MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-211C05
Chromosome	7 (Build37)
Map Location	31,341,423 - 31,494,340
singlet/doublet	doublet
Overlap gene	1810054G18Rik, Psenen, U2af1l4, Tmem149, Wbp7, Zbtb32, Upk1a, Cox6b1, Etv2, 3100004P22Rik, 2310022K01Rik, 4930479M11Rik, 2200002J24Rik
Upstream gene	4930432E11Rik, 1700067C01Rik, Zfp84, LOC100043794, Zfp30, EG625349, 6330581L23Rik, BC027344, Zfp420, Zfp27, Zfp74, LOC625437, LOC100043796, Zfp568, Zfp14, LOC100043798, Zfp82, Zfp566, Zfp260, Zfp382, Zfp146, EG330503, Cox7a1, Capns1, Tbcb, Polr2i, Ovol3, Wdr62, EG668354, 1700020L13Rik, Clip3, Alkbh6, AI428936, 0610010E21Rik, Lrfn3, Tyrobp, Hcst, AY078069, Aplp1, Kirrel2, Nphs1, LOC100034728, Prodh2, Gm1082, Snx26, BC053749, Hspb6
Downstream gene	EG233075, Atp4a, Tmem147, Gapdhs, Sbsn, Dmkn, Krtdap, Ffar2, Ffar3, Ffar1, Cd22, Mag, Hamp2, Usf2-ps1, Hamp1, Usf2, LOC100043823, Lsr, Tmem162, Fxyd5, Fxyd7, Fxyd1, Lgi4, Fxyd3, Hpn, Scn1b, Gramd1a, LOC672598, LOC100043323, LOC100043827, Apbh, Abpe, LOC100043326, EG384585, LOC100043328, LOC100043331, LOC626181, LOC100043334, LOC100043834, LOC546947, LOC677233, LOC100043337, LOC546949, LOC100043836
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930432E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243900 MGI:3045259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	1700067C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76718 MGI:1923968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74352 MGI:107780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Zfp30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22693 MGI:99178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625349 MGI:3643038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 196 ESTs

name	6330581L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233056 MGI:1923431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC027344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233057 MGI:2446235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs

name	Zfp27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72723 MGI:107784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043796 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 411 ESTs, 4 Proteins

name	Zfp568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243905 MGI:2142347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330502 MGI:1890753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp566 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72556 MGI:1919806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26466 MGI:1347071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233060 MGI:3588204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26465 MGI:1347092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330503 MGI:3644651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12865 MGI:1316714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12336 MGI:88266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbcb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66411 MGI:1913661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69920 MGI:1917170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovol3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381867 MGI:2388075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Wdr62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233064 MGI:1923696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins

name	EG668354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668354 MGI:3644977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 4 Proteins pseudo : _no_value

name	1700020L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75629 MGI:1922879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Clip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76686 MGI:1923936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alkbh6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233065 MGI:2142037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI428936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233066 MGI:2141950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68332 MGI:1915582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrfn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233067 MGI:2442512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyrobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22177 MGI:1277211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23900 MGI:1344360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY078069 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243910 MGI:3041243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aplp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11803 MGI:88046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kirrel2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243911 MGI:2442334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nphs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54631 MGI:1859637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100034728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034728
definition	note : ribosomal protein S12 pseudogene pseudo : _no_value

name	Prodh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56189 MGI:1929093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1082 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381868 MGI:2685928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233071 MGI:2673998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC053749 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333193 MGI:2681861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243912 MGI:2685325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810054G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75660 MGI:1922910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psenen (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66340 MGI:1913590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	U2af1l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233073 MGI:2678374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem149 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101883 MGI:3655979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75410 MGI:109565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58206 MGI:1891838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upk1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109637 MGI:98911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110323 MGI:107460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etv2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14008 MGI:99253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3100004P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68035 MGI:1915285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310022K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71909 MGI:1919159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 119 ESTs, 3 Proteins

name	4930479M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74927 MGI:1922177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 1 Protein

name	2200002J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69147 MGI:1916397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233075 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233075 MGI:3643348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	Atp4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11944 MGI:88113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem147 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69804 MGI:1915011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gapdhs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14447 MGI:95653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:282619 MGI:2446326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dmkn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73712 MGI:1920962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Krtdap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64661 MGI:1928282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233079 MGI:2441731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233080 MGI:2685324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233081 MGI:2684079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12483 MGI:88322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17136 MGI:96912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66438 MGI:2153530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usf2-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140554 MGI:2153531
definition	note : upstream transcription factor 2, pseudogene 1 pseudo : _no_value

name	Hamp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84506 MGI:1933533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22282 MGI:99961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043823 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Lsr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54135 MGI:1927471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem162 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76415 MGI:1923665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18301 MGI:1201785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57780 MGI:1889006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56188 MGI:1889273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Lgi4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243914 MGI:2180197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17178 MGI:107497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15451 MGI:1196620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20266 MGI:98247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gramd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52857 MGI:105490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043827 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043827
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Apbh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57426 MGI:1930867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381970 MGI:3042579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG384585 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384585 MGI:3644233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC100043328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC626181 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100043334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC546947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC677233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC546949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043836 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 38 ESTs, 5 Proteins

name	1700067C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922672 GeneID:76718 MGI:1923968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700067C01 gene transcript_id : NM_029714.2

name	Zfp84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865960 GeneID:74352 MGI:107780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 84 transcript_id : NM_023750.2

name	LOC100043794 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256677 GeneID:100043794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100043794 transcript_id : XM_001481066.1

name	Zfp30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305644 GeneID:22693 MGI:99178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 30 transcript_id : NM_013705.1

name	EG625349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256495 GeneID:625349 MGI:3643038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 196 ESTs product : predicted gene, EG625349 transcript_id : XM_889916.3

name	6330581L23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122722 GeneID:233056 MGI:1923431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330581L23 gene transcript_id : NM_146185.1

name	BC027344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343455 GeneID:233057 MGI:2446235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC027344 transcript_id : NM_173738.2

name	Zfp420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256681 GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : zinc finger protein 420, transcript variant 2 transcript_id : XM_001481071.1

name	Zfp420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256679 GeneID:233058 MGI:2444666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : zinc finger protein 420, transcript variant 1 transcript_id : XM_001481070.1

name	Zfp27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83416320 GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 27 transcript_id : NM_011754.2

name	Zfp27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83416318 GeneID:22689 MGI:99174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 27 transcript_id : NM_001037707.1

name	Zfp74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341627 GeneID:72723 MGI:107784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 74 transcript_id : NM_178384.2

name	LOC100043796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256685 GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 378 ESTs, 4 Proteins product : similar to macrophage migration inhibitory factor, transcript variant 2 transcript_id : XM_001481076.1

name	LOC100043796 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256683 GeneID:100043796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 410 ESTs, 4 Proteins product : similar to macrophage migration inhibitory factor, transcript variant 1 transcript_id : XM_001481075.1

name	Zfp568 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803302 GeneID:243905 MGI:2142347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 568 transcript_id : NM_001033355.2

name	Zfp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641900 GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 14 transcript_id : NM_178733.5

name	Zfp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641899 GeneID:243906 MGI:99160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 14 transcript_id : NM_011748.2

name	LOC100043798 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256687 GeneID:100043798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043798 transcript_id : XM_001481083.1

name	Zfp82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83423529 GeneID:330502 MGI:1890753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 82 transcript_id : NM_177889.3

name	Zfp566 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269713 GeneID:72556 MGI:1919806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 566 transcript_id : NM_152814.2

name	Zfp260 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55741879 GeneID:26466 MGI:1347071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 260 transcript_id : NM_011981.4

name	Zfp382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486593 GeneID:233060 MGI:3588204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 382 transcript_id : NM_001081007.1

name	Zfp146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116642879 GeneID:26465 MGI:1347092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 146 transcript_id : NM_011980.3

name	EG330503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802898 GeneID:330503 MGI:3644651
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330503 transcript_id : NM_001033540.2

name	Cox7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816960 GeneID:12865 MGI:1316714
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIa 1 transcript_id : NM_009944.3

name	Capns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802724 GeneID:12336 MGI:88266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain, small subunit 1 transcript_id : NM_009795.3

name	Tbcb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801754 GeneID:66411 MGI:1913661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin folding cofactor B transcript_id : NM_025548.2

name	Polr2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625756 GeneID:69920 MGI:1917170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide I transcript_id : NM_027259.1

name	Ovol3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256497 GeneID:381867 MGI:2388075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : OVO homolog-like 3 (Drosophila) transcript_id : XM_355880.5

name	Wdr62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380132 GeneID:233064 MGI:1923696
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins product : WD repeat domain 62, transcript variant 2 transcript_id : XM_891376.2

name	1700020L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380105 GeneID:75629 MGI:1922879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700020L13 gene transcript_id : XM_001000510.1

name	Clip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487424 GeneID:76686 MGI:1923936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAP-GLY domain containing linker protein 3 transcript_id : NM_001081114.1

name	Alkbh6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38569507 GeneID:233065 MGI:2142037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 6 (E. coli) transcript_id : NM_198027.2

name	AI428936 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886478 GeneID:233066 MGI:2141950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI428936 transcript_id : NM_153577.2

name	0610010E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118962 GeneID:68332 MGI:1915582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010E21 gene transcript_id : NM_001033140.3

name	Lrfn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130272 GeneID:233067 MGI:2442512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and fibronectin type III domain containing 3 transcript_id : NM_175478.2

name	Tyrobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254570 GeneID:22177 MGI:1277211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TYRO protein tyrosine kinase binding protein transcript_id : NM_011662.2

name	Hcst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102418 GeneID:23900 MGI:1344360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell signal transducer transcript_id : NM_011827.2

name	AY078069 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377505 GeneID:243910 MGI:3041243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY078069 transcript_id : NM_172142.2

name	Aplp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861185 GeneID:11803 MGI:88046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor-like protein 1 transcript_id : NM_007467.2

name	Kirrel2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354936 GeneID:243911 MGI:2442334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kin of IRRE like 2 (Drosophila) transcript_id : NM_172898.2

name	Nphs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120586996 GeneID:54631 MGI:1859637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nephrosis 1 homolog, nephrin (human) transcript_id : NM_019459.2

name	Prodh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372879 GeneID:56189 MGI:1929093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline dehydrogenase (oxidase) 2 transcript_id : NM_019546.5

name	Gm1082 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921316 GeneID:381868 MGI:2685928
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1082, (NCBI) transcript_id : NM_001004161.1

name	Snx26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789296 GeneID:233071 MGI:2673998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 26 transcript_id : NM_178252.2

name	BC053749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304002 GeneID:333193 MGI:2681861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC053749 transcript_id : NM_183321.1

name	Hspb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803573 GeneID:243912 MGI:2685325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein, alpha-crystallin-related, B6 transcript_id : NM_001012401.2

name	1810054G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374894 GeneID:75660 MGI:1922910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810054G18 gene transcript_id : NM_029377.2

name	Psenen (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981294 GeneID:66340 MGI:1913590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : presenilin enhancer 2 homolog (C. elegans) transcript_id : NM_025498.2

name	U2af1l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130054 GeneID:233073 MGI:2678374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2 small nuclear RNA auxiliary factor 1-like 4 transcript_id : NM_170760.3

name	Tmem149 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414140 GeneID:101883 MGI:3655979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 149 transcript_id : NM_145580.2

name	Wbp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115495456 GeneID:75410 MGI:109565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 7 transcript_id : NM_029274.2

name	Zbtb32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032010 GeneID:58206 MGI:1891838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 32 transcript_id : NM_021397.2

name	Upk1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373524 GeneID:109637 MGI:98911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 1A transcript_id : NM_026815.2

name	Cox6b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375877 GeneID:110323 MGI:107460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIb polypeptide 1 transcript_id : NM_025628.2

name	Etv2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964691 GeneID:14008 MGI:99253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 2 transcript_id : NM_007959.2

name	3100004P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526863 GeneID:68035 MGI:1915285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3100004P22 gene transcript_id : NM_133693.1

name	2310022K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256499 GeneID:71909 MGI:1919159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 119 ESTs, 3 Proteins product : RIKEN cDNA 2310022K01 gene, transcript variant 1 transcript_id : XM_355883.6

name	2200002J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378000 GeneID:69147 MGI:1916397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2200002J24 gene transcript_id : NM_026961.2

name	EG233075 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380115 GeneID:233075 MGI:3643348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : predicted gene, EG233075 transcript_id : XM_145468.3

name	Atp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225336 GeneID:11944 MGI:88113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+/K+ exchanging, gastric, alpha polypeptide transcript_id : NM_018731.2

name	Tmem147 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952691 GeneID:69804 MGI:1915011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 147 transcript_id : NM_027215.2

name	Gapdhs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679938 GeneID:14447 MGI:95653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyceraldehyde-3-phosphate dehydrogenase, spermatogenic transcript_id : NM_008085.1

name	Sbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953884 GeneID:282619 MGI:2446326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suprabasin transcript_id : NM_172205.3

name	Sbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953886 GeneID:282619 MGI:2446326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suprabasin transcript_id : NM_001083903.1

name	Dmkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375786 GeneID:73712 MGI:1920962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dermokine transcript_id : NM_172899.3

name	Dmkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50284531 GeneID:73712 MGI:1920962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dermokine transcript_id : NM_028618.1

name	Krtdap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382948 GeneID:64661 MGI:1928282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratinocyte differentiation associated protein transcript_id : NM_001033131.2

name	Ffar2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373011 GeneID:233079 MGI:2441731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 2 transcript_id : NM_146187.3

name	Ffar3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345193 GeneID:233080 MGI:2685324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 3 transcript_id : NM_001033316.2

name	Ffar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835700 GeneID:233081 MGI:2684079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 1 transcript_id : NM_194057.2

name	Cd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807202 GeneID:12483 MGI:88322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD22 antigen transcript_id : NM_001043317.1

name	Cd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807200 GeneID:12483 MGI:88322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD22 antigen transcript_id : NM_009845.2

name	Mag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130141 GeneID:17136 MGI:96912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated glycoprotein transcript_id : NM_010758.2

name	Hamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802189 GeneID:66438 MGI:2153530
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepcidin antimicrobial peptide 2 transcript_id : NM_183257.2

name	Hamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14211541 GeneID:84506 MGI:1933533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepcidin antimicrobial peptide 1 transcript_id : NM_032541.1

name	Usf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755944 GeneID:22282 MGI:99961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream transcription factor 2 transcript_id : NM_011680.1

name	LOC100043823 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256691 GeneID:100043823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100043823 transcript_id : XM_001481105.1

name	Lsr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794489 GeneID:54135 MGI:1927471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipolysis stimulated lipoprotein receptor transcript_id : NM_017405.1

name	Tmem162 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802962 GeneID:76415 MGI:1923665
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 162 transcript_id : NM_175240.3

name	Fxyd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612666 GeneID:18301 MGI:1201785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 5 transcript_id : NM_008761.2

name	Fxyd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612660 GeneID:57780 MGI:1889006
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 7 transcript_id : NM_022007.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577139 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_052992.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577136 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_194321.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577135 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_019503.2

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577138 GeneID:56188 MGI:1889273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_052991.2

name	Lgi4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981705 GeneID:243914 MGI:2180197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeat LGI family, member 4 transcript_id : NM_144556.2

name	Fxyd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678813 GeneID:17178 MGI:107497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 3 transcript_id : NM_008557.1

name	Hpn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377829 GeneID:15451 MGI:1196620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepsin transcript_id : NM_008281.2

name	Scn1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981505 GeneID:20266 MGI:98247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type I, beta transcript_id : NM_011322.2

name	Gramd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360343 GeneID:52857 MGI:105490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRAM domain containing 1A transcript_id : NM_027898.3

name	LOC100043323 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256501 GeneID:100043323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001479970.1

name	Apbh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357193 GeneID:57426 MGI:1930867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen-binding protein eta transcript_id : NM_020563.2

name	Abpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402272 GeneID:381970 MGI:3042579
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen binding protein epsilon transcript_id : NM_207262.1

name	LOC100043326 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256505 GeneID:100043326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein epsilon transcript_id : XM_001479974.1

name	EG384585 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380126 GeneID:384585 MGI:3644233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG384585 transcript_id : XM_357729.4

name	LOC100043334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256507 GeneID:100043334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to allergen dI chain C2C transcript_id : XM_001479986.1

name	LOC100043836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256693 GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs, 5 Proteins product : similar to lacrimal androgen-binding protein delta, transcript variant 1 transcript_id : XM_001481113.1

name	LOC100043836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256695 GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to lacrimal androgen-binding protein delta, transcript variant 2 transcript_id : XM_001481115.1

name	1700067C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810284 GeneID:76718 MGI:1923968
definition	codon_start : 1 product : hypothetical protein LOC76718 protein_id : NP_083990.1

name	Zfp84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789231 CCDS:CCDS21074.1 GeneID:74352 MGI:107780
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger protein 69 product : zinc finger protein 84 protein_id : NP_076239.1

name	LOC100043794 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256678 GeneID:100043794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481116.1

name	Zfp30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305645 CCDS:CCDS21075.1 GeneID:22693 MGI:99178
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 30 protein_id : NP_038733.1

name	EG625349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256496 GeneID:625349 MGI:3643038
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895009.3

name	6330581L23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122723 GeneID:233056 MGI:1923431
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233056 protein_id : NP_666297.1

name	BC027344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424581 GeneID:233057 MGI:2446235
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233057 protein_id : NP_776099.1

name	Zfp420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256680 GeneID:233058 MGI:2444666
definition	codon_start : 1 product : zinc finger protein 420 isoform 1 protein_id : XP_001481120.1

name	Zfp420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256682 GeneID:233058 MGI:2444666
definition	codon_start : 1 product : zinc finger protein 420 isoform 2 protein_id : XP_001481121.1

name	Zfp27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83416319 CCDS:CCDS21076.1 GeneID:22689 MGI:99174
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 27 protein_id : NP_001032796.1

name	Zfp27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83416321 CCDS:CCDS21076.1 GeneID:22689 MGI:99174
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 27 protein_id : NP_035884.2

name	Zfp74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410002 GeneID:72723 MGI:107784
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 74 protein_id : NP_848471.1

name	LOC100043796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256684 GeneID:100043796
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor isoform 1 protein_id : XP_001481125.1

name	LOC100043796 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256686 GeneID:100043796
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor isoform 2 protein_id : XP_001481126.1

name	Zfp568 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701844 CCDS:CCDS21077.1 GeneID:243905 MGI:2142347
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 568 protein_id : NP_001028527.1

name	Zfp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699450 GeneID:243906 MGI:99160
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 14 protein_id : NP_035878.1

name	Zfp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520165 GeneID:243906 MGI:99160
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 14 protein_id : NP_848848.1

name	LOC100043798 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256688 GeneID:100043798
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481133.1

name	Zfp82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83423530 GeneID:330502 MGI:1890753
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 82 protein_id : NP_808557.2

name	Zfp566 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779907 GeneID:72556 MGI:1919806
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 566 protein_id : NP_690027.1

name	Zfp260 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544063 CCDS:CCDS21078.1 GeneID:26466 MGI:1347071
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 260 protein_id : NP_036111.2

name	Zfp382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486594 GeneID:233060 MGI:3588204
definition	codon_start : 1 product : zinc finger protein 382 protein_id : NP_001074476.1

name	Zfp146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756047 CCDS:CCDS21079.1 GeneID:26465 MGI:1347092
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : zinc finger protein 146 protein_id : NP_036110.1

name	EG330503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702043 CCDS:CCDS21080.1 GeneID:330503 MGI:3644651
definition	codon_start : 1 product : hypothetical protein B430201F14 protein_id : NP_001028712.1

name	Cox7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753504 CCDS:CCDS21081.1 GeneID:12865 MGI:1316714
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005751 - respiratory chain complex IV (sensu Eukaryota) [Evidence ISS] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence ISS] [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0045333 - cellular respiration [Evidence ISS]; GO:0006118 - electron transport [Evidence ISS] [Evidence IEA] codon_start : 1 product : cytochrome c oxidase, subunit VIIa 1 protein_id : NP_034074.1

name	Capns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110227381 CCDS:CCDS21082.1 GeneID:12336 MGI:88266
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IMP] codon_start : 1 note : calpain 4 product : calpain, small subunit 1 protein_id : NP_033925.2

name	Tbcb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384976 CCDS:CCDS21083.1 GeneID:66411 MGI:1913661
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytoskeleton-associated protein 1 protein_id : NP_079824.1

name	Polr2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625757 CCDS:CCDS21084.1 GeneID:69920 MGI:1917170
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006354 - RNA elongation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide I protein_id : NP_081535.1

name	Ovol3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256498 GeneID:381867 MGI:2388075
definition	codon_start : 1 product : OVO homolog-like 3 protein_id : XP_355880.5

name	Wdr62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904867 GeneID:233064 MGI:1923696
definition	codon_start : 1 product : WD repeat domain 62 isoform 2 protein_id : XP_896469.1

name	1700020L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380106 GeneID:75629 MGI:1922879
definition	codon_start : 1 product : hypothetical protein LOC75629 protein_id : XP_001000510.1

name	Clip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487425 GeneID:76686 MGI:1923936
definition	codon_start : 1 product : CLIP-170-related protein protein_id : NP_001074583.1

name	Alkbh6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38569508 CCDS:CCDS21085.1 GeneID:233065 MGI:2142037
definition	codon_start : 1 product : alkB, alkylation repair homolog 6 protein_id : NP_932144.2

name	AI428936 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956370 CCDS:CCDS21086.1 GeneID:233066 MGI:2141950
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233066 protein_id : NP_705805.1

name	0610010E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815822 GeneID:68332 MGI:1915582
definition	codon_start : 1 product : hypothetical protein LOC68332 protein_id : NP_001028312.2

name	Lrfn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425224 CCDS:CCDS21088.1 GeneID:233067 MGI:2442512
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : synaptic adhesion-like molecule 4 product : leucine rich repeat and fibronectin type III domain containing 3 protein_id : NP_780687.1

name	Tyrobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755915 CCDS:CCDS21089.1 GeneID:22177 MGI:1277211
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : killer cell activating receptor associated protein product : TYRO protein tyrosine kinase binding protein protein_id : NP_035792.1

name	Hcst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102419 GeneID:23900 MGI:1344360
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hematopoietic cell signal transducer protein_id : NP_035957.2

name	AY078069 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024319 CCDS:CCDS21091.1 GeneID:243910 MGI:3041243
definition	codon_start : 1 product : NF-kappa B inhibitor protein_id : NP_742154.1

name	Aplp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861186 CCDS:CCDS21092.1 GeneID:11803 MGI:88046
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0008219 - cell death [Evidence IEA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030900 - forebrain development [Evidence IGI]; GO:0006378 - mRNA polyadenylation [Evidence IDA]; GO:0006445 - regulation of translation [Evidence IDA] codon_start : 1 product : amyloid precursor-like protein 1 protein_id : NP_031493.2

name	Kirrel2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370376 GeneID:243911 MGI:2442334
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : kin of irregular chiasm-like 2; X kin of IRRE like 2 product : kin of IRRE-like 2 protein_id : NP_766486.1

name	Nphs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120586997 GeneID:54631 MGI:1859637
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IDA] codon_start : 1 note : nephrin 1 product : nephrosis 1 homolog, nephrin protein_id : NP_062332.2

name	Prodh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18139551 CCDS:CCDS21093.1 GeneID:56189 MGI:1929093
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 note : kidney and liver proline oxidase 1 product : proline dehydrogenase (oxidase) 2 protein_id : NP_062419.2

name	Gm1082 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921317 GeneID:381868 MGI:2685928
definition	codon_start : 1 product : hypothetical protein LOC381868 protein_id : NP_001004161.1

name	Snx26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142699 CCDS:CCDS21095.1 GeneID:233071 MGI:2673998
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : TC10/CDC42 GTPase-activating protein product : sorting nexin 26 protein_id : NP_839983.1

name	BC053749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304003 CCDS:CCDS21096.1 GeneID:333193 MGI:2681861
definition	codon_start : 1 product : hypothetical protein LOC333193 protein_id : NP_899144.1

name	Hspb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59958370 CCDS:CCDS21097.1 GeneID:243912 MGI:2685325
definition	GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : cardiac heat shock protein p20; cardiac p20 product : heat shock protein, alpha-crystallin-related, B6 protein_id : NP_001012401.1

name	1810054G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313004 CCDS:CCDS21098.1 GeneID:75660 MGI:1922910
definition	codon_start : 1 note : antolefinine product : hypothetical protein LOC75660 protein_id : NP_083653.1

name	Psenen (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384922 CCDS:CCDS21099.1 GeneID:66340 MGI:1913590
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0042987 - amyloid precursor protein catabolism [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0007220 - Notch receptor processing [Evidence ISS]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence ISS]; GO:0016485 - protein processing [Evidence ISS] codon_start : 1 product : presenilin enhancer 2 homolog protein_id : NP_079774.1

name	U2af1l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25072205 CCDS:CCDS21100.1 GeneID:233073 MGI:2678374
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : U2 auxiliary factor 26 product : U2 small nuclear RNA auxiliary factor 1-like 4 protein_id : NP_739566.1

name	Tmem149 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414141 GeneID:101883 MGI:3655979
definition	codon_start : 1 product : hypothetical protein LOC101883 protein_id : NP_663555.2

name	Wbp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115495457 CCDS:CCDS21101.1 GeneID:75410 MGI:109565
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mixed lineage leukemia 2 product : WW domain binding protein 7 protein_id : NP_083550.2

name	Zbtb32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032011 CCDS:CCDS21102.1 GeneID:58206 MGI:1891838
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000228 - nuclear chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence IMP]; GO:0001817 - regulation of cytokine production [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0042098 - T cell proliferation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : GATA repressor product : repressor of GATA protein_id : NP_067372.2

name	Upk1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037127 CCDS:CCDS21103.1 GeneID:109637 MGI:98911
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0048029 - monosaccharide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0006897 - endocytosis [Evidence TAS]; GO:0030855 - epithelial cell differentiation [Evidence ISS]; GO:0051259 - protein oligomerization [Evidence ISS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : uroplakin 1A protein_id : NP_081091.1

name	Cox6b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385090 GeneID:110323 MGI:107460
definition	EC_number : 1.9.3.1 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : cytochrome c oxidase, subunit VIb polypeptide 1 protein_id : NP_079904.1

name	Etv2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964692 GeneID:14008 MGI:99253
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : ets related protein 71 protein_id : NP_031985.2

name	3100004P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526864 GeneID:68035 MGI:1915285
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68035 protein_id : NP_598454.1

name	2310022K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256500 GeneID:71909 MGI:1919159
definition	codon_start : 1 product : hypothetical protein LOC71909 isoform 1 protein_id : XP_355883.3

name	2200002J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037149 CCDS:CCDS21107.1 GeneID:69147 MGI:1916397
definition	codon_start : 1 product : hypothetical protein LOC69147 protein_id : NP_081237.1

name	EG233075 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20824630 GeneID:233075 MGI:3643348
definition	codon_start : 1 product : hypothetical protein protein_id : XP_145468.1

name	Atp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225337 GeneID:11944 MGI:88113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008900 - hydrogen:potassium-exchanging ATPase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+/K+ exchanging, alpha polypeptide; H+K+-transporting alpha 1 product : ATPase, H+/K+ transporting, alpha polypeptide protein_id : NP_061201.2

name	Tmem147 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952692 GeneID:69804 MGI:1915011
definition	codon_start : 1 note : seven transmembrane domain protein product : transmembrane protein 147 protein_id : NP_081491.2

name	Gapdhs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679939 CCDS:CCDS21109.1 GeneID:14447 MGI:95653
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0004365 - glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity [Evidence TAS] [Evidence IEA]; GO:0008943 - glyceraldehyde-3-phosphate dehydrogenase activity [Evidence IDA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0045821 - positive regulation of glycolysis [Evidence TAS]; GO:0030317 - sperm motility [Evidence IMP] [Evidence IDA] codon_start : 1 product : glyceraldehyde-3-phosphate dehydrogenase, spermatogenic protein_id : NP_032111.1

name	Sbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953885 GeneID:282619 MGI:2446326
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; suprabasal-specific protein product : suprabasin isoform 1 protein_id : NP_757342.2

name	Sbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953887 GeneID:282619 MGI:2446326
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; suprabasal-specific protein product : suprabasin isoform 2 protein_id : NP_001077372.1

name	Dmkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230483 GeneID:73712 MGI:1920962
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] codon_start : 1 exception : mismatches in translation note : beta is encoded by transcript variant 2; epidermis-specific secreted protein product : dermokine beta protein_id : NP_766487.2

name	Dmkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284532 GeneID:73712 MGI:1920962
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] codon_start : 1 note : alpha is encoded by transcript variant 1; epidermis-specific secreted protein product : dermokine alpha protein_id : NP_082894.1

name	Krtdap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781694 CCDS:CCDS21110.1 GeneID:64661 MGI:1928282
definition	GO_process : GO:0008544 - epidermis development [Evidence ISS] codon_start : 1 product : keratinocyte differentiation associated protein protein_id : NP_001028303.1

name	Ffar2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122727 CCDS:CCDS21111.1 GeneID:233079 MGI:2441731
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 43 protein_id : NP_666299.1

name	Ffar3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701812 CCDS:CCDS21112.1 GeneID:233080 MGI:2685324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : putative G protein-coupled receptor GPR41 product : G protein-coupled receptor 41 protein_id : NP_001028488.1

name	Ffar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835701 CCDS:CCDS21113.1 GeneID:233081 MGI:2684079
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR40 product : G protein-coupled receptor 40 protein_id : NP_918946.2

name	Cd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807203 GeneID:12483 MGI:88322
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IPI]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : CD22 antigen protein_id : NP_001036782.1

name	Cd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807201 CCDS:CCDS21114.1 GeneID:12483 MGI:88322
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IPI]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD22 antigen protein_id : NP_033975.2

name	Mag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754614 CCDS:CCDS21115.1 GeneID:17136 MGI:96912
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : myelin-associated glycoprotein protein_id : NP_034888.1

name	Hamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304034 GeneID:66438 MGI:2153530
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0050832 - defense response to fungus [Evidence IEA]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IEA] codon_start : 1 product : hepcidin antimicrobial peptide 2 protein_id : NP_899080.1

name	Hamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14211542 GeneID:84506 MGI:1933533
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0050832 - defense response to fungus [Evidence IDA]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : hepcidin antimicrobial peptide 1 protein_id : NP_115930.1

name	Usf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755945 CCDS:CCDS21118.1 GeneID:22282 MGI:99961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007595 - lactation [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : upstream stimulatory factor 2 protein_id : NP_035810.1

name	LOC100043823 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256692 GeneID:100043823
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481155.1

name	Lsr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794490 CCDS:CCDS21119.1 GeneID:54135 MGI:1927471
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0042627 - chylomicron [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] codon_start : 1 note : lipolysis stimulated receptor product : liver-specific bHLH-Zip transcription factor protein_id : NP_059101.1

name	Tmem162 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30172568 CCDS:CCDS21120.1 GeneID:76415 MGI:1923665
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76415 protein_id : NP_780449.1

name	Fxyd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679168 CCDS:CCDS21121.1 GeneID:18301 MGI:1201785
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : oncoprotein induced transcript 2 product : FXYD domain-containing ion transport regulator 5 protein_id : NP_032787.1

name	Fxyd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612661 CCDS:CCDS21122.1 GeneID:57780 MGI:1889006
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : FXYD domain-containing ion transport regulator 7 protein_id : NP_071290.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506705 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : FXYD domain-containing ion transport regulator 1 (MGD\|MGI:1889273)putative; phospholemman product : phospholemman precursor protein_id : NP_062376.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996479 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_443717.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37577140 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_443718.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37577137 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_919302.1

name	Lgi4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981706 CCDS:CCDS21124.1 GeneID:243914 MGI:2180197
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042552 - myelination [Evidence IMP]; GO:0042551 - neuron maturation [Evidence IMP] codon_start : 1 function : putative secreted protein note : LGI1-like protein 3; leucine-rich glioma inactivated protein 4; claw paw product : leucine-rich repeat LGI family, member 4 protein_id : NP_653139.2

name	Fxyd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678814 CCDS:CCDS21125.1 GeneID:17178 MGI:107497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mammary tumor 8 kDa product : chloride conductance inducer protein MAT-8 precursor protein_id : NP_032583.1

name	Hpn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680267 GeneID:15451 MGI:1196620
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hepsin protein_id : NP_032307.1

name	Scn1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755408 CCDS:CCDS21126.1 GeneID:20266 MGI:98247
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium channel, voltage-gated, type I, beta polypeptide product : sodium channel, voltage-gated, type I, beta protein_id : NP_035452.1

name	Gramd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360344 GeneID:52857 MGI:105490
definition	codon_start : 1 product : GRAM domain containing 1A protein_id : NP_082174.3

name	LOC100043323 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256502 GeneID:100043323
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480020.1

name	Apbh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181188 GeneID:57426 MGI:1930867
definition	codon_start : 1 note : lacrimal gland protein; major allergen 1-like product : androgen-binding protein eta protein_id : NP_065588.1

name	Abpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402273 CCDS:CCDS21128.1 GeneID:381970 MGI:3042579
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : lacrimal androgen-binding protein epsilon product : androgen binding protein epsilon protein_id : NP_997145.1

name	LOC100043326 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256506 GeneID:100043326
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein epsilon protein_id : XP_001480024.1

name	EG384585 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51782621 GeneID:384585 MGI:3644233
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_357729.2

name	LOC100043334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256508 GeneID:100043334
definition	codon_start : 1 product : similar to allergen dI chain C2C protein_id : XP_001480036.1

name	LOC100043836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256696 GeneID:100043836
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_001481165.1

name	LOC100043836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256694 GeneID:100043836
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 1 protein_id : XP_001481163.1

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 1 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 2 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 3 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 4 pseudo : _no_value

name	LOC625437 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625437
definition	number : 5 pseudo : _no_value

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 1 pseudo : _no_value

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 2 pseudo : _no_value

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 3 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 1 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 2 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 3 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 4 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 3 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 2 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 1 pseudo : _no_value

name	LOC100043331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043331
definition	number : 1 pseudo : _no_value

name	LOC100043331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043331
definition	number : 2 pseudo : _no_value

name	LOC626181 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626181
definition	number : 2 pseudo : _no_value

name	LOC626181 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626181
definition	number : 1 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 3 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 2 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 1 pseudo : _no_value

name	LOC546947 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546947
definition	number : 1 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 1 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 2 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 3 pseudo : _no_value

name	LOC100043337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043337
definition	number : 1 pseudo : _no_value

name	LOC100043337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043337
definition	number : 2 pseudo : _no_value

name	LOC546949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546949
definition	number : 1 pseudo : _no_value

name	4930432E11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256494 GeneID:243900 MGI:3045259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : RIKEN cDNA 4930432E11 gene transcript_id : XR_035433.1

name	EG668354 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256689 GeneID:668354 MGI:3644977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 4 Proteins product : predicted gene, EG668354 pseudo : _no_value transcript_id : XR_002251.2

name	4930479M11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256690 GeneID:74927 MGI:1922177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 1 Protein product : RIKEN cDNA 4930479M11 gene transcript_id : XR_035473.1

clone name	MSMg01-085C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-270K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-442A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432P02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359C06
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-249A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310H04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-211C05.b	B6Ng01-211C05.g
ACC	GA029297	GA029298
length	1,120	1,089
definition	B6Ng01-211C05.b	B6Ng01-211C05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(31,493,210 - 31,494,340)	(31,341,423 - 31,342,503)
sequence	gaattcctaaccctcctgcctccatctcccaaaagctgaggttacagcca ttcctggtgagaaacaagacactttctaactgtatttaggcagctgctgc ctatgaatatggtcattttttaacataaataatcatatggacaatttcaa aaaattaacagaaataagttacttttatctaagtatgagaatgcatttga attccatagttttccccctgaagtccttgcagtctgggatgtggtcccga tgtcactttacatgaattggtgtgtcccttgagctcctgaaaagaaccta ttttgggatgccttggaccggaatccacagtcacaccaaaacctcaatac atataaccactgcctgagcctatgtccacagccactgcccgagcctgagt tcacatacctattaactgagcctaagtccacaatgcagtcattgcctgag cctgaatctacacaactatcatctaaacctgaatctgtgcagctcctaaa tgcctaaacctgagcccacatggtcactgcctgatgttgtagctagatag ccaatgtccaaacaaacacaatttcttccaacactcccaacctcctacac ccaaccactgaaagacaatgcctgctacagacagcttgaatttacgatga cgttatggccttgttcatcgcaactgtacaatggccagacatactgaaga tcagtttcaccagcttctcagactatgcagccttcagacggtactcaaat tctgcatctttgggacaagtgtcttgattgatcaaattattctttttatc atgtgtatgagcaacactaaggccgtctctaggtggtgaacacataggcc tctacctacaggctggatgtgaagtgagctgaagtatcagatatgtctgg tagcttatatggactgtagcccatggtgtggacacagagtgctgtacaat gccacttcagctgatgggaaacttctggccacagttcagggaaagccttc ttgatggcaagtgtcagatgcagcccctacagtgggcagccactgcatgt cctcactgagctaagcacacctgacttgttgaggaagtggtcagaatgaa taattattctgtcctataaa	gaattccatctctatctgtcagcccaggggcagagggtggtcaagatgct ctctttacgcagttgtctagggcaggtgtcatgtctacttttatcttgag agccccaagaatcaaagtcatgtatctgtcccaggaatccatgtctaccc tttcaggccagatgattttcaaacctgttaccctccgcccagcccgtaag gtccacatgtgctcaccaaggccccatctggtagccacatctgtttgcac ttaagatccctgttccctaggaagccatatctatgtggcctagggacctc tgtccataatcctaagagcaaatagctatctgtcctacccgattctctat tcattgaggggggcccaggcattaaagctatctaccactcatgggggagt tgttgacttatccacccactcttcaatctggcctcctgattgaactcatc ctacctctccatcctcgggcagaggaggcagcggtgagccgggtgagcgc tcgcgctctcgcactgtggggctgttgcgcatccaggcgcggcagatggg gtacagtggtgtgttctcactgaactgggccaagtccacactccggtcaa atagcttgatcacatacgtatctggggtggtaaggtaggcgataagtgtg tagttcctggctccacacccaccctctcagtcccctgcctactcactgga tctctgaggacccccctcagcgagcccatcgtccatctccctcctcttct tcctccgctggtgggggaagcgggcagatggcctgtgtggttaaggtgag tgttcaggcccgggagctggggactgggaacctttttagtgagctggggt cccagccacctttacctttttgcttgtggcagcaatggaacaatccctgc agggagagatcatggtgtcagaggctttaataaacagctgctcaacgctg ccccccaaggtggaagtgacgtagttcagaacaaaagcatttgcctagca tggggcaaaagccctgggtttctatccctagctcctaaaaacaaccaaaa tatacaatccctgggattattggtactcccttgggccct
quality values	Open. Hide. 62 41 22 21 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 44 30 62 62 62 62 62 43 39 24 30 24 24 28 23 25 28 17 27 25 28 28 32 29 37 51 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 36 43 46 46 56 36 48 46 48 54 59 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 47 62 62 62 62 62 54 62 54 62 62 62 62 54 62 62 62 62 62 52 62 62 62 62 62 62 52 62 62 62 51 58 49 58 49 58 58 58 58 58 58 58 58 58 52 45 35 58 58 54 58 58 58 58 45 33 58 54 58 58 54 58 58 58 58 54 54 58 41 37 58 52 58 46 54 58 58 58 49 52 54 45 35 54 52 54 58 52 58 54 58 58 45 52 52 52 41 42 47 54 58 58 58 54 58 54 52 47 58 58 50 47 41 58 46 58 47 40 50 58 51 53 52 54 51 30 58 52 58 53 52 58 50 46 50 53 47 51 52 49 49 52 58 52 40 53 39 51 50 58 37 40 49 39 52 44 31 37 53 49 46 48 54 53 51 39 39 22 39 41 34 39 58 50 40 34 41 38 33 50 46 54 33 41 53 52 52 29 54 25 41 52 50 52 52 50 25 49 50 53 53 50 37 28 39 21 40 44 30 37 29 53 52 35 58 37 49 54 53 53 51 41 40 49 42 52 54 52 49 38 38 29 21 30 36 39 42 51 33 41 54 39 40 39 37 49 38 33 39 33 29 54 52 41 51 41 30 45 53 25 54 54 54 37 37 33 40 32 40 52 43 53 43 43 40 32 54 18 53 28 29 32 32 32 32 30 53 28 33 24 53 37 31 32 33 42 32 53 31 35 31 47 46 25 34 52 40 29 31 32 24 41 33 9 32 27 26 31 39 39 32 31 43 31 36 31 25 25 28 31 39 31 28 31 31 36 31 30 33 31 31 31 32 43 32 31 32 32 25 31 21 31 31 30 37 5 6 11 16 21 28 36 26 31 38 43 41 22 38 25 34 25 32 25 21 21 25 46 34 32 32 30 31 9 32 19 41 41 26 23 31 27 33 31 31 19 24 17 27 20 9 27 9 32 32 28 22 37 31 31 37 35 28 28 19 21 24 26 17 10 14 31 31 32 31 6 5 9 29 23 26 15 29 48 13 7 32 23 23 24 21 32 34 21 33 11 10 12 23 31 14 24 16 14 18 16 47 20 24 40 34 10 18 10 32 9 21 9 24 11 20 9 18 21 7 10 8 27 9 8 9 7 6 8 16 11 17 27 28 16 27 30 28 20 8 7 9 9 7 7 13 47 19 6 17 14 7 5 5 14 27 24 20 24 10 7 5 6 6 5 8 16 13 19 11 8 4 3 5 5 15 9 4 6 7 6 5 5 19 15 18 12 13 7 11 9 11 3 8 10 17 4 4 2 4 8 3 2 3 3 4 7 3 3 3 17 7 11 10 10 18 4 5 8 7 12 5 7 5 3 9 4 7 13 10 8 4	Open. Hide. 62 47 51 47 62 62 47 39 62 62 50 19 17 12 18 22 25 22 25 16 17 28 28 32 28 36 49 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 38 43 43 23 40 28 21 28 43 38 38 42 33 54 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 56 62 62 62 56 62 62 47 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 50 62 43 47 52 62 62 62 62 52 62 43 62 54 62 52 62 62 54 62 62 58 58 58 58 42 54 54 49 54 38 54 52 52 50 52 54 54 58 58 54 58 58 58 52 54 58 52 54 54 40 58 34 47 46 45 38 52 54 29 35 54 46 54 54 46 58 39 52 50 58 52 41 36 47 40 58 47 54 52 58 39 52 52 54 54 40 37 54 54 58 52 54 41 52 46 47 41 53 58 58 51 50 47 16 46 29 26 50 58 53 52 41 33 41 51 25 25 46 53 53 52 51 46 12 47 24 10 47 48 47 47 48 46 40 50 40 50 32 52 28 32 58 50 40 53 53 52 34 41 40 32 42 39 53 53 58 58 49 36 51 52 50 36 9 19 17 35 37 58 39 27 35 26 39 45 41 54 37 50 58 58 58 23 49 27 14 47 27 49 49 31 39 24 39 23 51 58 19 54 39 51 31 54 31 33 51 29 20 17 47 27 40 18 28 42 14 42 35 10 9 19 13 20 32 16 50 39 10 49 7 34 7 23 31 30 39 24 40 33 15 40 25 54 12 39 31 32 19 10 38 40 49 23 32 32 29 37 32 32 31 42 34 40 36 16 28 15 40 40 27 18 23 22 29 21 21 7 51 31 31 28 14 16 52 45 52 26 34 32 6 13 14 18 30 11 10 31 24 26 20 16 31 33 11 23 32 9 12 26 29 20 18 22 21 29 14 9 7 40 14 18 13 42 23 31 6 10 13 31 31 34 16 30 30 18 7 8 22 14 26 9 24 32 27 11 37 25 23 32 28 18 24 30 15 24 37 35 31 30 32 24 13 17 29 32 35 33 39 37 31 28 27 19 11 15 23 8 6 18 11 30 6 8 14 34 22 14 6 9 12 11 13 14 5 13 17 25 20 7 9 21 16 6 13 21 20 31 17 20 26 32 33 21 26 24 16 21 29 31 23 18 9 11 34 43 32 22 21 30 31 21 16 15 4 4 15 21 20 12 9 10 23 9 5 23 15 8 8 29 14 8 7 5 21 36 24 7 8 8 9 7 12 32 31 12 11 3 3 7 5 4 5 13 28 14 25 16 13 24 18 11 4 7 28 13 18 14 13 25 6 5 6 6 9 28 13 14 6 11 21 7 6 12 14 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_31493210_31494340
seq2: B6Ng01-211C05.b_46_1165 (reverse)

seq1  TTTATAGGGACAGAATAATATATTCAATTCTGACCACTGTCCTCAAACAA  50
      |||||| |||||||||||| ||||| |||||||||||| ||||| |||||
seq2  TTTATA-GGACAGAATAAT-TATTC-ATTCTGACCACT-TCCTC-AACAA  45

seq1  GTCA-GTGTGCCTTAGGCTCAGTGA-GACATGCAGT-GCTGCCCACTGTA  97
      |||| ||||| |||| ||||||||| |||||||||| |||||||||||||
seq2  GTCAGGTGTG-CTTA-GCTCAGTGAGGACATGCAGTGGCTGCCCACTGTA  93

seq1  GGGGCTGCATCCTGAACACCTGCCATTCAAGAAGGCTTTTCCCTTGAACT  147
      |||||||||| ||| |||| ||||| |||||||||||||  || ||||||
seq2  GGGGCTGCAT-CTG-ACACTTGCCA-TCAAGAAGGCTTT--CCCTGAACT  138

seq1  GT-GCCAGAAGTTTCCCATCAGCCTGAAGTGGCATTGTACAGCACCTCTG  196
      || ||||||||||||||||||| ||||||||||||||||||||| |||||
seq2  GTGGCCAGAAGTTTCCCATCAG-CTGAAGTGGCATTGTACAGCA-CTCTG  186

seq1  TGTCCACACCATGGGCTACAGTCCATATAAGCTACCAGACATATCCTGAT  246
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TGTCCACACCATGGGCTACAGTCCATATAAGCTACCAGACATAT-CTGAT  235

seq1  ACTTCAGCTCACTTCACATCCAGCCTGTAGGTAGAGGCCTATGTGTTCAC  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCAGCTCACTTCACATCCAGCCTGTAGGTAGAGGCCTATGTGTTCAC  285

seq1  CACCTAGAGACGGCCTTAGTGTTGCTCATACACATGATAAAAAGAATAAT  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTAGAGACGGCCTTAGTGTTGCTCATACACATGATAAAAAGAATAAT  335

seq1  TTGATCAATCAAGACACTTGTCCCAAAGATGCAGAATTTGAGTACCGTCT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATCAATCAAGACACTTGTCCCAAAGATGCAGAATTTGAGTACCGTCT  385

seq1  GAAGGCTGCATAGTCTGAGAAGCTGGTGAAACTGATCTTCAGTATGTCTG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGCTGCATAGTCTGAGAAGCTGGTGAAACTGATCTTCAGTATGTCTG  435

seq1  GCCATTGTACAGTTGCGATGAACAAGGCCATAACGTCATCGTAAATTCAA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTGTACAGTTGCGATGAACAAGGCCATAACGTCATCGTAAATTCAA  485

seq1  GCTGTCTGTAGCAGGCATTGTCTTTCAGTGGTTGGGTGTAGGAGGTTGGG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCTGTAGCAGGCATTGTCTTTCAGTGGTTGGGTGTAGGAGGTTGGG  535

seq1  AGTGTTGGAAGAAATTGTGTTTGTTTGGACATTGGCTATCTAGCTACAAC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTTGGAAGAAATTGTGTTTGTTTGGACATTGGCTATCTAGCTACAAC  585

seq1  ATCAGGCAGTGACCATGTGGGCTCAGGTTTAGGCATTTAGGAGCTGCACA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGGCAGTGACCATGTGGGCTCAGGTTTAGGCATTTAGGAGCTGCACA  635

seq1  GATTCAGGTTTAGATGATAGTTGTGTAGATTCAGGCTCAGGCAATGACTG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCAGGTTTAGATGATAGTTGTGTAGATTCAGGCTCAGGCAATGACTG  685

seq1  CATTGTGGACTTAGGCTCAGTTAATAGGTATGTGAACTCAGGCTCGGGCA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGTGGACTTAGGCTCAGTTAATAGGTATGTGAACTCAGGCTCGGGCA  735

seq1  GTGGCTGTGGACATAGGCTCAGGCAGTGGTTATATGTATTGAGGTTTTGG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCTGTGGACATAGGCTCAGGCAGTGGTTATATGTATTGAGGTTTTGG  785

seq1  TGTGACTGTGGATTCCGGTCCAAGGCATCCCAAAATAGGTTCTTTTCAGG  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACTGTGGATTCCGGTCCAAGGCATCCCAAAATAGGTTCTTTTCAGG  835

seq1  AGCTCAAGGGACACACCAATTCATGTAAAGTGACATCGGGACCACATCCC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCAAGGGACACACCAATTCATGTAAAGTGACATCGGGACCACATCCC  885

seq1  AGACTGCAAGGACTTCAGGGGGAAAACTATGGAATTCAAATGCATTCTCA  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTGCAAGGACTTCAGGGGGAAAACTATGGAATTCAAATGCATTCTCA  935

seq1  TACTTAGATAAAAGTAACTTATTTCTGTTAATTTTTTGAAATTGTCCATA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTAGATAAAAGTAACTTATTTCTGTTAATTTTTTGAAATTGTCCATA  985

seq1  TGATTATTTATGTTAAAAAATGACCATATTCATAGGCAGCAGCTGCCTAA  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTATTTATGTTAAAAAATGACCATATTCATAGGCAGCAGCTGCCTAA  1035

seq1  ATACAGTTAGAAAGTGTCTTGTTTCTCACCAGGAATGGCTGTAACCTCAG  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACAGTTAGAAAGTGTCTTGTTTCTCACCAGGAATGGCTGTAACCTCAG  1085

seq1  CTTTTGGGAGATGGAGGCAGGAGGGTTAGGAATTC  1131
      |||||||||||||||||||||||||||||||||||
seq2  CTTTTGGGAGATGGAGGCAGGAGGGTTAGGAATTC  1120

seq1: chr7_31341423_31342503
seq2: B6Ng01-211C05.g_68_1156

seq1  GAATTCCATCTCTATCTGTCAGCCCAGGGGCAGAGGGTGGTCAAGATGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATCTCTATCTGTCAGCCCAGGGGCAGAGGGTGGTCAAGATGCT  50

seq1  CTCTTTACGCAGTTGTCTAGGGCAGGTGTCATGTCTACTTTTATCTTGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTACGCAGTTGTCTAGGGCAGGTGTCATGTCTACTTTTATCTTGAG  100

seq1  AGCCCCAAGAATCAAAGTCATGTATCTGTCCCAGGAATCCATGTCTACCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCCAAGAATCAAAGTCATGTATCTGTCCCAGGAATCCATGTCTACCC  150

seq1  TTTCAGGCCAGATGATTTTCAAACCTGTTACCCTCCGCCCAGCCCGTAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAGGCCAGATGATTTTCAAACCTGTTACCCTCCGCCCAGCCCGTAAG  200

seq1  GTCCACATGTGCTCACCAAGGCCCCATCTGGTAGCCACATCTGTTTGCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCACATGTGCTCACCAAGGCCCCATCTGGTAGCCACATCTGTTTGCAC  250

seq1  TTAAGATCCCTGTTCCCTAGGAAGCCATATCTATGTGGCCTAGGGACCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGATCCCTGTTCCCTAGGAAGCCATATCTATGTGGCCTAGGGACCTC  300

seq1  TGTCCATAATCCTAAGAGCAAATAGCTATCTGTCCTACCCGATTCTCTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCATAATCCTAAGAGCAAATAGCTATCTGTCCTACCCGATTCTCTAT  350

seq1  TCATTGAGGGGGGCCCAGGCATTAAAGCTATCTACCACTCATGGGGGAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGAGGGGGGCCCAGGCATTAAAGCTATCTACCACTCATGGGGGAGT  400

seq1  TGTTGACTTATCCACCCACTCTTCAATCTGGCCTCCTGATTGAACTCATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGACTTATCCACCCACTCTTCAATCTGGCCTCCTGATTGAACTCATC  450

seq1  CTACCTCTCCATCCTCGGGCAGAGGAGGCAGCGGTGAGCCGGGTGAGCGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCTCTCCATCCTCGGGCAGAGGAGGCAGCGGTGAGCCGGGTGAGCGC  500

seq1  TCGCGCTCTCGCACTGTGGGGCTGTTGCGCATCCAGGCGCGGCAGATGGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGCGCTCTCGCACTGTGGGGCTGTTGCGCATCCAGGCGCGGCAGATGGG  550

seq1  GTACAGTGGTGTGTTCTCACTGAACTGGGCCAAGTCCACACTCCGGTCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAGTGGTGTGTTCTCACTGAACTGGGCCAAGTCCACACTCCGGTCAA  600

seq1  ATAGCTTGATCACATACGTATCTGGGGTGGTAAGGTAGGCGATAAGTGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCTTGATCACATACGTATCTGGGGTGGTAAGGTAGGCGATAAGTGTG  650

seq1  TAGTTCCTGGCTCCACACCCACCCTCTCAGTCCCCTGCCTACTCACTGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTCCTGGCTCCACACCCACCCTCTCAGTCCCCTGCCTACTCACTGGA  700

seq1  TCTCTGAGGACCCCCCTCAGCGAGCCCATCGTCCATCTCCCTCCTCTTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGAGGACCCCCCTCAGCGAGCCCATCGTCCATCTCCCTCCTCTTCT  750

seq1  TCCTCCGCTGGTGGGGGAAGCGGGCAGATGGCCTGTGTGGTTAAGGTGAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCGCTGGTGGGGGAAGCGGGCAGATGGCCTGTGTGGTTAAGGTGAG  800

seq1  TG-TCAGGCCC-GGAGCTGGGGACTGGGAACC-TTTTAGTGAGCTGGGGT  847
      || |||||||| |||||||||||||||||||| |||||||||||||||||
seq2  TGTTCAGGCCCGGGAGCTGGGGACTGGGAACCTTTTTAGTGAGCTGGGGT  850

seq1  CCCAGCCACC-TTACC-TTTTGCCTGTGGCAGCAATGGAACAATCCCTGC  895
      |||||||||| ||||| |||||| ||||||||||||||||||||||||||
seq2  CCCAGCCACCTTTACCTTTTTGCTTGTGGCAGCAATGGAACAATCCCTGC  900

seq1  AGGGAGAGA-CATGGTGTCAGGAGGCTTTAATAAACAGCTGCTCAACGCT  944
      ||||||||| |||||||||| |||||||||||||||||||||||||||||
seq2  AGGGAGAGATCATGGTGTCA-GAGGCTTTAATAAACAGCTGCTCAACGCT  949

seq1  GCCCCCCAAGGTGGAAGTGACGTAGTTCAGGAACAGAGCATTTGCCTAGC  994
      |||||||||||||||||||||||||||||| |  | ||||||||||||||
seq2  GCCCCCCAAGGTGGAAGTGACGTAGTTCAGAACAAAAGCATTTGCCTAGC  999

seq1  AT-GGGCAAAAGCCCTGGGGTTCTATCGCTAGCT-CTAAAAACAAACAAA  1042
      || |||||||||||||||| ||||||| |||||| |||||||||| ||||
seq2  ATGGGGCAAAAGCCCTGGGTTTCTATCCCTAGCTCCTAAAAACAACCAAA  1049

seq1  AATTAACATCCTGGGGATTATTGGTACT-CCTTGGGCCTT  1081
      |  ||  ||||  ||||||||||||||| ||||||||| |
seq2  ATATACAATCCCTGGGATTATTGGTACTCCCTTGGGCCCT  1089

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information