MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-210B03
Chromosome	7 (Build37)
Map Location	21,336,738 - 21,337,278
singlet/doublet	singlet
Overlap gene	LOC100043559
Upstream gene	Bcam, Cblc, Bcl3, Ceacam16, Ceacam19, Pvr, 2210010C17Rik, EG243872, Ceacam20, Nlrp9b, EG667040, EG667067, LOC620401, V1rd21, EG620537, LOC100043519, EG620574, LOC100043523, EG545926, LOC100043528, LOC100042964, LOC100042966, LOC100043533, EG435949, LOC100043536, LOC100042968, LOC100042971, EG667129, EG667135, EG435946, LOC100042976, LOC100043550, LOC667156, LOC673977, LOC667166, LOC100042980, EG381936
Downstream gene	LOC667311, LOC100043561, LOC667302, EG667292, LOC100043566, LOC100043569, EG436135, LOC100042996, EG667273, EG667268, EG667262, EG667259, LOC100043574, LOC100043576, Gm1447, LOC100043006, LOC100043583, EG435953, LOC673902, EG667240, EG435951, Gm1446, LOC381937, LOC100043588, LOC670764, EG667215, LOC100043013, LOC621561, EG667199, EG621510, LOC667186, EG628475, LOC100043595, LOC100043596, LOC667358, LOC100043016
Link	Open Mouse BAC browser

Click to get alignment info.

name	Bcam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57278 MGI:1929940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cblc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80794 MGI:1931457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12051 MGI:88140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330483 MGI:2685615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319930 MGI:2443001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52118 MGI:107741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210010C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70080 MGI:1917330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243872 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243872 MGI:3644288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 476 ESTs, 12 Proteins

name	Ceacam20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71601 MGI:1918851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243874 MGI:2675377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667040 MGI:3645816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 8 Proteins pseudo : _no_value

name	EG667067 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667067 MGI:3649070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC620401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	V1rd21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404290 MGI:3033490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620537 MGI:3647287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG620574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620574 MGI:3647652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043523 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG545926 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545926 MGI:3649012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 46 Proteins

name	LOC100043528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs

name	EG435949 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435949 MGI:3644398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 33 Proteins

name	LOC100042968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667129 MGI:3647681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	EG667135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667135 MGI:3644682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	EG435946 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435946 MGI:3644395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100042976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	LOC100043550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins pseudo : _no_value

name	LOC667156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC673977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100042980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	EG381936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381936 MGI:3648210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 34 Proteins

name	LOC667311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	EG667292 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667292 MGI:3645811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC100043566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins

name	LOC100043569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 32 Proteins

name	EG436135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436135 MGI:3647303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100042996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667273 MGI:3645605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	EG667268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667268 MGI:3648873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 Proteins

name	EG667262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667262 MGI:3648880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG667259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667259 MGI:3645425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 Proteins

name	LOC100043574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 40 Proteins pseudo : _no_value

name	LOC100043576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gm1447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384696 MGI:2686293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs

name	EG435953 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435953 MGI:3647340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	LOC673902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	EG667240 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667240 MGI:3648662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 32 Proteins

name	EG435951 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435951 MGI:3647341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gm1446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384695 MGI:2686292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins

name	LOC381937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 91 Proteins pseudo : _no_value

name	LOC100043588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC670764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 Proteins

name	EG667215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667215 MGI:3704112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 31 Proteins

name	LOC100043013 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC621561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins

name	EG667199 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667199 MGI:3643535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	EG621510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621510 MGI:3645471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	LOC667186 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	EG628475 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628475 MGI:3645601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 53 Proteins

name	LOC100043595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667358 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100043016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	Bcam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226187 GeneID:57278 MGI:1929940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basal cell adhesion molecule transcript_id : NM_020486.2

name	Cblc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802419 GeneID:80794 MGI:1931457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Casitas B-lineage lymphoma c transcript_id : NM_023224.4

name	Bcl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809013 GeneID:12051 MGI:88140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 3 transcript_id : NM_033601.1

name	Ceacam16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432549 GeneID:330483 MGI:2685615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 16 transcript_id : NM_001033419.2

name	Ceacam19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369101 GeneID:319930 MGI:2443001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 19 transcript_id : NM_177036.3

name	Pvr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076964 GeneID:52118 MGI:107741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poliovirus receptor transcript_id : NM_027514.1

name	2210010C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387586 GeneID:70080 MGI:1917330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010C17 gene transcript_id : NM_027308.2

name	EG243872 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256570 GeneID:243872 MGI:3644288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 476 ESTs, 12 Proteins product : predicted gene, EG243872 transcript_id : XM_620604.4

name	Ceacam20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037244 GeneID:71601 MGI:1918851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 20 transcript_id : NM_027839.1

name	Nlrp9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52145306 GeneID:243874 MGI:2675377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9B transcript_id : NM_194058.2

name	EG667067 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256571 GeneID:667067 MGI:3649070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667067 transcript_id : XM_988064.2

name	LOC620401 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256331 GeneID:620401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479154.1

name	V1rd21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430553 GeneID:404290 MGI:3033490
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D21 transcript_id : NM_207547.1

name	EG620537 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256333 GeneID:620537 MGI:3647287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG620537 transcript_id : XM_884930.2

name	LOC100043519 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256573 GeneID:100043519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100043519 transcript_id : XM_001480485.1

name	EG620574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256335 GeneID:620574 MGI:3647652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG620574 transcript_id : XM_884970.2

name	LOC100043523 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256575 GeneID:100043523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480490.1

name	EG545926 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256577 GeneID:545926 MGI:3649012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 46 Proteins product : predicted gene, EG545926, transcript variant 1 transcript_id : XM_620430.4

name	LOC100042964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256337 GeneID:100042964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479189.1

name	LOC100043533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256579 GeneID:100043533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs product : hypothetical protein LOC100043533 transcript_id : XM_001480503.1

name	EG435949 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762806 GeneID:435949 MGI:3644398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG435949 transcript_id : XM_487999.1

name	LOC100043536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256583 GeneID:100043536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 32 Proteins product : similar to pheromone receptor V3R8, transcript variant 2 transcript_id : XM_001480508.1

name	LOC100043536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256581 GeneID:100043536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8, transcript variant 1 transcript_id : XM_001480507.1

name	LOC100042968 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256339 GeneID:100042968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479203.1

name	LOC100042971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256341 GeneID:100042971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to LOC434138 protein transcript_id : XM_001479209.1

name	EG667129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379539 GeneID:667129 MGI:3647681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : predicted gene, EG667129 transcript_id : XM_988523.1

name	EG667135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379541 GeneID:667135 MGI:3644682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG667135 transcript_id : XM_988561.1

name	EG435946 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762800 GeneID:435946 MGI:3644395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG435946 transcript_id : XM_487996.1

name	LOC100042976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256344 GeneID:100042976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479224.1

name	LOC673977 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256587 GeneID:673977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480525.1

name	LOC100042980 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256347 GeneID:100042980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479235.1

name	EG381936 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383440 GeneID:381936 MGI:3648210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG381936 transcript_id : NM_001037248.2

name	LOC100043559 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256589 GeneID:100043559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : similar to pheromone receptor V3R8, transcript variant 2 transcript_id : XM_001480537.1

name	LOC100043559 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256591 GeneID:100043559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : similar to pheromone receptor V3R8, transcript variant 1 transcript_id : XM_001480534.1

name	LOC100043561 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256593 GeneID:100043561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480541.1

name	EG667292 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256352 GeneID:667292 MGI:3645811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : predicted gene, EG667292 transcript_id : XM_989581.2

name	LOC100043566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256595 GeneID:100043566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins product : hypothetical protein LOC100043566 transcript_id : XM_001480544.1

name	LOC100043569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256599 GeneID:100043569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 Proteins product : similar to pheromone receptor V3R8, transcript variant 2 transcript_id : XM_001480551.1

name	LOC100043569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256597 GeneID:100043569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8, transcript variant 1 transcript_id : XM_001480547.1

name	EG436135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256354 GeneID:436135 MGI:3647303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG436135 transcript_id : XM_488252.2

name	LOC100042996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256356 GeneID:100042996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479259.1

name	EG667273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256359 GeneID:667273 MGI:3645605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : predicted gene, EG667273 transcript_id : XM_989470.2

name	EG667268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379941 GeneID:667268 MGI:3648873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 Proteins product : predicted gene, EG667268 transcript_id : XM_989436.1

name	EG667262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379939 GeneID:667262 MGI:3648880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667262 transcript_id : XM_989397.1

name	EG667259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256361 GeneID:667259 MGI:3645425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 Proteins product : predicted gene, EG667259 transcript_id : XM_989373.2

name	Gm1447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256363 GeneID:384696 MGI:2686293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : gene model 1447, (NCBI) transcript_id : XM_001479279.1

name	LOC100043583 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256602 GeneID:100043583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs product : hypothetical protein LOC100043583 transcript_id : XM_001480571.1

name	EG435953 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762814 GeneID:435953 MGI:3647340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG435953 transcript_id : XM_488003.1

name	LOC673902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256366 GeneID:673902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479294.1

name	EG667240 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256604 GeneID:667240 MGI:3648662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 32 Proteins product : predicted gene, EG667240 transcript_id : XM_989224.2

name	EG435951 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256368 GeneID:435951 MGI:3647341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG435951 transcript_id : XM_488001.2

name	Gm1446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256370 GeneID:384695 MGI:2686292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins product : gene model 1446, (NCBI) transcript_id : XM_357796.4

name	LOC670764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256372 GeneID:670764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479309.1

name	EG667215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379929 GeneID:667215 MGI:3704112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 Proteins product : predicted gene, EG667215, transcript variant 2 transcript_id : XM_989080.1

name	EG667215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256607 GeneID:667215 MGI:3704112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667215, transcript variant 1 transcript_id : XM_001480583.1

name	LOC100043013 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256375 GeneID:100043013
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479313.1

name	LOC621561 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82904558 GeneID:621561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_885964.1

name	EG667199 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379927 GeneID:667199 MGI:3643535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins product : predicted gene, EG667199 transcript_id : XM_988960.1

name	EG621510 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82904554 GeneID:621510 MGI:3645471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG621510 transcript_id : XM_885914.1

name	EG628475 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256609 GeneID:628475 MGI:3645601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 53 Proteins product : predicted gene, EG628475, transcript variant 3 transcript_id : XM_993201.2

name	LOC100043596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256612 GeneID:100043596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480600.1

name	LOC100043016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256379 GeneID:100043016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479329.1

name	Bcam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048460 GeneID:57278 MGI:1929940
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005055 - laminin receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 note : lutheran glycoprotein; Lutheran blood group; Auberger b antigen product : basal cell adhesion molecule protein_id : NP_065232.1

name	Cblc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981243 GeneID:80794 MGI:1931457
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation product : Casitas B-lineage lymphoma c protein_id : NP_075713.2

name	Bcl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809014 CCDS:CCDS20914.1 GeneID:12051 MGI:88140
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : B-cell leukemia/lymphoma 3 protein_id : NP_291079.1

name	Ceacam16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432550 GeneID:330483 MGI:2685615
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CEA-related cell adhesion molecule 16 protein_id : NP_001028591.2

name	Ceacam19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892919 CCDS:CCDS20915.1 GeneID:319930 MGI:2443001
definition	codon_start : 1 product : carcinoembryonic antigen-like 1 protein_id : NP_796010.1

name	Pvr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076965 CCDS:CCDS20916.1 GeneID:52118 MGI:107741
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0016477 - cell migration [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence IDA] codon_start : 1 note : tumor-associated antigen 1 product : poliovirus receptor protein_id : NP_081790.1

name	2210010C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625759 GeneID:70080 MGI:1917330
definition	codon_start : 1 product : hypothetical protein LOC70080 protein_id : NP_081584.1

name	EG243872 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904025 GeneID:243872 MGI:3644288
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620604.2

name	Ceacam20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037245 CCDS:CCDS20919.1 GeneID:71601 MGI:1918851
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CEA-related cell adhesion molecule 20 protein_id : NP_082115.1

name	Nlrp9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52145307 CCDS:CCDS20920.1 GeneID:243874 MGI:2675377
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : NLR family, pyrin domain containing 9 product : NACHT, LRR and PYD containing protein 9b protein_id : NP_918947.2

name	EG667067 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256572 GeneID:667067 MGI:3649070
definition	codon_start : 1 product : hypothetical protein protein_id : XP_993158.2

name	LOC620401 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256332 GeneID:620401
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479204.1

name	V1rd21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430554 CCDS:CCDS20921.1 GeneID:404290 MGI:3033490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D21 protein_id : NP_997430.1

name	EG620537 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256334 GeneID:620537 MGI:3647287
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_890023.2

name	LOC100043519 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256574 GeneID:100043519
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480535.1

name	EG620574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256336 GeneID:620574 MGI:3647652
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_890063.2

name	LOC100043523 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256576 GeneID:100043523
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480540.1

name	EG545926 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256578 GeneID:545926 MGI:3649012
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_620430.4

name	LOC100042964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256338 GeneID:100042964
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479239.1

name	LOC100043533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256580 GeneID:100043533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480553.1

name	EG435949 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762807 GeneID:435949 MGI:3644398
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_487999.1

name	LOC100043536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256582 GeneID:100043536
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001480557.1

name	LOC100043536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256584 GeneID:100043536
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_001480558.1

name	LOC100042968 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256340 GeneID:100042968
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479253.1

name	LOC100042971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256342 GeneID:100042971
definition	codon_start : 1 product : similar to LOC434138 protein protein_id : XP_001479259.1

name	EG667129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379540 GeneID:667129 MGI:3647681
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_993617.1

name	EG667135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379542 GeneID:667135 MGI:3644682
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_993655.1

name	EG435946 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762801 GeneID:435946 MGI:3644395
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_487996.1

name	LOC100042976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256345 GeneID:100042976
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479274.1

name	LOC673977 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256588 GeneID:673977
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480575.1

name	LOC100042980 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256348 GeneID:100042980
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479285.1

name	EG381936 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702276 GeneID:381936 MGI:3648210
definition	codon_start : 1 product : hypothetical protein LOC381936 protein_id : NP_001032325.1

name	LOC100043559 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256590 GeneID:100043559
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_001480587.1

name	LOC100043559 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256592 GeneID:100043559
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001480584.1

name	LOC100043561 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256594 GeneID:100043561
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480591.1

name	EG667292 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256353 GeneID:667292 MGI:3645811
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994675.2

name	LOC100043566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256596 GeneID:100043566
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480594.1

name	LOC100043569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256598 GeneID:100043569
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001480597.1

name	LOC100043569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256600 GeneID:100043569
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_001480601.1

name	EG436135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256355 GeneID:436135 MGI:3647303
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488252.2

name	LOC100042996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256357 GeneID:100042996
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479309.1

name	EG667273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256360 GeneID:667273 MGI:3645605
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994564.2

name	EG667268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379942 GeneID:667268 MGI:3648873
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994530.1

name	EG667262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379940 GeneID:667262 MGI:3648880
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994491.1

name	EG667259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256362 GeneID:667259 MGI:3645425
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994467.2

name	Gm1447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256364 GeneID:384696 MGI:2686293
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479329.1

name	LOC100043583 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256603 GeneID:100043583
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480621.1

name	EG435953 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762815 GeneID:435953 MGI:3647340
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_488003.1

name	LOC673902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256367 GeneID:673902
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479344.1

name	EG667240 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256605 GeneID:667240 MGI:3648662
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD21 protein_id : XP_994318.2

name	EG435951 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256369 GeneID:435951 MGI:3647341
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_488001.2

name	Gm1446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256371 GeneID:384695 MGI:2686292
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_357796.4

name	LOC670764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256373 GeneID:670764
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479359.1

name	EG667215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256608 GeneID:667215 MGI:3704112
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001480633.1

name	EG667215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379930 GeneID:667215 MGI:3704112
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_994174.1

name	LOC100043013 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256376 GeneID:100043013
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479363.1

name	LOC621561 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82904559 GeneID:621561
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_891057.1

name	EG667199 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379928 GeneID:667199 MGI:3643535
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_994054.1

name	EG621510 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904555 GeneID:621510 MGI:3645471
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_891007.1

name	EG628475 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256610 GeneID:628475 MGI:3645601
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_998295.2

name	LOC100043596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256613 GeneID:100043596
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480650.1

name	LOC100043016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256380 GeneID:100043016
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479379.1

name	LOC100043528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043528
definition	number : 1 pseudo : _no_value

name	LOC100042966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042966
definition	number : 2 pseudo : _no_value

name	LOC100042966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042966
definition	number : 1 pseudo : _no_value

name	LOC667166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667166
definition	number : 1 pseudo : _no_value

name	LOC667302 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667302
definition	number : 1 pseudo : _no_value

name	LOC100043576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043576
definition	number : 1 pseudo : _no_value

name	LOC100043006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043006
definition	number : 2 pseudo : _no_value

name	LOC100043006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043006
definition	number : 1 pseudo : _no_value

name	LOC100043588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043588
definition	number : 1 pseudo : _no_value

name	LOC667358 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667358
definition	number : 1 pseudo : _no_value

name	EG667040 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379522 GeneID:667040 MGI:3645816
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 8 Proteins product : predicted gene, EG667040 pseudo : _no_value transcript_id : XR_001962.1

name	LOC100043550 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256585 GeneID:100043550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins product : hypothetical protein LOC100043550 pseudo : _no_value transcript_id : XR_034735.1

name	LOC667156 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256586 GeneID:667156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_035705.1

name	LOC667311 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256350 GeneID:667311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_034113.1

name	LOC100043574 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256601 GeneID:100043574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 40 Proteins product : hypothetical protein LOC100043574 pseudo : _no_value transcript_id : XR_034750.1

name	LOC381937 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256606 GeneID:381937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 91 Proteins product : hypothetical LOC381937 pseudo : _no_value transcript_id : XR_035732.1

name	LOC667186 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256377 GeneID:667186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins product : similar to V1rd13 protein pseudo : _no_value transcript_id : XR_034151.1

name	LOC100043595 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256611 GeneID:100043595
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_034766.1

clone name	MSMg01-096P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-210B03.b	B6Ng01-210B03.g
ACC	GA028510	GA028511
length	1,176	535
definition	B6Ng01-210B03.b	B6Ng01-210B03.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaatacagaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacagccctgagat tccatctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggtttgcaggcttgtacaaccactctggaaatcagtctggcggttcctca aaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcatatgcaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa ggaactcacacaatatgtactcactgataagtggatattagccccaaacc taggatacccaagatataagatacaatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtggacactatgcccctccttagaattgggaa caaaacacccatggaaggagttacaaagacaaagtttggagctgagatga aaggatggaccatgtagagactgccatatccagggatccaccccataatc agcatccaaacgctgacaccattgcatatactagcaagattttatcgaaa ggacccagatgtagctgtctcttgggagactatgccggggcctagcaaac acagaagtggatgctcatagtcagctaatggatggatcacagggctccca gtggagagctagagaaagtacccaaggagctaaagggatctgcaacctat agtgacacattatgaactaaccagtaccccgagcttcttgactctagctg catatgttatcaaaagaatggcctagtcgcatcactggaaagaagggtca attgacaccgcaactttatattgcctcagtacaggacgccagtccaaaag ggggatggccggttaggaattggggg	tgactgagctgaatactcccttagtgtgtgacctaatatttgtttacatc attttgttacatatatataaatgcttatatatgcagcatgtgcatatata tgtatacatatgtgtctccatatgtatatatacattcatgtgtacatata cattacaagtgtttatgtgtgtctgtgtgtatatgtgtatacgcatcatg ttcatgcaatgctcactgaggcctaaaaagggcaatggatctcttcattt gtgttagagttggcttggagataccatgtgggtgctgagaattgaaccca tgtccttttaaatttcaaccactgatccattactccagcaccacggtaac caagtttcagactctgtgttactttataaagggatcaatgggtcgaggaa aagaaaaaccccattcctttgtaaagtctacataccaatagccaactctc ttttaaaaggtgtgttgtaggtatgtttgtgtctatttgtgtagtgtgtg tgcatggtgaatgtatatgtgagtgtgtatgtgta
quality values	Open. Hide. 58 33 26 30 58 58 58 38 22 62 62 62 62 47 47 62 47 24 32 62 56 47 62 62 62 49 62 49 62 54 22 43 13 25 30 13 24 22 26 28 25 28 24 23 23 24 34 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 59 62 62 59 59 56 46 48 48 54 43 56 56 59 54 54 59 56 62 62 54 54 59 59 59 59 59 62 62 54 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 59 59 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 46 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 53 62 62 62 62 47 42 58 54 54 58 54 58 52 58 58 58 58 58 54 58 58 58 58 54 49 50 54 54 58 52 52 54 58 58 58 52 58 54 54 58 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 38 54 52 58 58 49 58 58 51 41 49 49 58 58 51 58 58 58 51 52 51 58 48 58 58 54 38 58 45 35 51 43 47 54 50 58 54 58 39 41 53 53 58 54 54 50 51 49 40 58 51 58 58 58 51 54 49 58 51 50 49 49 50 58 58 58 58 58 50 58 53 41 51 51 58 51 39 58 38 28 58 54 58 40 54 33 49 58 58 51 40 53 53 53 58 49 49 41 50 44 54 53 58 51 43 44 43 41 49 40 51 50 51 40 32 51 31 31 58 58 58 40 44 42 40 23 51 49 40 38 41 27 34 50 40 49 51 54 54 28 18 54 46 31 45 45 35 39 26 34 38 44 41 37 29 54 53 35 35 54 29 49 49 51 34 38 47 37 39 15 22 21 34 47 54 46 22 44 31 28 47 34 34 32 52 37 42 53 42 52 35 53 43 43 38 37 53 33 31 25 35 32 53 31 31 28 34 49 46 19 31 23 52 26 25 32 40 47 33 52 32 32 31 37 31 36 32 25 41 31 31 22 53 32 32 31 32 37 31 35 28 26 26 32 28 37 43 43 37 30 30 26 30 21 31 34 35 23 31 30 34 31 33 21 51 51 31 29 30 31 23 41 51 32 31 31 25 19 40 31 19 27 27 22 36 38 29 28 21 37 32 31 36 31 30 21 29 32 40 31 36 18 31 21 38 28 31 31 28 28 27 46 46 41 28 29 25 32 23 30 30 44 31 24 29 31 25 26 32 35 30 31 35 20 15 19 34 31 31 26 20 36 31 23 31 32 20 30 31 31 22 26 22 38 32 27 20 31 35 14 27 11 9 21 19 7 47 33 17 29 24 44 31 13 15 23 31 27 12 11 5 7 31 31 22 24 34 17 25 41 26 23 32 32 22 16 14 9 16 25 32 29 22 32 34 17 43 7 24 34 16 16 22 21 31 34 31 20 20 31 30 16 19 18 12 28 17 23 4 9 29 32 17 32 18 13 31 17 17 22 23 27 15 15 13 17 18 27 27 24 21 21 17 18 6 3 4 9 24 8 10 9 15 28 8 10 28 24 24 24 27 24 26 24 28 17 18 15 11 8 8 10 14 25 8 20 33 34 9 5 7 21 14 16 18 8 13 20 19 9 16 4 5 3 5 19 21 17 18 16 13 3 4 11 6 6 13 9 2 14 15 4 11 6 5 16 6 13 8 6 4 5 12 4 12 14 17 9 17 22 8 5 4 7 7 6 5 14 18 5 15 7 4 6 6 8 6 3 4 3 5 6 4 18 5 3 1 11 7 13 25 23 5 3 12 26 8 10 7 3 6 25 5 6 11 20 4 6 8 18 15 5 10 13 13 19 25 17 10 8	Open. Hide. 59 62 59 59 62 39 36 13 28 27 25 28 28 27 28 28 27 28 36 49 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 51 51 48 43 34 43 48 46 56 54 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 34 34 38 62 62 46 34 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 51 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 51 58 58 58 58 53 58 58 58 58 58 51 58 58 58 58 49 53 58 58 58 58 58 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_21336738_21337278
seq2: B6Ng01-210B03.g_65_605

seq1  GAATTCTGACTGAGCTGAATACTCCCTTAGTGTGTGACCTAATATTTGTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGACTGAGCTGAATACTCCCTTAGTGTGTGACCTAATATTTGTT  50

seq1  TACATCATTTTGTTACATATATATAAATGCTTATATATGCAGCATGTGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATCATTTTGTTACATATATATAAATGCTTATATATGCAGCATGTGCA  100

seq1  TATATATGTATACATATGTGTCTCCATATGTATATATACATTCATGTGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATGTATACATATGTGTCTCCATATGTATATATACATTCATGTGTA  150

seq1  CATATACATTACAAGTGTTTATGTGTGTCTGTGTGTATATGTGTATACGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATACATTACAAGTGTTTATGTGTGTCTGTGTGTATATGTGTATACGC  200

seq1  ATCATGTTCATGCAATGCTCACTGAGGCCTAAAAAGGGCAATGGATCTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATGTTCATGCAATGCTCACTGAGGCCTAAAAAGGGCAATGGATCTCT  250

seq1  TCATTTGTGTTAGAGTTGGCTTGGAGATACCATGTGGGTGCTGAGAATTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTGTGTTAGAGTTGGCTTGGAGATACCATGTGGGTGCTGAGAATTG  300

seq1  AACCCATGTCCTTTTAAATTTCAACCACTGATCCATTACTCCAGCACCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCATGTCCTTTTAAATTTCAACCACTGATCCATTACTCCAGCACCAC  350

seq1  GGTAACCAAGTTTCAGACTCTGTGTTACTTTATAAAGGGATCAATGGGTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAACCAAGTTTCAGACTCTGTGTTACTTTATAAAGGGATCAATGGGTC  400

seq1  GAGGAAAAGAAAAACCCCATTCCTTTGTAAAGTCTACATACCAATAGCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAAAGAAAAACCCCATTCCTTTGTAAAGTCTACATACCAATAGCCA  450

seq1  ACTCTCTTTTAAAAGGTGTGTTGTAGGTATGTTTGTGTCTATTTGTGTAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTCTTTTAAAAGGTGTGTTGTAGGTATGTTTGTGTCTATTTGTGTAG  500

seq1  TGTGTGTGCATGGTGAATGTATATGTGAGTGTGTATGTGTA  541
      |||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGCATGGTGAATGTATATGTGAGTGTGTATGTGTA  541

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information