MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-209P18
Chromosome	7 (Build37)
Map Location	147,088,191 - 147,088,961
singlet/doublet	singlet
Overlap gene	Kndc1
Upstream gene	Bnip3, EG668784, LOC669185, 6330417G02Rik, Dpysl4, Stk32c, LOC100038956, Lrrc27, Pwwp2, Inpp5a, Nkx6-2, E030019B06Rik, 9330101J02Rik, LOC100043472, EG434253, EG664869, Gpr123, LOC244229
Downstream gene	Utf1, LOC100039095, 6430531B16Rik, Adam8, Tubgcp2, Zfp511, Msx3, Drd1ip, Prap1, 1810014F10Rik, Echs1, Paox, Mtg1, Sprn, Olfr522, Olfr523, Olfr524, E430002D04Rik, 5830411N06Rik, EG622335, Olfr525, Olfr527, GA_x5J8B7W72BC-152913-152037, Olfr60, GA_x5J8B7W72BC-125691-125311, Olfr530, LOC622973, Olfr531, Olfr532, Olfr533, Olfr534-ps1, Olfr535, Olfr536, Olfr537-ps1, Olfr1523-ps1, Olfr538, Olfr1553-ps1, Olfr46, Olfr61, Olfr53, Olfr539, GA_x5J8B7W3EKE-4574231-4574913, Olfr45, Olfr541, GA_x5J8B7W3EKE-4522784-4521912, Cyp2e1, Syce1, LOC100043529, BC066028, 1190003J15Rik, Scgb1c1, Odf3, Bet1l, Ric8, Sirt3, Psmd13, LOC100043546, Cox8b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bnip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12176 MGI:109326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668784 MGI:3643920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC669185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	6330417G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74004 MGI:1921254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Dpysl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26757 MGI:1349764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk32c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57740 MGI:2385336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lrrc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76612 MGI:1923862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pwwp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101631 MGI:2142008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212111 MGI:2686961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx6-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14912 MGI:1352738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E030019B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212124 MGI:2685016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	9330101J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664857 MGI:2444387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 3 Proteins

name	LOC100043472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 328 ESTs, 4 Proteins

name	EG434253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434253 MGI:3649022
definition	note : predicted gene, EG434253 pseudo : _no_value

name	EG664869 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664869 MGI:3646626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 399 ESTs, 1 Protein

name	Gpr123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52389 MGI:1277167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC244229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:244229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 5 Proteins pseudo : _no_value

name	Kndc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76484 MGI:1923734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Utf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22286 MGI:1276125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	6430531B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381933 MGI:2685939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11501 MGI:107825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubgcp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74237 MGI:1921487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp511 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69752 MGI:1917002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins

name	Msx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17703 MGI:106587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drd1ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68566 MGI:1915816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22264 MGI:893573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810014F10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69064 MGI:1916314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Echs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93747 MGI:2136460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212503 MGI:1916983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212508 MGI:2685015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sprn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212518 MGI:3582583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr522 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258954 MGI:3030356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258511 MGI:3030357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258055 MGI:3030358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E430002D04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244233 MGI:2443796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830411N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244234 MGI:2443685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622335 MGI:3646082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	Olfr525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258958 MGI:3030359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr527 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257939 MGI:3030361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W72BC-152913-152037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257753
definition	note : olfactory receptor GA_x5J8B7W72BC-152913-152037 pseudo : _no_value

name	Olfr60 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18361 MGI:1333881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W72BC-125691-125311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257754
definition	note : olfactory receptor GA_x5J8B7W72BC-125691-125311 pseudo : _no_value

name	Olfr530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258512 MGI:3030364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr531 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258955 MGI:3030365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr532 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259028 MGI:3030366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258056 MGI:3030367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr534-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404402 MGI:3030368
definition	note : olfactory receptor 534, pseudogene 1 pseudo : _no_value

name	Olfr535 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258956 MGI:3030369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr536 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258513 MGI:3030370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr537-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258200 MGI:3030371
definition	gene_synonym : MOR253-11P note : olfactory receptor 537, pseudogene 1 pseudo : _no_value

name	Olfr1523-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258174 MGI:3031357
definition	gene_synonym : MOR253-12P note : olfactory receptor 1523, pseudogene 1 pseudo : _no_value

name	Olfr538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258201 MGI:3030372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1553-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257965 MGI:3031387
definition	gene_synonym : MOR253-13P note : olfactory receptor 1553, pseudogene 1 pseudo : _no_value

name	Olfr46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18345 MGI:1333824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18362 MGI:1333885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258962 MGI:1333749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr539 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258963 MGI:3030373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3EKE-4574231-4574913 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257844
definition	note : olfactory receptor GA_x5J8B7W3EKE-4574231-4574913 pseudo : _no_value

name	Olfr45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18344 MGI:1333826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258964 MGI:3030375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3EKE-4522784-4521912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257845
definition	note : olfactory receptor GA_x5J8B7W3EKE-4522784-4521912 pseudo : _no_value

name	Cyp2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13106 MGI:88607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74075 MGI:1921325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 4 Proteins

name	LOC100043529 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	BC066028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407812 MGI:3039601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190003J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76974 MGI:1916142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scgb1c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338417 MGI:2655401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins

name	Odf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69287 MGI:1916537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bet1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54399 MGI:1913128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ric8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101489 MGI:2141866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64384 MGI:1927665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23997 MGI:1345192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 574 ESTs, 8 Proteins

name	Cox8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12869 MGI:105958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bnip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375800 GeneID:12176 MGI:109326
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B interacting protein 1, NIP3 transcript_id : NM_009760.3

name	LOC669185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257750 GeneID:669185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC669185 transcript_id : XM_001479912.1

name	6330417G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257753 GeneID:74004 MGI:1921254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 6330417G02 gene transcript_id : XM_355952.5

name	Dpysl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344019 GeneID:26757 MGI:1349764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydropyrimidinase-like 4 transcript_id : NM_011993.3

name	Stk32c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366033 GeneID:57740 MGI:2385336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 32C transcript_id : NM_021302.2

name	LOC100038956 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258246 GeneID:100038956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CG15780-PA transcript_id : XM_001471976.1

name	Lrrc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60650307 GeneID:76612 MGI:1923862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 27 transcript_id : NM_027164.1

name	Pwwp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131138 GeneID:101631 MGI:2142008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PWWP domain containing 2 transcript_id : NM_001033206.2

name	Inpp5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354555 GeneID:212111 MGI:2686961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase A transcript_id : NM_183144.2

name	Nkx6-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443674 GeneID:14912 MGI:1352738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK6 transcription factor related, locus 2 (Drosophila) transcript_id : NM_183248.2

name	E030019B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381440 GeneID:212124 MGI:2685016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : RIKEN cDNA E030019B06 gene transcript_id : XM_133957.7

name	9330101J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258248 GeneID:664857 MGI:2444387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 3 Proteins product : RIKEN cDNA 9330101J02 gene transcript_id : XM_001472165.1

name	LOC100043472 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258260 GeneID:100043472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 328 ESTs, 4 Proteins product : similar to NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 transcript_id : XM_001480473.1

name	EG664869 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381445 GeneID:664869 MGI:3646626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 399 ESTs, 1 Protein product : predicted gene, EG664869 transcript_id : XM_973155.1

name	Gpr123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446129 GeneID:52389 MGI:1277167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 123 transcript_id : NM_177469.3

name	Kndc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482624 GeneID:76484 MGI:1923734
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinase non-catalytic C-lobe domain (KIND) containing 1 transcript_id : NM_177261.3

name	Utf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130372 GeneID:22286 MGI:1276125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : undifferentiated embryonic cell transcription factor 1 transcript_id : NM_009482.2

name	LOC100039095 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258251 GeneID:100039095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039095 transcript_id : XM_001472250.1

name	6430531B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360518 GeneID:381933 MGI:2685939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430531B16 gene transcript_id : NM_001033465.2

name	Adam8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131182 GeneID:11501 MGI:107825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 8 transcript_id : NM_007403.2

name	Tubgcp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526967 GeneID:74237 MGI:1921487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma complex associated protein 2 transcript_id : NM_133755.1

name	Zfp511 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258262 GeneID:69752 MGI:1917002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins product : zinc finger protein 511 transcript_id : XM_887149.3

name	Msx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354337 GeneID:17703 MGI:106587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box, msh-like 3 transcript_id : NM_010836.2

name	Drd1ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802515 GeneID:68566 MGI:1915816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine receptor D1 interacting protein transcript_id : NM_026769.3

name	Prap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678510 GeneID:22264 MGI:893573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich acidic protein 1 transcript_id : NM_009475.1

name	1810014F10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377997 GeneID:69064 MGI:1916314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810014F10 gene transcript_id : NM_026928.2

name	Echs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359909 GeneID:93747 MGI:2136460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl Coenzyme A hydratase, short chain, 1, mitochondrial transcript_id : NM_053119.2

name	Paox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803044 GeneID:212503 MGI:1916983
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyamine oxidase (exo-N4-amino) transcript_id : NM_153783.3

name	Mtg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556273 GeneID:212508 MGI:2685015
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial GTPase 1 homolog (S. cerevisiae) transcript_id : NM_199301.1

name	Sprn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118240 GeneID:212518 MGI:3582583
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shadow of prion protein transcript_id : NM_183147.2

name	Olfr522 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129012 GeneID:258954 MGI:3030356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 522 transcript_id : NM_146952.1

name	Olfr523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239353 GeneID:258511 MGI:3030357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 523 transcript_id : NM_146518.1

name	Olfr524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801393 GeneID:258055 MGI:3030358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 524 transcript_id : NM_001011814.1

name	E430002D04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064871 GeneID:244233 MGI:2443796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E430002D04 gene transcript_id : NM_172909.3

name	5830411N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352147 GeneID:244234 MGI:2443685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830411N06 gene transcript_id : NM_175533.3

name	EG622335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381449 GeneID:622335 MGI:3646082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : predicted gene, EG622335 transcript_id : XM_886771.2

name	Olfr525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227554 GeneID:258958 MGI:3030359
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 525 transcript_id : NM_146956.1

name	Olfr527 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801327 GeneID:257939 MGI:3030361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 527 transcript_id : NM_001011776.1

name	Olfr60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203808 GeneID:18361 MGI:1333881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 60 transcript_id : NM_146955.1

name	Olfr530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238963 GeneID:258512 MGI:3030364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 530 transcript_id : NM_146519.1

name	Olfr531 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129014 GeneID:258955 MGI:3030365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 531 transcript_id : NM_146953.1

name	Olfr532 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227414 GeneID:259028 MGI:3030366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 532 transcript_id : NM_147026.1

name	Olfr533 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801395 GeneID:258056 MGI:3030367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 533 transcript_id : NM_001011815.1

name	Olfr535 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129008 GeneID:258956 MGI:3030369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 535 transcript_id : NM_146954.1

name	Olfr536 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254193 GeneID:258513 MGI:3030370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 536 transcript_id : NM_146520.2

name	Olfr538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801487 GeneID:258201 MGI:3030372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 538 transcript_id : NM_001011867.1

name	Olfr46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203806 GeneID:18345 MGI:1333824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 46 transcript_id : NM_146934.1

name	Olfr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203810 GeneID:18362 MGI:1333885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 61 transcript_id : NM_146964.1

name	Olfr53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129006 GeneID:258962 MGI:1333749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 53 transcript_id : NM_146960.1

name	Olfr539 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129000 GeneID:258963 MGI:3030373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 539 transcript_id : NM_146961.1

name	Olfr45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203816 GeneID:18344 MGI:1333826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 45 transcript_id : NM_146963.1

name	Olfr541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129002 GeneID:258964 MGI:3030375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 541 transcript_id : NM_146962.1

name	Cyp2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57634519 GeneID:13106 MGI:88607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily e, polypeptide 1 transcript_id : NM_021282.2

name	Syce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258253 GeneID:74075 MGI:1921325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 4 Proteins product : synaptonemal complex central element protein 1 transcript_id : XM_001472886.1

name	BC066028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383654 GeneID:407812 MGI:3039601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066028 transcript_id : NM_001001180.2

name	1190003J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347753 GeneID:76974 MGI:1916142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190003J15 gene transcript_id : NM_029821.2

name	Scgb1c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258264 GeneID:338417 MGI:2655401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins product : secretoglobin, family 1C, member 1 transcript_id : XM_001480591.1

name	Odf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353814 GeneID:69287 MGI:1916537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 3 transcript_id : NM_027019.2

name	Bet1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344115 GeneID:54399 MGI:1913128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : blocked early in transport 1 homolog (S. cerevisiae)-like transcript_id : NM_018742.4

name	Ric8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131149 GeneID:101489 MGI:2141866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : resistance to inhibitors of cholinesterase 8 homolog (C. elegans) transcript_id : NM_053194.4

name	Sirt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967962 GeneID:64384 MGI:1927665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) transcript_id : NM_022433.1

name	Psmd13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366730 GeneID:23997 MGI:1345192
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 transcript_id : NM_011875.3

name	LOC100043546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258266 GeneID:100043546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 574 ESTs, 8 Proteins product : similar to DnaJ-like protein transcript_id : XM_001480612.1

name	Cox8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921592 GeneID:12869 MGI:105958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIIb transcript_id : NM_007751.2

name	Bnip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753198 GeneID:12176 MGI:109326
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0030425 - dendrite [Evidence ISS]; GO:0031307 - integral to mitochondrial outer membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0031966 - mitochondrial membrane [Evidence IDA] [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006915 - apoptosis [Evidence ISS]; GO:0008219 - cell death [Evidence ISS]; GO:0006338 - chromatin remodeling [Evidence ISS]; GO:0051607 - defense response to virus [Evidence ISS]; GO:0006309 - DNA fragmentation during apoptosis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0045837 - negative regulation of membrane potential [Evidence ISS]; GO:0008634 - negative regulation of survival gene product activity [Evidence ISS]; GO:0051402 - neuron apoptosis [Evidence ISS]; GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence ISS]; GO:0043065 - positive regulation of apoptosis [Evidence IEA]; GO:0046902 - regulation of mitochondrial membrane permeability [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : BCL2/adenovirus E1B 19 kDa-interacting protein 1, NIP3 product : BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP3 protein_id : NP_033890.1

name	LOC669185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257751 GeneID:669185
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479962.1

name	6330417G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257754 GeneID:74004 MGI:1921254
definition	codon_start : 1 product : hypothetical protein LOC74004 protein_id : XP_355952.4

name	Dpysl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328211 CCDS:CCDS21951.1 GeneID:26757 MGI:1349764
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : unc-33-like phosphoprotein 4 product : dihydropyrimidinase-related protein 4 protein_id : NP_036123.2

name	Stk32c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946600 CCDS:CCDS21952.1 GeneID:57740 MGI:2385336
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PKE protein kinase product : serine/threonine kinase 32C protein_id : NP_067277.1

name	LOC100038956 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258247 GeneID:100038956
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472026.1

name	Lrrc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60650308 CCDS:CCDS21953.1 GeneID:76612 MGI:1923862
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 27 protein_id : NP_081440.1

name	Pwwp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701712 GeneID:101631 MGI:2142008
definition	codon_start : 1 product : PWWP domain containing 2 protein_id : NP_001028378.1

name	Inpp5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147161 CCDS:CCDS21954.1 GeneID:212111 MGI:2686961
definition	GO_component : GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence ISS] GO_process : GO:0046855 - inositol phosphate dephosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : inositol polyphosphate-5-phosphatase A protein_id : NP_898967.1

name	Nkx6-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443675 GeneID:14912 MGI:1352738
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IGI]; GO:0031018 - endocrine pancreas development [Evidence IGI]; GO:0045686 - negative regulation of glial cell differentiation [Evidence IGI]; GO:0045687 - positive regulation of glial cell differentiation [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Drosophila NK transcription factor related, gene family 6, locus 2; glial and testis specific homeobox product : NK6 transcription factor related, locus 2 protein_id : NP_899071.2

name	E030019B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381441 GeneID:212124 MGI:2685016
definition	codon_start : 1 product : similar to Chromosome 10 open reading frame 92 protein_id : XP_133957.6

name	9330101J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258249 GeneID:664857 MGI:2444387
definition	codon_start : 1 product : hypothetical protein LOC320625 protein_id : XP_001472215.1

name	LOC100043472 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258261 GeneID:100043472
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480523.1

name	EG664869 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381446 GeneID:664869 MGI:3646626
definition	codon_start : 1 product : similar to ribosomal protein L24 protein_id : XP_978249.1

name	Gpr123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446130 GeneID:52389 MGI:1277167
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 123 protein_id : NP_803420.2

name	Kndc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482625 GeneID:76484 MGI:1923734
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : kinase non-catalytic C-lobe domain (KIND) containing 1 protein_id : NP_796235.3

name	Utf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678525 CCDS:CCDS21958.1 GeneID:22286 MGI:1276125
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : undifferentiated embryonic cell transcription factor 1 protein_id : NP_033508.1

name	LOC100039095 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258252 GeneID:100039095
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472300.1

name	6430531B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701983 GeneID:381933 MGI:2685939
definition	codon_start : 1 product : hypothetical protein LOC381933 protein_id : NP_001028637.1

name	Adam8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680642 CCDS:CCDS21959.1 GeneID:11501 MGI:107825
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IDA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016337 - cell-cell adhesion [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : a disintegrin and metalloprotease domain (ADAM) 8 product : a disintegrin and metalloprotease domain 8 protein_id : NP_031429.1

name	Tubgcp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526968 CCDS:CCDS21960.1 GeneID:74237 MGI:1921487
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IEA]; GO:0000922 - spindle pole [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tubulin, gamma complex associated protein 2 protein_id : NP_598516.1

name	Zfp511 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258263 GeneID:69752 MGI:1917002
definition	codon_start : 1 product : zinc finger protein 511 protein_id : XP_892242.2

name	Msx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754756 CCDS:CCDS21961.1 GeneID:17703 MGI:106587
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box, msh-like 3 protein_id : NP_034966.1

name	Drd1ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229075 CCDS:CCDS21962.1 GeneID:68566 MGI:1915816
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050780 - dopamine receptor binding [Evidence IEA] GO_process : GO:0007212 - dopamine receptor signaling pathway [Evidence IEA] codon_start : 1 note : D1 dopamine receptor-interacting protein; calcyon; D1 dopamine receptor-interacting protein product : calcyon protein protein_id : NP_081045.2

name	Prap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678511 CCDS:CCDS21963.1 GeneID:22264 MGI:893573
definition	codon_start : 1 exception : mismatches in translation note : uterine-specific proline-rich acidic protein product : proline-rich acidic protein 1 protein_id : NP_033501.1

name	1810014F10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124377998 GeneID:69064 MGI:1916314
definition	GO_function : GO:0042806 - fucose binding [Evidence ISS] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69064 protein_id : NP_081204.2

name	Echs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789289 CCDS:CCDS21964.1 GeneID:93747 MGI:2136460
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : enoyl Coenzyme A hydratase, short chain, 1, mitochondrial protein_id : NP_444349.1

name	Paox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28173566 CCDS:CCDS21965.1 GeneID:212503 MGI:1916983
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0046592 - polyamine oxidase activity [Evidence ISS] [Evidence IDA] GO_process : GO:0006598 - polyamine catabolism [Evidence ISS] [Evidence IDA] codon_start : 1 note : exo-N4-amino product : peroxisomal N1-acetyl-spermine/spermidine oxidase protein_id : NP_722478.2

name	Mtg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556274 GeneID:212508 MGI:2685015
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : GTP binding protein 7 (putative) protein_id : NP_955005.1

name	Sprn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147163 CCDS:CCDS21966.1 GeneID:212518 MGI:3582583
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Shadoo product : shadow of prion protein protein_id : NP_898970.1

name	Olfr522 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129013 CCDS:CCDS21967.1 GeneID:258954 MGI:3030356
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42315125-42314187; olfactory receptor MOR103-5 product : olfactory receptor 522 protein_id : NP_667163.1

name	Olfr523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239354 CCDS:CCDS21968.1 GeneID:258511 MGI:3030357
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42327937-42328872; olfactory receptor MOR104-4; odorant receptor product : olfactory receptor 523 protein_id : NP_666729.1

name	Olfr524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801394 CCDS:CCDS21969.1 GeneID:258055 MGI:3030358
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42354580-42353624; olfactory receptor MOR103-14P product : olfactory receptor 524 protein_id : NP_001011814.1

name	E430002D04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064872 GeneID:244233 MGI:2443796
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 product : scavenger receptor cysteine-rich type 1 protein CD163c-alpha protein_id : NP_766497.3

name	5830411N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425310 CCDS:CCDS21970.1 GeneID:244234 MGI:2443685
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 note : mFLJ00268 protein product : scavenger receptor protein family member protein_id : NP_780742.1

name	EG622335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915954 GeneID:622335 MGI:3646082
definition	codon_start : 1 product : similar to 3110003A17Rik protein protein_id : XP_891864.1

name	Olfr525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227555 CCDS:CCDS21971.1 GeneID:258958 MGI:3030359
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42472898-42473827; olfactory receptor MOR251-2 product : olfactory receptor 525 protein_id : NP_667167.1

name	Olfr527 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801328 CCDS:CCDS21972.1 GeneID:257939 MGI:3030361
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42486061-42486978; olfactory receptor MOR251-5 product : olfactory receptor 527 protein_id : NP_001011776.1

name	Olfr60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203809 CCDS:CCDS21973.1 GeneID:18361 MGI:1333881
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-6; GA_x6K02T2PBJ9-42496183-42495251 product : olfactory receptor 60 protein_id : NP_667166.1

name	Olfr530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238964 CCDS:CCDS21974.1 GeneID:258512 MGI:3030364
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42523824-42522901; olfactory receptor MOR252-2 product : olfactory receptor 530 protein_id : NP_666730.1

name	Olfr531 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129015 CCDS:CCDS21975.1 GeneID:258955 MGI:3030365
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42551260-42550346; olfactory receptor MOR251-3 product : olfactory receptor 531 protein_id : NP_667164.1

name	Olfr532 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227415 CCDS:CCDS21976.1 GeneID:259028 MGI:3030366
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42570051-42569122; olfactory receptor MOR251-1 product : olfactory receptor 532 protein_id : NP_667237.1

name	Olfr533 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801396 CCDS:CCDS21977.1 GeneID:258056 MGI:3030367
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42615403-42616365; olfactory receptor MOR252-3P product : olfactory receptor 533 protein_id : NP_001011815.1

name	Olfr535 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129009 CCDS:CCDS21978.1 GeneID:258956 MGI:3030369
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42641642-42642574; olfactory receptor MOR253-7 product : olfactory receptor 535 protein_id : NP_667165.1

name	Olfr536 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238970 CCDS:CCDS21979.1 GeneID:258513 MGI:3030370
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42653501-42652578; olfactory receptor MOR252-1 product : olfactory receptor 536 protein_id : NP_666731.1

name	Olfr538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801488 CCDS:CCDS21980.1 GeneID:258201 MGI:3030372
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42723314-42724246; olfactory receptor MOR253-10P product : olfactory receptor 538 protein_id : NP_001011867.1

name	Olfr46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203807 CCDS:CCDS21981.1 GeneID:18345 MGI:1333824
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-8; GA_x6K02T2PBJ9-42759973-42760905 product : olfactory receptor 46 protein_id : NP_667145.1

name	Olfr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203811 GeneID:18362 MGI:1333885
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-1; GA_x6K02T2PBJ9-42783826-42784758 product : olfactory receptor 61 protein_id : NP_667175.1

name	Olfr53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129007 GeneID:258962 MGI:1333749
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-5; GA_x6K02T2PBJ9-42798103-42799038 product : olfactory receptor 53 protein_id : NP_667171.1

name	Olfr539 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129001 CCDS:CCDS21982.1 GeneID:258963 MGI:3030373
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42813436-42814368; olfactory receptor MOR253-4 product : olfactory receptor 539 protein_id : NP_667172.1

name	Olfr45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203817 CCDS:CCDS21983.1 GeneID:18344 MGI:1333826
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-2; GA_x6K02T2PBJ9-42837030-42837962 product : olfactory receptor 45 protein_id : NP_667174.1

name	Olfr541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129003 CCDS:CCDS21984.1 GeneID:258964 MGI:3030375
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42850324-42851256; olfactory receptor MOR253-3 product : olfactory receptor 541 protein_id : NP_667173.1

name	Cyp2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11276065 CCDS:CCDS21985.1 GeneID:13106 MGI:88607
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2e1, ethanol inducible product : cytochrome P450, family 2, subfamily e, polypeptide 1 protein_id : NP_067257.1

name	Syce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258254 GeneID:74075 MGI:1921325
definition	codon_start : 1 product : synaptonemal complex central element protein 1 protein_id : XP_001472936.1

name	BC066028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142383655 GeneID:407812 MGI:3039601
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC407812 protein_id : NP_001001180.2

name	1190003J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626070 CCDS:CCDS21986.1 GeneID:76974 MGI:1916142
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0019841 - retinol binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006590 - thyroid hormone generation [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : HIU hydrolase protein_id : NP_084097.1

name	Scgb1c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258265 GeneID:338417 MGI:2655401
definition	codon_start : 1 product : similar to RYD5 protein_id : XP_001480641.1

name	Odf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16756270 GeneID:69287 MGI:1916537
definition	GO_component : GO:0001520 - outer dense fiber [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : shippo 1 protein_id : NP_081295.1

name	Bet1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542224 CCDS:CCDS21987.1 GeneID:54399 MGI:1913128
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005484 - SNAP receptor activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : soluble N-ethylmaleimide-sensitive factor attachment protein (SNARE) 15; golgi SNARE product : golgi SNARE, 15 kD protein_id : NP_061212.2

name	Ric8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716495 CCDS:CCDS21988.1 GeneID:101489 MGI:2141866
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0001965 - G-protein alpha-subunit binding [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence ISS] codon_start : 1 product : synembryn protein_id : NP_444424.1

name	Sirt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967963 CCDS:CCDS21989.1 GeneID:64384 MGI:1927665
definition	GO_component : GO:0005677 - chromatin silencing complex [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006342 - chromatin silencing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : silent mating type information regulation 2, (S.cerevisiae, homolog)-like 3 product : sirtuin 3 (silent mating type information regulation 2, homolog) 3 protein_id : NP_071878.1

name	Psmd13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755210 CCDS:CCDS21990.1 GeneID:23997 MGI:1345192
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005838 - proteasome regulatory particle (sensu Eukaryota) [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence ISS] GO_process : GO:0007127 - meiosis I [Evidence IMP] codon_start : 1 note : 26S proteasome subunit p40.5 product : proteasome 26S non-ATPase subunit 13 protein_id : NP_036005.1

name	LOC100043546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258267 GeneID:100043546
definition	codon_start : 1 product : similar to DnaJ-like protein protein_id : XP_001480662.1

name	Cox8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680995 CCDS:CCDS21991.1 GeneID:12869 MGI:105958
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : COX VIII-H product : cytochrome c oxidase, subunit VIIIb protein_id : NP_031777.1

name	EG668784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668784
definition	number : 1 pseudo : _no_value

name	LOC622973 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622973
definition	number : 2 pseudo : _no_value

name	LOC622973 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622973
definition	number : 1 pseudo : _no_value

name	LOC100043529 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043529
definition	number : 1 pseudo : _no_value

name	LOC244229 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258250 GeneID:244229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 5 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_030607.1

clone name	MSMg01-393B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-209P18.b	B6Ng01-209P18.g
ACC	GA028447	GA028448
length	1,163	775
definition	B6Ng01-209P18.b	B6Ng01-209P18.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccaagcccatggtctgctgaaggactttctaggatgttatatcct gtcctatgctaagactactacttctaagacatcttttgcctccaaatttt tatctatataatatgttgctctgacaaagctatggaaatattcctatgct tatcattaacaaaatgggcagtatgtagctgctgatctaaagctatggta gatacctttttaaagtttgtattctcagatttttaaaaccaaggatcatt ttctaactctaataggcagcaaaacataagcaggtctcttacaaaaacat aacagtagattccttatctaaattaggatctacacaattagttaattgac aagaattacaatgaatataaaaagacttgccaagattggcgatcttaact cttaaaattatctaacaataagcatataggtaaggtacacaaactttcat agctataaggagctggcctgaatggccaaaaacagtgtctatgacaaaag catcttgtacattctctgtaccagtcagcttttttagttgtttgtatttt aagttggcaccaggttggtactccttgctgcagcccatggtggagatacg aagtttctttatctgtttgtaagtggctgctctcccatttctcctctttt gtccactcaacacagctttctggtcaccactgtcagggcactcacaggtc acaggtcagcctgtcacattggaagctagcatgctcttgttgcattctgt ggaaaaaaacagaaacattcccccttttctccatattaagtatctgaaca ggatcatggcatgtgccaataagtggatcctttttatctgccctagacat tatatctagtttttttgtatttaaataaaaatgtgacttaaataatgtgc acagggatataatttccccccttctgtttttaagttttacagtaccttgt ctttgagattataaaatatctcagtaacatgtgtaacattaaatttgttg acaaaacatctcaaatctttgggctgtatagccagtttttaaatttgatt agaccacagcagcaaaaaaaaaaaatccaaccagggcatgactactatta cttaagttgctttttcctggtaagtggttgtaattgaacaggacactaaa acggggtactcaa	gaattcacttactgcaaagtcaaatcagatggcttctctgcctcaccaat gacctgtgggaggaaccagaaaagggtatgcatggccaccacccttaaga aacacctctgggggggggcggagagatagctcagtggttaaaagcccttg ctgctcttggagagcacccaagttgggttcccagcatccacatagtggtt caaaccatccttaactcgtttcaagggatcccatgccagctgctgtcctc tgattgaaagagtttctctgttttatttgaaatagggtctgactgcattg tccaagtgtcttagttaggattacgattgctatgatgaaacaccataacc aaagcaacttgaggaggaaaagatttgtctgacttacactttcacgtcat ggtccatcgctggaggaagtcgggacaggaaagaacctggatgcaggagc tgatgcagaggccatggagggtgcttcttattggcttgctctttatggct ttcctcggcctggttccttatagaacacaaacacactgtcccagagatgg caccagctacgatgggctggggcctcccccatcaatcactaattaaagaa actgccaagagccagatcttatggaagcatttttctcaatggcagttccc tctttctcagataacttcagcttgcgccgagtcactgaccattctctcta gtcttcacatctaagtccttcatagaatctgttttctttgtgttactaga ctgtgggttgacaaccaaagttgta
quality values	Open. Hide. 54 29 35 39 54 43 36 10 42 58 58 62 47 38 62 62 62 62 62 62 49 62 62 46 62 62 62 37 35 41 62 62 11 16 10 10 11 20 19 19 28 28 28 32 45 45 44 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 40 59 51 38 38 34 48 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 46 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 54 58 58 58 58 54 58 58 54 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 50 45 54 58 58 58 58 58 58 58 58 58 58 42 54 49 58 58 52 58 54 42 58 58 49 53 58 58 58 51 58 58 58 46 39 58 58 58 52 52 58 58 54 58 58 49 58 58 58 54 58 58 53 58 51 50 58 58 46 58 52 54 58 52 58 51 58 58 58 58 46 46 39 32 53 54 58 37 58 54 49 58 53 51 58 58 58 52 49 52 58 58 40 53 52 46 41 33 54 58 58 47 53 50 28 29 49 47 50 42 44 39 39 51 41 43 58 41 51 47 49 37 35 49 40 58 50 42 51 54 41 51 35 50 37 44 25 51 49 54 53 58 39 39 53 39 42 40 49 35 53 54 40 53 53 37 54 51 28 42 45 37 42 51 49 47 49 54 40 54 49 49 54 54 54 54 54 40 39 39 39 54 51 32 41 37 53 42 26 54 54 54 33 26 54 54 46 53 52 45 53 30 45 37 16 9 18 33 37 40 41 33 45 53 53 35 33 47 24 11 49 28 29 43 40 35 46 52 39 27 33 52 32 32 47 34 24 28 24 12 28 18 36 41 33 30 26 21 46 21 52 53 53 45 32 28 32 34 35 26 51 45 31 42 16 33 34 35 31 45 31 31 32 36 31 31 41 32 29 51 51 51 51 51 26 41 25 29 33 51 32 31 51 29 31 31 51 46 41 21 31 31 28 31 30 22 29 28 31 46 44 18 12 11 9 24 18 31 31 25 31 23 34 46 31 23 24 22 27 28 21 22 46 6 8 41 41 41 41 19 10 21 24 14 34 33 48 31 31 12 19 29 23 9 48 46 27 26 31 30 32 21 21 11 18 25 14 41 29 9 6 46 44 19 32 15 43 15 29 29 37 32 48 44 11 19 31 31 32 38 14 14 21 16 33 28 36 19 31 28 20 23 22 32 27 21 17 27 30 27 38 25 10 38 9 8 43 7 16 27 8 6 18 19 8 10 6 15 31 21 24 13 39 28 6 4 7 32 38 10 37 21 22 13 19 26 28 7 15 23 33 37 32 28 11 39 48 34 28 12 36 9 31 40 27 20 13 8 34 11 14 15 8 10 17 13 13 8 18 40 5 8 7 10 30 19 9 3 6 10 7 12 23 11 3 3 5 10 11 9 3 3 5 16 6 17 30 6 11 14 27 25 17 15 11 9 4 4 4 3 5 3 6 9 3 6 9 6 14 11 17 25 8 5 5 6 7 7 6 5 2 12 10 6 1 1 3 13 6 4 2 4 6 7 4 6 10 4 11 5 6 16 6 4 5 7 6 22 9 14 4 6 4 8 16 21 21 6 10 8 5 9	Open. Hide. 62 59 39 59 62 44 34 59 62 62 62 62 62 30 22 11 10 13 13 23 12 13 48 45 50 38 23 30 54 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 59 50 48 42 31 43 35 48 59 59 46 45 54 56 62 62 62 54 54 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 54 62 59 49 59 49 59 59 62 59 62 62 62 59 49 59 62 59 59 59 59 56 59 62 62 62 62 62 59 59 62 56 59 59 59 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 59 59 56 50 56 54 46 49 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 59 59 62 62 62 59 54 62 62 62 59 59 62 62 62 59 62 62 62 59 49 46 56 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 43 59 56 50 59 56 62 59 59 62 62 56 51 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 59 48 62 59 62 62 62 59 62 62 62 62 62 51 59 56 50 56 49 62 62 56 59 59 56 59 59 62 62 51 51 49 46 56 59 62 59 59 62 62 62 62 59 62 54 46 59 59 49 62 59 59 62 62 62 62 59 62 62 59 62 62 34 40 34 27 31 48 51 50 35 50 35 56 56 56 59 62 62 62 62 62 59 62 62 59 59 62 62 62 59 51 59 59 51 49 32 24 18 27 27 32 38 34 46 59 62 59 44 39 56 50 44 51 51 46 23 43 43 45 34 23 28 56 46 45 51 59 56 62 59 62 62 59 50 62 51 59 44 59 43 56 59 62 59 62 62 59 51 62 59 56 44 62 62 56 47 47 62 62 56 56 47 47 62 56 62 62 47 56 44 44 62 62 62 39 51 56 20 47 54 47 56 51 56 51 39 42 42 21 23 26 42 56 51 56 56 56 56 42 33 26 20 22 26 24 30 38 39 30 42 31 38 38 56 56 50 56 31 22 35 25 26 41 38 56 56 38 50 42 43 32 27 34 42 42 43 46 62 42 52 42 43 47 50 43 38 43 43 35 40 43 42 33 22 28 29 20 41 23 14 31 32 24 18 22 21 17 21 21 17 9 32 21 23 46 22 17 27 32 52 32 34 29 24 13 33 18 9 16 16 15 37 31 42 35 35 31 39 52 24 52 43 35 52 24 26 58 54 58 27 52 39 39 30 22 33 47 42 16 24 19 10 26 36 29 29 37 38 13 46 46 42 32 46 32 29 38 33 19 20 27 24 23 34 9 15 31 46 50 41 23 14 32 30 13 41 5 22 29 22 32 40 41 17 14 13 22 46 49 51 42 51 36 50 39 22 26 29 50 50 37 39 30 36 28 46 32 23 11 14 15 12 28 18 9 28 23 6 6 21 26 32 38 26 24 24 27 34 31 50 33 52 8 30 39 14 6 39 28 32 40 49 24 19 15 33 18 14 34 28 11 32 21 21 33 33 24 21 39 14 41 52 38 17 21 13 10 13 21 8 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_147088191_147088961
seq2: B6Ng01-209P18.g_67_841

seq1  GAATTCACTTACTGCAAAGTCAAATCAGATGGCTTCTCTGCCTCACCAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTACTGCAAAGTCAAATCAGATGGCTTCTCTGCCTCACCAAT  50

seq1  GACCTGTGGGAGGAACCAGAAAAGGGTATGCATGGCCACCACCCTTAAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTGTGGGAGGAACCAGAAAAGGGTATGCATGGCCACCACCCTTAAGA  100

seq1  AACACCTCTGGGGGGGGGCGGAGAGATAGCTCAGTGGTTAAAAGCCCTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACCTCTGGGGGGGGGCGGAGAGATAGCTCAGTGGTTAAAAGCCCTTG  150

seq1  CTGCTCTTGGAGAGCACCCAAGTTGGGTTCCCAGCATCCACATAGTGGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCTTGGAGAGCACCCAAGTTGGGTTCCCAGCATCCACATAGTGGTT  200

seq1  CAAACCATCCTTAACTCGTTTCAAGGGATCCCATGCCAGCTGCTGTCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACCATCCTTAACTCGTTTCAAGGGATCCCATGCCAGCTGCTGTCCTC  250

seq1  TGATTGAAAGAGTTTCTCTGTTTTATTTGAAATAGGGTCTGACTGCATTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGAAAGAGTTTCTCTGTTTTATTTGAAATAGGGTCTGACTGCATTG  300

seq1  TCCAAGTGTCTTAGTTAGGATTACGATTGCTATGATGAAACACCATAACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGTGTCTTAGTTAGGATTACGATTGCTATGATGAAACACCATAACC  350

seq1  AAAGCAACTTGAGGAGGAAAAGATTTGTCTGACTTACACTTTCACGTCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCAACTTGAGGAGGAAAAGATTTGTCTGACTTACACTTTCACGTCAT  400

seq1  GGTCCATCGCTGGAGGAAGTCGGGACAGGAAAGAACCTGGATGCAGGAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCATCGCTGGAGGAAGTCGGGACAGGAAAGAACCTGGATGCAGGAGC  450

seq1  TGATGCAGAGGCCATGGAGGGTGCTTCTTATTGGCTTGCTCTTTATGGC-  499
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TGATGCAGAGGCCATGGAGGGTGCTTCTTATTGGCTTGCTCTTTATGGCT  500

seq1  TTCCTCGGCCTGGTTCCTTATAGAACACAAACACACTGTCCCAGAGATGG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCGGCCTGGTTCCTTATAGAACACAAACACACTGTCCCAGAGATGG  550

seq1  CACCAGCTACGATGGGCTGGGGCCTCCCCCATCAATCACTAATT-AAGAA  598
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  CACCAGCTACGATGGGCTGGGGCCTCCCCCATCAATCACTAATTAAAGAA  600

seq1  ACTGCCAAGAGCCAGATCTTATGGAAGCA-TTTTCTCAATGGCAGTTCCC  647
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  ACTGCCAAGAGCCAGATCTTATGGAAGCATTTTTCTCAATGGCAGTTCCC  650

seq1  TC-TTCTCAGATAACTTCAGCTTGCGCCGAGTTCACTGA-CATTCTCTCT  695
      || |||||||||||||||||||||||||||| ||||||| ||||||||||
seq2  TCTTTCTCAGATAACTTCAGCTTGCGCCGAG-TCACTGACCATTCTCTCT  699

seq1  AGTCTTCACATCT-AGTCCTTCAGAGAATCTGTTTTCCTTGGTGTTACTA  744
      ||||||||||||| ||||||||| |||||||||||| ||| |||||||||
seq2  AGTCTTCACATCTAAGTCCTTCATAGAATCTGTTTT-CTTTGTGTTACTA  748

seq1  GACTGT-GGTTGACAAACCAAAGTTGTA  771
      |||||| ||||||| |||||||||||||
seq2  GACTGTGGGTTGAC-AACCAAAGTTGTA  775

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information