87,354,232 - 87,485,750
singlet/doublet	doublet
Overlap gene	Sema4b, Cib1, D330012F22Rik, LOC100042374, LOC100042379, Ttll13, Ngrn, Vps33b, Prc1, Rccd1, Unc45a
Upstream gene	Abhd2, Rlbp1, BC025462, Polg, AI854517, Rhcg, 5730590G19Rik, Plin, Pex11a, EG626359, EG665900, Mesp1, Mesp2, Anpep, Ap3s2, 2610034B18Rik, Zfp710, Idh2
Downstream gene	Hddc3, Man2a2, Fes, Furin, LOC384647, Blm, Crtc3, Iqgap1, LOC100042402, Zscan2, Wdr73, Nmb, Sec11a, Zfp592, Alpk3, Slc28a1, EG623286, LOC100043130, Pde8a, EG636544
Link	Open Mouse BAC browser

Click to get alignment info.

name	Abhd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54608 MGI:1914344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rlbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19771 MGI:97930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208836 MGI:2384790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18975 MGI:1196389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI854517 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101694 MGI:2142071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs

name	Rhcg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56315 MGI:1888517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730590G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77011 MGI:1924261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103968 MGI:1890505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18631 MGI:1338788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626359 MGI:3646885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665900 MGI:3644089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 300 ESTs, 6 Proteins pseudo : _no_value

name	Mesp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17292 MGI:107785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mesp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17293 MGI:1096325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anpep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16790 MGI:96749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap3s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11778 MGI:1337060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610034B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70420 MGI:1917670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209225 MGI:1921747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269951 MGI:96414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20352 MGI:107559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cib1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23991 MGI:1344418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D330012F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269952 MGI:2443429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	LOC100042379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ttll13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269954 MGI:1920845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83485 MGI:1933212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps33b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233405 MGI:2446237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233406 MGI:1858961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rccd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269955 MGI:2444156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc45a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101869 MGI:2142246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hddc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68695 MGI:1915945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140481 MGI:2150656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fes (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14159 MGI:95514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Furin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18550 MGI:97513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384647 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Blm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12144 MGI:1328362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crtc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70461 MGI:1917711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29875 MGI:1352757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Zscan2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22691 MGI:99176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71968 MGI:1919218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 133 ESTs, 4 Proteins

name	Nmb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68039 MGI:1915289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56529 MGI:1929464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233410 MGI:2443541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alpk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116904 MGI:2151224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc28a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434203 MGI:3605073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623286 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623286 MGI:3648526
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 109 ESTs, 3 Proteins

name	LOC100043130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	Pde8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18584 MGI:1277116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG636544 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636544 MGI:3648560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 122 ESTs, 14 Proteins

name	Abhd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802583 GeneID:54608 MGI:1914344
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 2 transcript_id : NM_018811.5

name	Rlbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181109 GeneID:19771 MGI:97930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinaldehyde binding protein 1 transcript_id : NM_020599.1

name	BC025462 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722699 GeneID:208836 MGI:2384790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025462 transcript_id : NM_145946.2

name	Polg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87080814 GeneID:18975 MGI:1196389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), gamma transcript_id : NM_017462.2

name	AI854517 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380588 GeneID:101694 MGI:2142071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs product : expressed sequence AI854517 transcript_id : XM_979851.1

name	Rhcg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803521 GeneID:56315 MGI:1888517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rhesus blood group-associated C glycoprotein transcript_id : NM_019799.2

name	5730590G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78354982 GeneID:77011 MGI:1924261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730590G19 gene transcript_id : NM_029835.1

name	Plin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28316725 GeneID:103968 MGI:1890505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : perilipin transcript_id : NM_175640.1

name	Pex11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755033 GeneID:18631 MGI:1338788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 11a transcript_id : NM_011068.1

name	EG626359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776568 GeneID:626359 MGI:3646885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG626359 transcript_id : NM_001037927.1

name	Mesp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469090 GeneID:17292 MGI:107785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesoderm posterior 1 transcript_id : NM_008588.1

name	Mesp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955347 GeneID:17293 MGI:1096325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesoderm posterior 2 transcript_id : NM_008589.2

name	Anpep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678663 GeneID:16790 MGI:96749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanyl (membrane) aminopeptidase transcript_id : NM_008486.1

name	Ap3s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538813 GeneID:11778 MGI:1337060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 3, sigma 2 subunit transcript_id : NM_009682.2

name	2610034B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382975 GeneID:70420 MGI:1917670
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610034B18 gene transcript_id : NM_027420.3

name	Zfp710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734491 GeneID:209225 MGI:1921747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 710 transcript_id : NM_175433.4

name	Idh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370515 GeneID:269951 MGI:96414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isocitrate dehydrogenase 2 (NADP+), mitochondrial transcript_id : NM_173011.1

name	Sema4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377065 GeneID:20352 MGI:107559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B transcript_id : NM_013659.3

name	Cib1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376820 GeneID:23991 MGI:1344418
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium and integrin binding 1 (calmyrin) transcript_id : NM_011870.3

name	D330012F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702128 GeneID:269952 MGI:2443429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330012F22 gene transcript_id : NM_178752.3

name	LOC100042379 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257497 GeneID:100042379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042379 transcript_id : XM_001478078.1

name	Ttll13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392071 GeneID:269954 MGI:1920845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 13 transcript_id : NM_177765.3

name	Ngrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373623 GeneID:83485 MGI:1933212
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neugrin, neurite outgrowth associated transcript_id : NM_031375.3

name	Vps33b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368211 GeneID:233405 MGI:2446237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 33B (yeast) transcript_id : NM_178070.3

name	Prc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553110 GeneID:233406 MGI:1858961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein regulator of cytokinesis 1 transcript_id : NM_145150.1

name	Rccd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802869 GeneID:269955 MGI:2444156
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RCC1 domain containing 1 transcript_id : NM_173445.2

name	Unc45a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527171 GeneID:101869 MGI:2142246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-45 homolog A (C. elegans) transcript_id : NM_133952.1

name	Hddc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803068 GeneID:68695 MGI:1915945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HD domain containing 3 transcript_id : NM_026812.2

name	Man2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388437 GeneID:140481 MGI:2150656
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha 2 transcript_id : NM_172903.2

name	Fes (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185913 GeneID:14159 MGI:95514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : feline sarcoma oncogene transcript_id : NM_010194.2

name	Furin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347021 GeneID:18550 MGI:97513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : furin (paired basic amino acid cleaving enzyme) transcript_id : NM_001081454.1

name	Furin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347019 GeneID:18550 MGI:97513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : furin (paired basic amino acid cleaving enzyme) transcript_id : NM_011046.2

name	Blm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225359 GeneID:12144 MGI:1328362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bloom syndrome homolog (human) transcript_id : NM_001042527.1

name	Blm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225361 GeneID:12144 MGI:1328362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bloom syndrome homolog (human) transcript_id : NM_007550.3

name	Crtc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140971159 GeneID:70461 MGI:1917711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB regulated transcription coactivator 3 transcript_id : NM_173863.2

name	Iqgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710041 GeneID:29875 MGI:1352757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing GTPase activating protein 1 transcript_id : NM_016721.1

name	Zscan2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982821 GeneID:22691 MGI:99176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 2 transcript_id : NM_009553.2

name	Wdr73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257523 GeneID:71968 MGI:1919218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 133 ESTs, 4 Proteins product : WD repeat domain 73 transcript_id : XM_001479496.1

name	Nmb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366023 GeneID:68039 MGI:1915289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuromedin B transcript_id : NM_026523.2

name	Sec11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910549 GeneID:56529 MGI:1929464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC11 homolog A (S. cerevisiae) transcript_id : NM_019951.1

name	Zfp592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802739 GeneID:233410 MGI:2443541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 592 transcript_id : NM_178707.3

name	Alpk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938323 GeneID:116904 MGI:2151224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-kinase 3 transcript_id : NM_054085.2

name	Slc28a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372035 GeneID:434203 MGI:3605073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 transcript_id : NM_001004184.2

name	EG623286 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257525 GeneID:623286 MGI:3648526
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 109 ESTs, 3 Proteins product : predicted gene, EG623286 transcript_id : XM_889816.3

name	LOC100043130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257526 GeneID:100043130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : hypothetical protein LOC100043130 transcript_id : XM_001479535.1

name	Pde8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679248 GeneID:18584 MGI:1277116
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 8A transcript_id : NM_008803.1

name	EG636544 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380583 GeneID:636544 MGI:3648560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 121 ESTs, 14 Proteins product : predicted gene, EG636544 transcript_id : XM_982642.1

name	Abhd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254377 CCDS:CCDS21380.1 GeneID:54608 MGI:1914344
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0030336 - negative regulation of cell migration [Evidence IMP]; GO:0009611 - response to wounding [Evidence IMP] codon_start : 1 note : lung alpha/beta hydrolase 2 product : alpha/beta hydrolase fold protein protein_id : NP_061281.3

name	Rlbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181110 GeneID:19771 MGI:97930
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005502 - 11-cis retinal binding [Evidence IDA]; GO:0019841 - retinol binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : retinaldehyde-binding protein 1 product : retinaldehyde binding protein 1 protein_id : NP_065624.1

name	BC025462 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722700 GeneID:208836 MGI:2384790
definition	codon_start : 1 product : hypothetical protein LOC208836 protein_id : NP_666058.2

name	Polg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87080815 CCDS:CCDS21382.1 GeneID:18975 MGI:1196389
definition	GO_component : GO:0005760 - gamma DNA polymerase complex [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence ISS]; GO:0004527 - exonuclease activity [Evidence IDA]; GO:0003895 - gamma DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007568 - aging [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006264 - mitochondrial DNA replication [Evidence IMP] codon_start : 1 note : mitochondrial polymerase gamma; polymerase, gamma; Pol gamma; mitochondrial DNA polymerase gamma; mitochondrial DNA polymerase-gamma product : polymerase (DNA directed), gamma protein_id : NP_059490.2

name	AI854517 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380589 GeneID:101694 MGI:2142071
definition	codon_start : 1 product : hypothetical protein LOC101694 protein_id : XP_984945.1

name	Rhcg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790197 CCDS:CCDS21383.1 GeneID:56315 MGI:1888517
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0008519 - ammonium transporter activity [Evidence ISS]; GO:0030506 - ankyrin binding [Evidence ISS] GO_process : GO:0015696 - ammonium transport [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Rh type C glycoprotein protein_id : NP_062773.1

name	5730590G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78354983 CCDS:CCDS21384.1 GeneID:77011 MGI:1924261
definition	codon_start : 1 note : leucine-rich repeat kinase 1 product : hypothetical protein LOC77011 protein_id : NP_084111.1

name	Plin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316726 CCDS:CCDS21385.1 GeneID:103968 MGI:1890505
definition	GO_component : GO:0005811 - lipid particle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0016042 - lipid catabolism [Evidence IMP] codon_start : 1 exception : mismatches in translation product : perilipin protein_id : NP_783571.1

name	Pex11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755034 CCDS:CCDS21386.1 GeneID:18631 MGI:1338788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005778 - peroxisomal membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0016559 - peroxisome fission [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 function : involved in regulation of peroxisome abundance product : peroxisomal biogenesis factor 11a protein_id : NP_035198.1

name	EG626359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776569 GeneID:626359 MGI:3646885
definition	codon_start : 1 function : unknown product : hypothetical protein LOC626359 protein_id : NP_001033016.1

name	Mesp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469091 CCDS:CCDS21387.1 GeneID:17292 MGI:107785
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mesoderm posterior 1 protein_id : NP_032614.1

name	Mesp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955348 GeneID:17293 MGI:1096325
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IMP] [Evidence IGI] codon_start : 1 product : mesoderm posterior 2 protein_id : NP_032615.2

name	Anpep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678664 CCDS:CCDS21388.1 GeneID:16790 MGI:96749
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : leucine arylaminopeptidase 1, intestinal; aminopeptidase M; aminopeptidase N; microsomal aminopeptidase product : alanyl (membrane) aminopeptidase protein_id : NP_032512.1

name	Ap3s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538814 CCDS:CCDS21389.1 GeneID:11778 MGI:1337060
definition	GO_component : GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : adaptor-related protein complex AP-3, sigma 2 subunit; sigma 3B product : adaptor-related protein complex 3, sigma 2 subunit protein_id : NP_033812.2

name	2610034B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47498088 CCDS:CCDS21390.1 GeneID:70420 MGI:1917670
definition	codon_start : 1 product : hypothetical protein LOC70420 protein_id : NP_081696.1

name	Zfp710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254298 GeneID:209225 MGI:1921747
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 710 protein_id : NP_780642.2

name	Idh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370516 GeneID:269951 MGI:96414
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004450 - isocitrate dehydrogenase (NADP+) activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016652 - oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0006097 - glyoxylate cycle [Evidence IEA]; GO:0006092 - main pathways of carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : isocitrate dehydrogenase 2 (NADP+), mitochondrial protein_id : NP_766599.1

name	Sema4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625636 CCDS:CCDS21391.1 GeneID:20352 MGI:107559
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 4B precursor protein_id : NP_038687.2

name	Cib1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755154 CCDS:CCDS21392.1 GeneID:23991 MGI:1344418
definition	GO_component : GO:0005737 - cytoplasm [Evidence IMP]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence TAS] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence ISS] codon_start : 1 note : protein kinase, DNA activated, catalytic polypeptide interacting protein; calcium and integrin binding, protein kinase interacting protein product : calcium and integrin binding 1 (calmyrin) protein_id : NP_036000.1

name	D330012F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123702129 GeneID:269952 MGI:2443429
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0031177 - phosphopantetheine binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC269952 protein_id : NP_848867.2

name	LOC100042379 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257498 GeneID:100042379
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478128.1

name	Ttll13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392072 GeneID:269954 MGI:1920845
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 product : tubulin tyrosine ligase-like family, member 13 protein_id : NP_808433.2

name	Ngrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981417 CCDS:CCDS21393.1 GeneID:83485 MGI:1933212
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : neurite outgrowth associated protein product : neugrin protein_id : NP_113552.2

name	Vps33b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017383 GeneID:233405 MGI:2446237
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vacuolar protein sorting 33B protein_id : NP_835171.1

name	Prc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553111 GeneID:233406 MGI:1858961
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : protein regulator of cytokinesis 1 protein_id : NP_660132.1

name	Rccd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734102 CCDS:CCDS21394.1 GeneID:269955 MGI:2444156
definition	codon_start : 1 exception : mismatches in translation product : RCC1 domain containing 1 protein_id : NP_775621.1

name	Unc45a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527172 CCDS:CCDS21395.1 GeneID:101869 MGI:2142246
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : smooth muscle cell associated protein-1 protein_id : NP_598713.1

name	Hddc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312092 CCDS:CCDS21396.1 GeneID:68695 MGI:1915945
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : HD domain containing 3 protein_id : NP_081088.1

name	Man2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777691 GeneID:140481 MGI:2150656
definition	GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : mannosidase, alpha, class 2A, member 2; alpha mannosidase IIx product : mannosidase 2, alpha 2 protein_id : NP_766491.1

name	Fes (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185914 GeneID:14159 MGI:95514
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : tyrosine kinase Fps/Fes product : feline sarcoma oncogene protein_id : NP_034324.2

name	Furin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347022 GeneID:18550 MGI:97513
definition	GO_component : GO:0005769 - early endosome [Evidence TAS]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0030140 - trans-Golgi network transport vesicle [Evidence ISS]; GO:0012510 - trans-Golgi network transport vesicle membrane [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004276 - furin activity [Evidence ISS] [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : proprotein convertase subtilisin/kexin type 3; subtilisin pro-protein processing enzyme product : furin (paired basic amino acid cleaving enzyme) protein_id : NP_001074923.1

name	Furin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754996 CCDS:CCDS21397.1 GeneID:18550 MGI:97513
definition	GO_component : GO:0005769 - early endosome [Evidence TAS]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0030140 - trans-Golgi network transport vesicle [Evidence ISS]; GO:0012510 - trans-Golgi network transport vesicle membrane [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004276 - furin activity [Evidence ISS] [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : proprotein convertase subtilisin/kexin type 3; subtilisin pro-protein processing enzyme product : furin (paired basic amino acid cleaving enzyme) protein_id : NP_035176.1

name	Blm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225360 GeneID:12144 MGI:1328362
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0051098 - regulation of binding [Evidence IDA] codon_start : 1 product : Bloom syndrome protein homolog protein_id : NP_001035992.1

name	Blm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225362 GeneID:12144 MGI:1328362
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0051098 - regulation of binding [Evidence IDA] codon_start : 1 product : Bloom syndrome protein homolog protein_id : NP_031576.3

name	Crtc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140971160 CCDS:CCDS21398.1 GeneID:70461 MGI:1917711
definition	codon_start : 1 product : transducer of regulated CREB protein 3 protein_id : NP_776288.2

name	Iqgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710042 GeneID:29875 MGI:1352757
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005099 - Ras GTPase activator activity [Evidence IEA] GO_process : GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation function : regulates cadherin-based cell adhesion note : Cdc42-Rac1 effector protein product : IQ motif containing GTPase activating protein 1 protein_id : NP_057930.1

name	Zscan2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677607 CCDS:CCDS21399.1 GeneID:22691 MGI:99176
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 29 protein_id : NP_033579.1

name	Wdr73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257524 GeneID:71968 MGI:1919218
definition	codon_start : 1 product : WD repeat domain 73 protein_id : XP_001479546.1

name	Nmb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386018 CCDS:CCDS21400.1 GeneID:68039 MGI:1915289
definition	GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : neuromedin B protein_id : NP_080799.1

name	Sec11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910550 CCDS:CCDS21401.1 GeneID:56529 MGI:1929464
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0006465 - signal peptide processing [Evidence IEA] codon_start : 1 note : signal peptidase complex (18kD) product : Sec11-like 1 protein_id : NP_064335.1

name	Zfp592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520115 GeneID:233410 MGI:2443541
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 592 protein_id : NP_848822.1

name	Alpk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938324 GeneID:116904 MGI:2151224
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0007507 - heart development [Evidence IMP] codon_start : 1 product : myocyte induction differentiation originator protein_id : NP_473426.2

name	Slc28a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921363 CCDS:CCDS21402.1 GeneID:434203 MGI:3605073
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001882 - nucleoside binding [Evidence IEA]; GO:0005415 - nucleoside:sodium symporter activity [Evidence IEA]; GO:0005350 - pyrimidine transporter activity [Evidence ISS] GO_process : GO:0015855 - pyrimidine transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 protein_id : NP_001004184.1

name	EG623286 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906344 GeneID:623286 MGI:3648526
definition	codon_start : 1 product : similar to NADH dehydrogenase (ubiquinone) Fe-S protein 6 protein_id : XP_894909.1

name	LOC100043130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257527 GeneID:100043130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479585.1

name	Pde8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679249 GeneID:18584 MGI:1277116
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence IDA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000156 - two-component response regulator activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 product : phosphodiesterase 8A protein_id : NP_032829.1

name	EG636544 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380584 GeneID:636544 MGI:3648560
definition	codon_start : 1 product : similar to mitochondrial inner membrane translocase component Tim17a protein_id : XP_987736.1

name	LOC384647 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384647
definition	number : 1 pseudo : _no_value

name	LOC384647 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384647
definition	number : 2 pseudo : _no_value

name	LOC100042402 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042402
definition	number : 1 pseudo : _no_value

name	LOC100042402 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042402
definition	number : 2 pseudo : _no_value

name	LOC100042402 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042402
definition	number : 3 pseudo : _no_value

name	EG665900 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257522 GeneID:665900 MGI:3644089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 300 ESTs, 6 Proteins product : predicted gene, EG665900 pseudo : _no_value transcript_id : XR_001799.2

name	LOC100042374 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257496 GeneID:100042374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ribosomal protein S19 pseudo : _no_value transcript_id : XR_033523.1

clone name	MSMg01-416B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080K23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-520J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436G23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-199B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-208H17.b	B6Ng01-208H17.g
ACC	GA027352	GA027353
length	937	1,089
definition	B6Ng01-208H17.b	B6Ng01-208H17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(87,484,814 - 87,485,750)	(87,354,232 - 87,355,289)
sequence	gaattctgcagtgggagacttgtagcttccagattagtggagaggaagtc actaaatcataattacaaccaatgctgtaaatgaaaacaagtaacagaag ctgctttgtcttaaggggtttggacggtgttaataaagaggatttgttaa tcttggacacattgtagtaggaggtttaattctgaatctgccgcgtttgt cttcaaggtacttgcgagctcccagatttgtatgcaaaatatgtgtatgc atctgtatttatcccctgctctcgtgggactctgggctctgcaaaccctg acttgtagcagccagtagacaaccttgagtctctcctgtctccccagggg tccaggcccgctcctagcactgggcatctacactctactgctgatggcac tgatgactacagatttcgtgcacttctgccgtggtcggggacggagagaa aaacaaaactccagcggctgccgccgcctttcctttagagcctcttccgc gcgccctctacaggttccagtgggaacagactaggcgctcgtgaagcagc cctgagcctgagcctgcgcctgcgcaacgcgagtaccccgcccttgcaca gacccaaccacttcttggcctcgccttgtttagcgtaacactgacgcatt gctggggcggggcagtcgccggcatctcgcggatcccagggacacctttg ctctaaagactgcgcctgcactggctcttggagcttagcttcgtgatgac tgtgagtggcccggagacccccgagccccgaccttccgaccccggggtgc gtactgattctcctgtgccatctcccctttcacacatgcgccttcgcacc tggtcgccgtcaccttattctagcccttcacgggactcggccaagacccg gctcttctcccaggcgcgctgctctgcccaacgcctt	gaattcagtgggtgtcatacagaagggcctcctggagcttctcagagtgt agtccttgggctacctcctcctaagtcactgggagctggtcaagaggctc agaccagcagtttcagaatctcttgggagggcctggagtccgggtgatgt ttagggaggttggcattggtgctggaactttccttggccccccaatttat cgaagtactaagggttggaagtctctggagctgcaggagttgagtttgag aaaaggctcttggtggtttaaagagaggtttcaactgcctctggcctcag gcaggaccgttccttaaagttctagcgcagccctgtgtgtaactctgggt tttaggagtttgtcaagacttcagccacagagctatacaaatgtcctcaa acttctgcaccgcatccctccccaggagagcttctggggcgcagcggtgg gggccctgttgtccagtgactggagctgctctctacctcatgtgtctcag caggcttactagggaagccccacctgagagctgcttcagcaccctgtgct gtgtggtaaaaaaaagctgagcttccgtcaaagggctagtgtggtttcct gttcttgaacagtgtgagaaccaagttttttcatttcccctttctccgtg gctaccaggagtcttggtactaaattttgcaacccaccccaatagctatg taaagatcctgtgacctgcttgtgtgaccgctcttttctctctggtttag atgttcttcttcagattggttttttctctgcctgtgattttaatgcttct attctcaacactttcttgtcttttgttgttttccttacctcttccttgga aacaggctggagggtattgtaaagacacggggaacacgcagacacacatg gaagtcatccctccacattgcttggctggcatgcttgtcttcattggact tcccagcctctgtagagtgtgtttgtttgcattggtcctgaaccaactgg tctgttgggacaatgccctgaaggcttgctcaagggctcgccttcctgct ttggttgtgggtttttagtctctttacttttgtttggtt
quality values	Open. Hide. 58 31 35 29 62 62 47 47 56 47 62 62 62 62 62 47 42 41 31 62 62 62 54 62 62 62 62 62 62 43 12 11 23 19 11 11 13 23 27 23 25 25 23 23 23 28 54 56 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 50 36 35 34 32 31 48 56 50 50 50 46 43 46 45 43 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 54 54 62 59 62 54 62 62 62 62 62 62 54 62 62 49 54 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 43 62 49 49 44 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 56 46 56 56 56 62 62 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 48 62 62 52 62 62 62 62 62 58 54 58 58 58 58 58 42 54 58 58 58 52 50 54 54 54 58 58 54 54 52 58 54 58 58 45 54 54 41 54 44 39 44 52 52 54 58 58 58 58 58 58 54 52 49 46 58 52 52 52 52 54 49 42 41 54 54 58 58 58 58 58 42 39 58 53 58 52 51 58 58 50 58 54 58 47 47 50 58 58 50 58 41 51 53 52 58 58 46 52 50 47 50 50 58 58 47 58 58 58 58 54 50 58 58 49 58 50 49 50 53 53 40 50 50 37 49 50 32 54 53 53 50 37 46 52 50 31 29 50 54 40 42 33 58 44 27 27 33 40 58 58 58 43 47 51 51 53 35 26 58 58 39 49 37 53 58 32 41 54 58 40 49 37 41 37 39 49 35 35 53 53 50 32 49 18 54 39 45 54 37 52 20 53 33 30 39 25 37 51 53 33 38 49 29 41 54 42 53 53 28 35 54 51 15 54 42 32 35 37 20 37 17 42 44 47 42 33 33 28 23 44 47 47 26 53 19 47 43 39 33 33 23 41 11 25 31 42 32 53 53 52 18 41 31 45 45 28 21 32 53 32 21 42 36 40 33 32 30 45 31 32 26 45 27 31 31 31 18 37 32 36 31 42 51 25 25 26 34 24 28 39 31 41 30 41 31 51 15 28 23 31 32 25 31 21 31 46 32 30 30 31 37 36 22 25 23 30 31 42 18 26 28 28 31 29 31 22 18 36 21 26 31 18 31 31 22 46 28 25 8 29 23 36 24 11 16 33 29 18 30 8 38 29 16 23 19 8 14 22 9 14 31 27 25 21 25 20 32 23 29 25 31 19 20 24 24 38 24 17 21 11 28 31 25 33 30 33 23 33 22 22	Open. Hide. 62 47 56 47 62 47 38 51 56 62 14 14 10 19 15 14 11 21 21 19 16 25 23 27 19 50 59 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 49 49 44 28 28 31 38 43 51 48 32 48 48 54 59 62 54 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 56 59 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 51 62 62 50 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 56 59 51 48 48 48 59 62 62 59 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 56 56 50 56 44 43 62 49 46 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 56 56 56 59 59 62 62 62 62 62 62 62 56 56 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 62 56 47 62 62 62 62 62 62 62 47 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 56 56 56 56 38 56 62 62 62 48 42 62 56 54 62 62 62 62 62 62 42 50 56 47 41 62 56 62 62 56 62 56 62 62 62 56 56 62 56 56 56 62 62 62 47 47 62 62 56 56 62 56 62 39 62 62 54 52 62 42 52 52 43 62 62 33 62 43 62 62 53 54 52 62 62 62 47 42 62 62 48 62 62 62 62 42 54 42 54 62 62 62 52 62 43 62 62 58 58 58 52 58 29 41 42 40 54 49 58 58 58 58 58 45 47 24 48 42 42 32 52 47 58 58 58 52 54 27 32 58 54 47 58 58 52 54 46 44 22 21 27 52 58 50 54 52 49 36 38 31 26 42 47 41 22 36 17 15 54 58 41 50 53 24 28 22 22 27 26 32 54 47 16 18 50 52 35 35 42 42 39 52 52 50 31 58 36 40 34 21 47 47 50 52 50 47 37 20 47 37 48 33 48 48 50 25 22 30 50 30 27 50 34 47 49 34 39 51 49 34 41 43 34 26 35 46 41 51 31 48 19 38 15 39 18 37 12 9 28 28 49 35 37 50 26 23 18 39 14 28 51 39 35 51 58 49 58 19 21 46 50 34 50 35 34 33 49 19 50 28 14 53 53 49 40 44 30 54 26 14 11 25 37 41 8 12 17 37 30 18 50 22 19 28 29 50 41 42 25 24 28 11 33 17 42 54 30 16 6 6 15 16 44 25 32 49 38 8 44 21 26 39 35 52 18 41 52 16 7 14 42 10 13 51 10 44 12 34 14 22 26 7 8 30 7 49 30 17 17 9 5 20 31 12 54 24 21 32 27 14 12 8 14 44 15 29 17 9 11 17 21 28 14 6 35 17 7 14 19 32 12 11 9 10 52 21 19 32 13 10 10 13 24 9 9 9 19 30 32 15 15 37 29 17 21 39 28 34 21 9 9 36 20 23 29 33 33 31 8 25 12 42 46 6 18 17 9 8 31 46 7 21 31 45 8 41 12 12 27 29 9 30 24 25 11 12 9 8 12 5 5 22 12 22 13 38 33 37 19 32 16 26 13 29 16 8 27 6 6 35 8 20 12 7 15 5 18 11 14 11 8 12 6 9 22 5 6 9 9 20 31 21 11 7 9 7 24 10 8 21 25 18 14 15 24 18 19 13 11 7 14 7 9 5 6 8 17 46 11 9 18 6 5 5 6 22 13 6 8 6 19 24 24 26 9 26 13 6 6 11 11 17 10 9 25 8 22 13 27 7 8 19 6 17 17 5 13 5 5 5 7 10 14 13 14 9 33 30 18 14 6 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_87484814_87485750
seq2: B6Ng01-208H17.b_46_982 (reverse)

seq1  AAGGCGTTGGGCAGAGCAGCGCGCCTGGGAGAAGAGCCGGGTCTTGGCCG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCGTTGGGCAGAGCAGCGCGCCTGGGAGAAGAGCCGGGTCTTGGCCG  50

seq1  AGTCCCGTGAAGGGCTAGAATAAGGTGACGGCGACCAGGTGCGAAGGCGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCCGTGAAGGGCTAGAATAAGGTGACGGCGACCAGGTGCGAAGGCGC  100

seq1  ATGTGTGAAAGGGGAGATGGCACAGGAGAATCAGTACGCACCCCGGGGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGTGAAAGGGGAGATGGCACAGGAGAATCAGTACGCACCCCGGGGTC  150

seq1  GGAAGGTCGGGGCTCGGGGGTCTCCGGGCCACTCACAGTCATCACGAAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGTCGGGGCTCGGGGGTCTCCGGGCCACTCACAGTCATCACGAAGC  200

seq1  TAAGCTCCAAGAGCCAGTGCAGGCGCAGTCTTTAGAGCAAAGGTGTCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCTCCAAGAGCCAGTGCAGGCGCAGTCTTTAGAGCAAAGGTGTCCCT  250

seq1  GGGATCCGCGAGATGCCGGCGACTGCCCCGCCCCAGCAATGCGTCAGTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATCCGCGAGATGCCGGCGACTGCCCCGCCCCAGCAATGCGTCAGTGT  300

seq1  TACGCTAAACAAGGCGAGGCCAAGAAGTGGTTGGGTCTGTGCAAGGGCGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGCTAAACAAGGCGAGGCCAAGAAGTGGTTGGGTCTGTGCAAGGGCGG  350

seq1  GGTACTCGCGTTGCGCAGGCGCAGGCTCAGGCTCAGGGCTGCTTCACGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACTCGCGTTGCGCAGGCGCAGGCTCAGGCTCAGGGCTGCTTCACGAG  400

seq1  CGCCTAGTCTGTTCCCACTGGAACCTGTAGAGGGCGCGCGGAAGAGGCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCTAGTCTGTTCCCACTGGAACCTGTAGAGGGCGCGCGGAAGAGGCTC  450

seq1  TAAAGGAAAGGCGGCGGCAGCCGCTGGAGTTTTGTTTTTCTCTCCGTCCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGAAAGGCGGCGGCAGCCGCTGGAGTTTTGTTTTTCTCTCCGTCCC  500

seq1  CGACCACGGCAGAAGTGCACGAAATCTGTAGTCATCAGTGCCATCAGCAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGACCACGGCAGAAGTGCACGAAATCTGTAGTCATCAGTGCCATCAGCAG  550

seq1  TAGAGTGTAGATGCCCAGTGCTAGGAGCGGGCCTGGACCCCTGGGGAGAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTGTAGATGCCCAGTGCTAGGAGCGGGCCTGGACCCCTGGGGAGAC  600

seq1  AGGAGAGACTCAAGGTTGTCTACTGGCTGCTACAAGTCAGGGTTTGCAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAGACTCAAGGTTGTCTACTGGCTGCTACAAGTCAGGGTTTGCAGA  650

seq1  GCCCAGAGTCCCACGAGAGCAGGGGATAAATACAGATGCATACACATATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGAGTCCCACGAGAGCAGGGGATAAATACAGATGCATACACATATT  700

seq1  TTGCATACAAATCTGGGAGCTCGCAAGTACCTTGAAGACAAACGCGGCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCATACAAATCTGGGAGCTCGCAAGTACCTTGAAGACAAACGCGGCAG  750

seq1  ATTCAGAATTAAACCTCCTACTACAATGTGTCCAAGATTAACAAATCCTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCAGAATTAAACCTCCTACTACAATGTGTCCAAGATTAACAAATCCTC  800

seq1  TTTATTAACACCGTCCAAACCCCTTAAGACAAAGCAGCTTCTGTTACTTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTAACACCGTCCAAACCCCTTAAGACAAAGCAGCTTCTGTTACTTG  850

seq1  TTTTCATTTACAGCATTGGTTGTAATTATGATTTAGTGACTTCCTCTCCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATTTACAGCATTGGTTGTAATTATGATTTAGTGACTTCCTCTCCA  900

seq1  CTAATCTGGAAGCTACAAGTCTCCCACTGCAGAATTC  937
      |||||||||||||||||||||||||||||||||||||
seq2  CTAATCTGGAAGCTACAAGTCTCCCACTGCAGAATTC  937

seq1: chr7_87354232_87355289
seq2: B6Ng01-208H17.g_67_1155

seq1  GAATTCAGTGGGTGTCATACAGAAGGGCCTCCTGGAGCTTCTCAGAGTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTGGGTGTCATACAGAAGGGCCTCCTGGAGCTTCTCAGAGTGT  50

seq1  AGTCCTTGGGCTACCTCCTCCTAAGTCACTGGGAGCTGGTCAAGAGGCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTTGGGCTACCTCCTCCTAAGTCACTGGGAGCTGGTCAAGAGGCTC  100

seq1  AGACCAGCAGTTTCAGAATCTCTTGGGAGGGCCTGGAGTCCGGGTGATGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCAGCAGTTTCAGAATCTCTTGGGAGGGCCTGGAGTCCGGGTGATGT  150

seq1  TTAGGGAGGTTGGCATTGGTGCTGGAACTTTCCTTGGCCCCCCAATTTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGGAGGTTGGCATTGGTGCTGGAACTTTCCTTGGCCCCCCAATTTAT  200

seq1  CGAAGTACTAAGGGTTGGAAGTCTCTGGAGCTGCAGGAGTTGAGTTTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAGTACTAAGGGTTGGAAGTCTCTGGAGCTGCAGGAGTTGAGTTTGAG  250

seq1  AAAAGGCTCTTGGTGGTTTAAAGAGAGGTTTCAACTGCCTCTGGCCTCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGCTCTTGGTGGTTTAAAGAGAGGTTTCAACTGCCTCTGGCCTCAG  300

seq1  GCAGGACCGTTCCTTAAAGTTCTAGCGCAGCCCTGTGTGTAACTCTGGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGACCGTTCCTTAAAGTTCTAGCGCAGCCCTGTGTGTAACTCTGGGT  350

seq1  TTTAGGAGTTTGTCAAGACTTCAGCCACAGAGCTATACAAATGTCCTCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGGAGTTTGTCAAGACTTCAGCCACAGAGCTATACAAATGTCCTCAA  400

seq1  ACTTCTGCACCGCATCCCTCCCCAGGAGAGCTTCTGGGGCGCAGCGGTGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTGCACCGCATCCCTCCCCAGGAGAGCTTCTGGGGCGCAGCGGTGG  450

seq1  GGGCCCTGTTGTCCAGTGACTGGAGCTGCTCTCTACCTCATGTGTCTCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCTGTTGTCCAGTGACTGGAGCTGCTCTCTACCTCATGTGTCTCAG  500

seq1  CAGGCTTACTAGGGAAGCCCCACCTGAGAGCTGCTTCAGCACCCTGTGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTTACTAGGGAAGCCCCACCTGAGAGCTGCTTCAGCACCCTGTGCT  550

seq1  GTGTGGTAAAAAAAAGCTGAGCTTCCGTCAAAGGGCTAGTGTGGTTTCCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGGTAAAAAAAAGCTGAGCTTCCGTCAAAGGGCTAGTGTGGTTTCCT  600

seq1  GTTCTTGAACAGTGTGAGAACCAAGTTTTTTCATTTCCCCTTTCTCCGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTTGAACAGTGTGAGAACCAAGTTTTTTCATTTCCCCTTTCTCCGTG  650

seq1  GCTACCAGGAGTCTTGGTACTAAA-TTTGCAACCCACCCCAATAGCTATG  699
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  GCTACCAGGAGTCTTGGTACTAAATTTTGCAACCCACCCCAATAGCTATG  700

seq1  TAAAGATCCTGTGACCTGCTTGTGTGACCGCTCTTTTCTCTCTGGTTTAG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGATCCTGTGACCTGCTTGTGTGACCGCTCTTTTCTCTCTGGTTTAG  750

seq1  ATG-TCTTCTTCAGATTGG-TTTTTCTCTGCCTGTGATTTTAATGCTTCT  797
      ||| ||||||||||||||| ||||||||||||||||||||||||||||||
seq2  ATGTTCTTCTTCAGATTGGTTTTTTCTCTGCCTGTGATTTTAATGCTTCT  800

seq1  A-TCTCAACACTTTCTTGTC-TTTGT--GTTTCCTTACCTCTTCC-TGGA  842
      | |||||||||||||||||| |||||   |||||||||||||||| ||||
seq2  ATTCTCAACACTTTCTTGTCTTTTGTTGTTTTCCTTACCTCTTCCTTGGA  850

seq1  ACCAGGCT-GAGGGTA-TGTAAAGACACGGG--ACACGCAGACACACAT-  887
      | |||||| ||||||| ||||||||||||||  |||||||||||||||| 
seq2  AACAGGCTGGAGGGTATTGTAAAGACACGGGGAACACGCAGACACACATG  900

seq1  GAAGTCATCC--TCACATTGCTTGGCTGGCATGC-TGTCTTCAT--GGCT  932
      ||||||||||   ||||||||||||||||||||| |||||||||  | ||
seq2  GAAGTCATCCCTCCACATTGCTTGGCTGGCATGCTTGTCTTCATTGGACT  950

seq1  TCCCAG-CTCTGT-GAGTGTGTTTGTTTGCA-TGGTCCTGAGCC-ACTGG  978
      |||||| |||||| ||||||||||||||||| ||||||||| || |||||
seq2  TCCCAGCCTCTGTAGAGTGTGTTTGTTTGCATTGGTCCTGAACCAACTGG  1000

seq1  TCGGTTGGGAC-ATG-CCTG-AGGC-TGGTCAGGGGCT-GCCTT-CTGCT  1022
      || |||||||| ||| |||| |||| || ||| ||||| ||||| |||||
seq2  TCTGTTGGGACAATGCCCTGAAGGCTTGCTCAAGGGCTCGCCTTCCTGCT  1050

seq1  T--GGTGTGGGTTTTT-GTTTCTTTAGTTTGTTTTGGTT  1058
      |  | ||||||||||| || |||||| |||  |||||||
seq2  TTGGTTGTGGGTTTTTAGTCTCTTTACTTTTGTTTGGTT  1089

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information