MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-211E09
Chromosome	7 (Build37)
Map Location	114,261,089 - 114,442,766
singlet/doublet	doublet
Overlap gene	Olfr715, Olfr716, Nlrp14, LOC100042278, 1700012H05Rik
Upstream gene	EG668117, Gvin1, LOC672660, LOC100042097, LOC668128, LOC634394, EG209380, EG668139, Gm1966, LOC100042141, Olfr693, Olfr694, Olfr695, Olfr696-ps1, Olfr697, Olfr698, Olfr699, Olfr700, Olfr701, Olfr702, Olfr703, Olfr704, Olfr705, Olfr706, Olfr707, Olfr708, Olfr709-ps1, Olfr710, LOC384651, Olfr6, Olfr711, GA_x5J8B7W6B6J-1784824-1783474, Olfr2, Olfr713, Olfr714, Olfr17
Downstream gene	Syt9, Olfml1, Ppfibp2, 5330417H12Rik, Cyb5r2, Ovch2, LOC100042310, Olfr467, Olfr468-ps1, Olfr469, GA_x5J8B7W6B6J-2580381-2580079, Olfr470, Olfr471, LOC626661, Olfr472, Olfr473, LOC669301, Olfr474, Olfr476, Olfr477, LOC626732, Olfr478, Olfr479, Olfr480, Olfr481, LOC100043059, Olfr482, Olfr483, Olfr484, Olfr485, Olfr486, Olfr487, Olfr1538-ps1, Olfr488, LOC546990, Olfr489-ps1, Olfr490
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG668117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Gvin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC672660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100042097 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668128
definition	note : very large inducible GTPase 1 pseudogene pseudo : _no_value

name	LOC634394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins pseudo : _no_value

name	EG209380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209380 MGI:3647753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668139 MGI:3644223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins

name	Gm1966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 30 ESTs, 3 Proteins

name	LOC100042141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258445 MGI:3030527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr694 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258444 MGI:3030528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258591 MGI:3030529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr696-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404416 MGI:3030530
definition	note : olfactory receptor 696, pseudogene 1 pseudo : _no_value

name	Olfr697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258592 MGI:3030531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr698 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258595 MGI:3030532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr699 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258180 MGI:3030533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr700 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258593 MGI:3030534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66786 MGI:3030535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr702 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258590 MGI:3030536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258589 MGI:3030537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr704 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259034 MGI:3030539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258350 MGI:3030540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258173 MGI:3030542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr709-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258146 MGI:3030543
definition	gene_synonym : MOR260-7 note : olfactory receptor 709, pseudogene 1 pseudo : _no_value

name	Olfr710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233670 MGI:104713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259037 MGI:3030545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-1784824-1783474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257721
definition	note : olfactory receptor GA_x5J8B7W6B6J-1784824-1783474 pseudo : _no_value

name	Olfr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr713 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259036 MGI:3030547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr714 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259035 MGI:3030548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18314 MGI:109148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258776 MGI:3030549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr716 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258597 MGI:3030550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76858 MGI:1924108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700012H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60510 MGI:1926373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244198 MGI:2679264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppfibp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19024 MGI:894649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5330417H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76679 MGI:1923929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320635 MGI:2444415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244199 MGI:3045251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257919 MGI:3030301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr468-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404393 MGI:3030302
definition	note : olfactory receptor 468, pseudogene 1 pseudo : _no_value

name	Olfr469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258418 MGI:3030303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-2580381-2580079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257773
definition	note : olfactory receptor GA_x5J8B7W6B6J-2580381-2580079 pseudo : _no_value

name	Olfr470 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258417 MGI:3030304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626674 MGI:3030305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 486 Proteins

name	LOC626661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626661
definition	note : RNA-binding protein 3-like pseudo : _no_value

name	Olfr472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258770 MGI:3030306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258771 MGI:3030307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins pseudo : _no_value

name	Olfr474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258488 MGI:3030308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr476 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258926 MGI:3030310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258928 MGI:3030311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	Olfr478 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258729 MGI:3030312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr479 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257891 MGI:3030313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56861 MGI:3030314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr481 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258927 MGI:3030315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043059 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 200 ESTs, 1 Protein

name	Olfr482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258728 MGI:3030316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258730 MGI:3030317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258492 MGI:3030318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258041 MGI:3030319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258489 MGI:3030320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258042 MGI:3030321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1538-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258040 MGI:3031372
definition	gene_synonym : MOR204-31P note : olfactory receptor 1538, pseudogene 1 pseudo : _no_value

name	Olfr488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258727 MGI:3030322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr489-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258161 MGI:3030323
definition	gene_synonym : MOR204-26P note : olfactory receptor 489, pseudogene 1 pseudo : _no_value

name	Olfr490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258491 MGI:3030324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270967 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_001039160.2

name	Gvin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270957 GeneID:74558 MGI:1921808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase, very large interferon inducible 1 transcript_id : NM_029000.3

name	LOC672660 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257693 GeneID:672660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to very large inducible GTPase 1 transcript_id : XM_001478554.1

name	EG209380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802592 GeneID:209380 MGI:3647753
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG209380 transcript_id : NM_001001318.2

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257695 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI) transcript_id : XM_001478597.1

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380896 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI), transcript variant 2 transcript_id : XM_485982.3

name	Gm1966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380897 GeneID:434223 MGI:3584360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : gene model 1966, (NCBI), transcript variant 1 transcript_id : XM_001000891.1

name	Olfr693 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238889 GeneID:258445 MGI:3030527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 693 transcript_id : NM_146453.1

name	Olfr694 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238883 GeneID:258444 MGI:3030528
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 694 transcript_id : NM_146452.1

name	Olfr695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129452 GeneID:258591 MGI:3030529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 695 transcript_id : NM_146598.1

name	Olfr697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129454 GeneID:258592 MGI:3030531
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 697 transcript_id : NM_146599.1

name	Olfr698 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129450 GeneID:258595 MGI:3030532
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 698 transcript_id : NM_146602.1

name	Olfr699 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801485 GeneID:258180 MGI:3030533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 699 transcript_id : NM_001011862.1

name	Olfr700 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129448 GeneID:258593 MGI:3030534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 700 transcript_id : NM_146600.1

name	Olfr701 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368940 GeneID:66786 MGI:3030535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 701 transcript_id : NM_028910.2

name	Olfr702 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129458 GeneID:258590 MGI:3030536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 702 transcript_id : NM_146597.1

name	Olfr703 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129456 GeneID:258589 MGI:3030537
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 703 transcript_id : NM_146596.1

name	Olfr704 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801285 GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 704 transcript_id : NM_001011749.1

name	Olfr705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128880 GeneID:259034 MGI:3030539
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 705 transcript_id : NM_147032.1

name	Olfr706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129596 GeneID:258350 MGI:3030540
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 706 transcript_id : NM_146353.1

name	Olfr707 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174767 GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 707 transcript_id : NM_001005570.2

name	Olfr708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58531211 GeneID:258173 MGI:3030542
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 708 transcript_id : NM_001011542.1

name	Olfr710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128640 GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 710 transcript_id : NM_146601.1

name	Olfr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047479 GeneID:233670 MGI:104713
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 6 transcript_id : NM_206897.1

name	Olfr711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128878 GeneID:259037 MGI:3030545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 711 transcript_id : NM_147035.1

name	Olfr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242164 GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 2 transcript_id : NM_010983.1

name	Olfr713 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128876 GeneID:259036 MGI:3030547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 713 transcript_id : NM_147034.1

name	Olfr714 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128882 GeneID:259035 MGI:3030548
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 714 transcript_id : NM_147033.1

name	Olfr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181105 GeneID:18314 MGI:109148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 17 transcript_id : NM_020598.1

name	Olfr715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129286 GeneID:258776 MGI:3030549
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 715 transcript_id : NM_146780.1

name	Olfr716 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129444 GeneID:258597 MGI:3030550
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 716 transcript_id : NM_146604.1

name	Nlrp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50872154 GeneID:76858 MGI:1924108
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 14 transcript_id : NM_001002894.1

name	1700012H05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369862 GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012H05 gene transcript_id : NM_029660.2

name	Syt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802850 GeneID:60510 MGI:1926373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin IX transcript_id : NM_021889.3

name	Olfml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982547 GeneID:244198 MGI:2679264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin-like 1 transcript_id : NM_172907.2

name	Ppfibp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679434 GeneID:19024 MGI:894649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2 transcript_id : NM_008905.1

name	5330417H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257707 GeneID:76679 MGI:1923929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5330417H12 gene transcript_id : XM_001478760.1

name	Cyb5r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662404 GeneID:320635 MGI:2444415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 reductase 2 transcript_id : NM_177216.3

name	Ovch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892770 GeneID:244199 MGI:3045251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovochymase 2 transcript_id : NM_172908.3

name	Olfr467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828689 GeneID:257919 MGI:3030301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 467 transcript_id : NM_001005488.1

name	Olfr469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239107 GeneID:258418 MGI:3030303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 469 transcript_id : NM_146426.1

name	Olfr470 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239109 GeneID:258417 MGI:3030304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 470 transcript_id : NM_146425.1

name	Olfr471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257649 GeneID:626674 MGI:3030305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 486 Proteins product : olfactory receptor 471 transcript_id : XM_001487801.1

name	Olfr472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129298 GeneID:258770 MGI:3030306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 472 transcript_id : NM_146774.1

name	Olfr473 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129300 GeneID:258771 MGI:3030307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 473 transcript_id : NM_146775.1

name	Olfr474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239113 GeneID:258488 MGI:3030308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 474 transcript_id : NM_146495.1

name	Olfr476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227562 GeneID:258926 MGI:3030310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 476 transcript_id : NM_146924.1

name	Olfr477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239111 GeneID:258928 MGI:3030311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 477 transcript_id : NM_146926.1

name	Olfr478 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129376 GeneID:258729 MGI:3030312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 478 transcript_id : NM_146734.1

name	Olfr479 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801277 GeneID:257891 MGI:3030313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 479 transcript_id : NM_001011742.1

name	Olfr480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938015 GeneID:56861 MGI:3030314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 480 transcript_id : NM_020291.1

name	Olfr481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544956 GeneID:258927 MGI:3030315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 481 transcript_id : NM_146925.1

name	LOC100043059 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257713 GeneID:100043059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 200 ESTs, 1 Protein product : hypothetical protein LOC100043059 transcript_id : XM_001478802.1

name	Olfr482 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129374 GeneID:258728 MGI:3030316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 482 transcript_id : NM_146733.1

name	Olfr483 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129370 GeneID:258730 MGI:3030317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 483 transcript_id : NM_146735.1

name	Olfr484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239119 GeneID:258492 MGI:3030318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 484 transcript_id : NM_146499.1

name	Olfr485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801385 GeneID:258041 MGI:3030319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 485 transcript_id : NM_001011810.1

name	Olfr486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239117 GeneID:258489 MGI:3030320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 486 transcript_id : NM_146496.1

name	Olfr487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801387 GeneID:258042 MGI:3030321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 487 transcript_id : NM_001011811.1

name	Olfr488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380654 GeneID:258727 MGI:3030322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 488 transcript_id : NM_146732.1

name	Olfr490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239121 GeneID:258491 MGI:3030324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 490 transcript_id : NM_146498.1

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270968 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_001034249.2

name	Gvin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270958 CCDS:CCDS21663.1 GeneID:74558 MGI:1921808
definition	codon_start : 1 note : interferon inducible GTPase 1 product : very large inducible GTPase 1 protein_id : NP_083276.2

name	LOC672660 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257694 GeneID:672660
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478604.1

name	EG209380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47604974 GeneID:209380 MGI:3647753
definition	codon_start : 1 product : hypothetical protein LOC209380 protein_id : NP_001001318.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257696 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 protein_id : XP_001478647.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380898 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 isoform 1 protein_id : XP_001000891.1

name	Gm1966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907383 GeneID:434223 MGI:3584360
definition	codon_start : 1 product : hypothetical protein LOC434223 isoform 2 protein_id : XP_485982.2

name	Olfr693 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238890 CCDS:CCDS21665.1 GeneID:258445 MGI:3030527
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9055944-9054994; olfactory receptor MOR283-8 product : olfactory receptor 693 protein_id : NP_666664.1

name	Olfr694 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238884 CCDS:CCDS21666.1 GeneID:258444 MGI:3030528
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9067220-9066273; olfactory receptor MOR283-9 product : olfactory receptor 694 protein_id : NP_666663.1

name	Olfr695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129453 CCDS:CCDS21667.1 GeneID:258591 MGI:3030529
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9092181-9091234; olfactory receptor MOR283-6 product : olfactory receptor 695 protein_id : NP_666809.1

name	Olfr697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129455 CCDS:CCDS21668.1 GeneID:258592 MGI:3030531
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9119301-9118348; olfactory receptor MOR283-5 product : olfactory receptor 697 protein_id : NP_666810.1

name	Olfr698 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129451 CCDS:CCDS21669.1 GeneID:258595 MGI:3030532
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9130754-9129519; olfactory receptor MOR283-3 product : olfactory receptor 698 protein_id : NP_666813.1

name	Olfr699 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801486 CCDS:CCDS21670.1 GeneID:258180 MGI:3030533
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9168355-9167405; olfactory receptor MOR283-10P product : olfactory receptor 699 protein_id : NP_001011862.1

name	Olfr700 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129449 CCDS:CCDS21671.1 GeneID:258593 MGI:3030534
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9184187-9183237; olfactory receptor MOR283-4 product : olfactory receptor 700 protein_id : NP_666811.1

name	Olfr701 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312710 CCDS:CCDS21672.1 GeneID:66786 MGI:3030535
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9195805-9196755; olfactory receptor MOR283-1 product : olfactory receptor 701 protein_id : NP_083186.1

name	Olfr702 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129459 CCDS:CCDS21673.1 GeneID:258590 MGI:3030536
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9202245-9201289; olfactory receptor MOR260-4; B7 olfactory receptor product : olfactory receptor 702 protein_id : NP_666808.1

name	Olfr703 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129457 CCDS:CCDS21674.1 GeneID:258589 MGI:3030537
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9222217-9223176; olfactory receptor MOR283-7; T4 olfactory receptor product : olfactory receptor 703 protein_id : NP_666807.1

name	Olfr704 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801286 CCDS:CCDS21675.1 GeneID:257902 MGI:3030538
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9247095-9248042; olfactory receptor MOR283-12P; T3 olfactory receptor product : olfactory receptor 704 protein_id : NP_001011749.1

name	Olfr705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128881 CCDS:CCDS21676.1 GeneID:259034 MGI:3030539
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9256348-9255398; olfactory receptor MOR283-2; T2 olfactory receptor product : olfactory receptor 705 protein_id : NP_667243.1

name	Olfr706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129597 CCDS:CCDS21677.1 GeneID:258350 MGI:3030540
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9271198-9270248; olfactory receptor MOR283-11; T1 olfactory receptor product : olfactory receptor 706 protein_id : NP_666465.1

name	Olfr707 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174768 CCDS:CCDS21678.1 GeneID:194433 MGI:3030541
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9276470-9275547; olfactory receptor MOR260-8P; B6 olfactory receptor; B4 olfactory receptor product : olfactory receptor 707 protein_id : NP_001005570.2

name	Olfr708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58531212 CCDS:CCDS21679.1 GeneID:258173 MGI:3030542
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9297671-9298594; olfactory receptor MOR260-6P; B5 olfactory receptor product : olfactory receptor 708 protein_id : NP_001011542.1

name	Olfr710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128641 CCDS:CCDS21680.1 GeneID:258594 MGI:3030544
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9325348-9324416; olfactory receptor MOR260-3; B3 olfactory receptor product : olfactory receptor 710 protein_id : NP_666812.1

name	Olfr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047480 CCDS:CCDS21681.1 GeneID:233670 MGI:104713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9337331-9336381; m50 olfactory receptor product : olfactory receptor 6 protein_id : NP_996780.1

name	Olfr711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128879 CCDS:CCDS21682.1 GeneID:259037 MGI:3030545
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9352783-9351839; olfactory receptor MOR103-4; m51 olfactory receptor product : olfactory receptor 711 protein_id : NP_667246.1

name	Olfr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242165 CCDS:CCDS21683.1 GeneID:18317 MGI:97432
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9381439-9380456; I7 olfactory receptor; odorant receptor B2 product : olfactory receptor 41 protein_id : NP_035113.1

name	Olfr713 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128877 CCDS:CCDS21684.1 GeneID:259036 MGI:3030547
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9415724-9416677; olfactory receptor MOR263-1; P3 olfactory receptor product : olfactory receptor 713 protein_id : NP_667245.1

name	Olfr714 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128883 GeneID:259035 MGI:3030548
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9453401-9454354; olfactory receptor MOR263-2; P4 olfactory receptor product : olfactory receptor 714 protein_id : NP_667244.1

name	Olfr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181106 GeneID:18314 MGI:109148
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9470146-9471093; olfactory receptor MOR263-5; P2 olfactory receptor product : olfactory receptor 17 protein_id : NP_065623.1

name	Olfr715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129287 CCDS:CCDS21686.1 GeneID:258776 MGI:3030549
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9479517-9478573; olfactory receptor MOR260-1; B2 olfactory receptor product : olfactory receptor 715 protein_id : NP_666991.1

name	Olfr716 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129445 CCDS:CCDS21687.1 GeneID:258597 MGI:3030550
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9497411-9498355; olfactory receptor MOR260-2; B1 olfactory receptor product : olfactory receptor 716 protein_id : NP_666815.1

name	Nlrp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50872155 CCDS:CCDS21688.1 GeneID:76858 MGI:1924108
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : germ-cell specific leucine rich repeat NTPase; RNI-like protein; NACHT, leucine rich repeat and PYD containing 14 product : NACHT, leucine rich repeat and PYD containing 14-like protein_id : NP_001002894.1

name	1700012H05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301143 CCDS:CCDS21689.1 GeneID:76572 MGI:1923822
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : testes-specific heterogenous nuclear ribonucleoprotein G-T protein_id : NP_083936.1

name	Syt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543799 GeneID:60510 MGI:1926373
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : synaptotagmin V; synaptotagmin 9 product : synaptotagmin IX protein_id : NP_068689.2

name	Olfml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370390 GeneID:244198 MGI:2679264
definition	codon_start : 1 product : olfactomedin-like 1 protein_id : NP_766495.1

name	5330417H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257708 GeneID:76679 MGI:1923929
definition	codon_start : 1 product : hypothetical protein LOC76679 protein_id : XP_001478810.1

name	Ppfibp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679435 CCDS:CCDS21691.1 GeneID:19024 MGI:894649
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : liprin beta 2 product : protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2 protein_id : NP_032931.1

name	Cyb5r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893247 GeneID:320635 MGI:2444415
definition	GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 product : cytochrome b5 reductase b5R.2 protein_id : NP_796190.1

name	Ovch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34013516 CCDS:CCDS21692.1 GeneID:244199 MGI:3045251
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : oviductin product : oviductin precursor protein_id : NP_766496.2

name	Olfr467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828690 GeneID:257919 MGI:3030301
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10144091-10145011; olfactory receptor MOR204-33P product : olfactory receptor 467 protein_id : NP_001005488.1

name	Olfr469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239108 CCDS:CCDS21693.1 GeneID:258418 MGI:3030303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10152980-10152036; olfactory receptor MOR204-21 product : olfactory receptor 469 protein_id : NP_666637.1

name	Olfr470 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239110 CCDS:CCDS21694.1 GeneID:258417 MGI:3030304
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10175273-10174329; olfactory receptor MOR204-22 product : olfactory receptor 470 protein_id : NP_666636.1

name	Olfr471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257650 GeneID:626674 MGI:3030305
definition	codon_start : 1 product : similar to olfactory receptor Olfr471 protein_id : XP_001487851.1

name	Olfr472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129299 CCDS:CCDS21695.1 GeneID:258770 MGI:3030306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10231953-10232885; olfactory receptor MOR204-5 product : olfactory receptor 472 protein_id : NP_666985.1

name	Olfr473 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129301 CCDS:CCDS21696.1 GeneID:258771 MGI:3030307
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10262759-10263691; olfactory receptor MOR204-4 product : olfactory receptor 473 protein_id : NP_666986.1

name	Olfr474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239114 CCDS:CCDS21697.1 GeneID:258488 MGI:3030308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10283869-10284801; olfactory receptor MOR204-20 product : olfactory receptor 474 protein_id : NP_666706.1

name	Olfr476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227563 CCDS:CCDS21698.1 GeneID:258926 MGI:3030310
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10296787-10297719; olfactory receptor MOR204-3 product : olfactory receptor 476 protein_id : NP_667135.1

name	Olfr477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239112 CCDS:CCDS21699.1 GeneID:258928 MGI:3030311
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10319672-10320604; olfactory receptor MOR204-1 product : olfactory receptor 477 protein_id : NP_667137.1

name	Olfr478 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129377 CCDS:CCDS21700.1 GeneID:258729 MGI:3030312
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10361879-10360935; olfactory receptor MOR204-13 product : olfactory receptor 478 protein_id : NP_666945.1

name	Olfr479 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801278 CCDS:CCDS21701.1 GeneID:257891 MGI:3030313
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10384085-10385068; olfactory receptor MOR267-15 product : olfactory receptor 479 protein_id : NP_001011742.1

name	Olfr480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938016 CCDS:CCDS21702.1 GeneID:56861 MGI:3030314
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR204-32; GA_x6K02T2PBJ9-10395807-10394869 product : odorant receptor S25 protein_id : NP_064687.1

name	Olfr481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544957 CCDS:CCDS21703.1 GeneID:258927 MGI:3030315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10409785-10410723; olfactory receptor MOR204-2 product : olfactory receptor 481 protein_id : NP_667136.1

name	LOC100043059 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257714 GeneID:100043059
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478852.1

name	Olfr482 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129375 CCDS:CCDS21704.1 GeneID:258728 MGI:3030316
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10424354-10423383; olfactory receptor MOR204-14 product : olfactory receptor 482 protein_id : NP_666944.1

name	Olfr483 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129371 CCDS:CCDS21705.1 GeneID:258730 MGI:3030317
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10432095-10433042; olfactory receptor MOR204-12 product : olfactory receptor 483 protein_id : NP_666946.1

name	Olfr484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239120 CCDS:CCDS21706.1 GeneID:258492 MGI:3030318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10454128-10453163; olfactory receptor MOR204-16 product : olfactory receptor 484 protein_id : NP_666710.1

name	Olfr485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801386 GeneID:258041 MGI:3030319
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-10489044-10488091; MOR204-40_p; olfactory receptor MOR204-30P product : olfactory receptor 485 protein_id : NP_001011810.1

name	Olfr486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239118 CCDS:CCDS21707.1 GeneID:258489 MGI:3030320
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10501920-10500976; olfactory receptor MOR204-19 product : olfactory receptor 486 protein_id : NP_666707.1

name	Olfr487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801388 CCDS:CCDS21708.1 GeneID:258042 MGI:3030321
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10541702-10540758; olfactory receptor MOR204-29P product : olfactory receptor 487 protein_id : NP_001011811.1

name	Olfr488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380655 CCDS:CCDS21709.1 GeneID:258727 MGI:3030322
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10586187-10585243; olfactory receptor MOR204-15 product : olfactory receptor 488 protein_id : NP_666943.1

name	Olfr490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239122 CCDS:CCDS21710.1 GeneID:258491 MGI:3030324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10617173-10616229; olfactory receptor MOR204-17 product : olfactory receptor 490 protein_id : NP_666709.1

name	LOC100042097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042097
definition	number : 1 pseudo : _no_value

name	LOC100042141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042141
definition	number : 1 pseudo : _no_value

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 1 pseudo : _no_value

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 2 pseudo : _no_value

name	LOC100042278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042278
definition	number : 1 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 3 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 2 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 1 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 1 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 2 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 3 pseudo : _no_value

name	EG668117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380912 GeneID:668117 MGI:3644465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : predicted gene, EG668117 pseudo : _no_value transcript_id : XR_002142.1

name	LOC634394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257646 GeneID:634394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 3 Proteins product : similar to very large inducible GTPase 1 pseudo : _no_value transcript_id : XR_033283.1

name	EG668139 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94380919 GeneID:668139 MGI:3644223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 48 ESTs, 3 Proteins product : predicted gene, EG668139 transcript_id : XR_001627.1

name	LOC669301 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257651 GeneID:669301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins product : similar to suppressor of cytokine signaling 6 pseudo : _no_value transcript_id : XR_033485.1

name	LOC626732 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257712 GeneID:626732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : similar to peptidylprolyl isomerase A pseudo : _no_value transcript_id : XR_033898.1

clone name	MSMg01-487E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465G13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-121K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-306B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342K12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-100O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K21
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-030F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-211E09.b	B6Ng01-211E09.g
ACC	GA029387	GA029388
length	1,047	907
definition	B6Ng01-211E09.b	B6Ng01-211E09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,261,089 - 114,262,143)	(114,441,873 - 114,442,766)
sequence	gaattcaattactatatgaacaaaatcagaagtcagatggctttctgaaa cccaaaccacatcatcttctgatgcgattttgagcaatatttatacaaga tatgaaagaaagacagataacatgtggtttggcaaatttagcctgtgatt ttaattacaacagcaagtgtcccagggtgttgctgtaaaggacagaaagg taatatgctaaggactctcaaagcacgagggaatcccaggtttacacaac ctttaggaactcacctttaaatatttcctcaaaggaaaataattagaagc atgacctaagagacttggagcttgtactcagtgaagtaaagcagaggggc ataattagtataaagataaaactcctaagatcagtatgggctttgagaaa cttttcccagaagccagtgctgtcctttaagtctctccctcatgctaggt cttaggctccttcatggacgacacttccaacagtgtttctgctccatgcc tacattgaggtcagagaggggaagctgctaataggtctagttggcataat tctgtagggttggctggagattggggtagaagaaatatgctgtgttattg gccctcctactcgctcatagtttttcttattaggctcctaagcaaaaatt ctattcccattcttctccaaaattccagtctgtaaactggaatccaaact ttccccttcagggatgaagctcatggcctagggaccacaaagacacagag gccatgtcatccagtattgctctccctttggtgtggaaggcagctctgcc tggctctgtccttgttcagctatcagcctccagcttttcattgcttcctt agtttctatacatcccactatctccctttatgggtgacatactgaataca gcaagagttgcaaagacactaagaatattggtttgaggagctcatcagaa catgcttgggggctcaagttccttccgcccactgcagaccagggtccctg gacaggagtctcctgacacccgcaaggacccacacagatctgcacgg	gaattcatatacagtggaaaagcatggagtttatgttagatgaagtaaga cagacagaaaaaaatattgcattctcatatggggaaactaaaaaatgcaa aatagaaaacccacaaaagttgttagcagaggtgggggaggggctttgga agacgtaggtcaaagggtataaatcttacttgctgtttctcctggccacg agctcatggtccatctttccttaattgtgcaggataaatctagttagctt acagcaggagcagtagggtgaactgtagagagaagactgcatcctgcaat tagctaaaagagattttagatgttcttacacacaaaaaggtaaaaatatg agataacagaagtgttagcctacctaaatcatttcactgtagaaaaaagc ctaatatatatctattcattcatatattcattatatatatatatgaatga ataggaaactgtataattcacatgtatatcctgaatttacgcattctggt attcatctggttagctttacaatatcatactacttgtgaacttgatcgat tttagagcatttaagaagctcctctatattcaagagattctgattagata tttagaagtgtttgattaagtttgaaatcaacattaaatgtttaggaaaa atttaacctatggtgaataaatcttatttattagttgtgtatatgttgta taaaaatattcagtagggatgttattaatatttaaataaattatagattt caagggttaataaattggaagataataatgtttactcttcaggaatagca atttttttgacataaattaatcttcactgacatgacctacacagttttta gaatgagataactgggtgaatggggaatgaagagaaagaagacagacact gattctt
quality values	Open. Hide. 58 31 19 25 58 38 21 36 62 47 62 62 62 62 62 62 47 49 62 62 42 29 62 62 54 47 47 41 62 62 62 62 12 12 8 10 19 19 23 23 13 25 28 28 28 34 46 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 49 49 43 32 28 32 28 32 27 48 50 54 49 49 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 54 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 58 41 58 54 40 58 58 58 58 58 58 58 58 49 42 27 58 58 58 58 58 54 58 43 58 58 52 58 58 58 49 54 46 58 58 58 58 52 58 58 54 54 41 58 58 45 41 58 58 54 54 58 42 54 54 58 58 54 58 54 54 52 52 54 52 58 58 58 58 52 54 58 54 54 47 47 58 51 46 46 58 50 58 48 49 58 37 49 53 58 58 58 39 41 58 50 49 53 58 58 50 58 52 50 53 58 53 50 49 50 53 39 50 28 58 58 37 41 51 52 53 37 58 52 47 51 58 41 39 58 43 32 51 58 51 51 48 42 40 49 35 58 48 41 49 58 50 30 58 58 58 50 50 39 35 16 49 41 33 35 50 49 37 36 39 38 50 39 39 58 49 39 46 46 51 19 58 33 28 23 14 31 52 31 47 40 27 40 26 18 40 35 37 47 47 49 28 49 37 40 54 42 45 39 53 52 38 20 53 39 41 53 40 51 32 53 40 41 37 54 46 21 54 36 40 41 40 49 31 51 38 47 33 11 54 13 34 31 32 51 32 40 33 31 37 39 37 33 32 45 36 32 32 32 34 45 31 47 53 40 37 31 26 25 31 35 31 36 35 34 37 53 41 37 26 32 40 31 39 39 46 46 30 30 18 9 28 35 31 31 30 26 33 30 42 8 6 13 37 25 30 28 30 31 24 28 19 35 18 51 33 27 31 29 30 36 36 43 33 46 31 31 46 42 31 26 32 46 44 29 31 31 16 29 36 32 30 34 42 33 31 25 25 25 21 23 34 36 26 32 41 21 31 34 21 24 25 41 32 19 30 15 27 32 38 26 34 20 35 33 24 24 35 38 30 31 19 48 31 20 26 26 20 38 14 14 20 31 31 34 15 43 10 26 34 17 27 32 32 24 32 30 38 41 41 44 35 21 17 18 21 22 31 22 17 21 27 32 32 15 13 6 4 36 19 19 24 31 18 9 7 5 24 7 16 22 23 36 33 27 22 31 14 15 11 19 4 4 9 4 12 11 8 16 10 16 11 28 27 27 16 5 4 4 25 24 13 28 10 7 15 15 25 16 27 18 13 12 9 17 4 4 3 7 15 14 10 30 10 11 17 16	Open. Hide. 46 35 43 39 62 54 42 56 56 62 62 11 11 10 7 10 9 11 18 25 21 22 25 22 27 28 28 46 62 62 62 62 62 59 62 62 59 59 59 62 62 62 54 62 62 62 62 62 62 59 62 62 62 54 62 62 17 28 23 18 25 18 23 28 28 28 28 28 43 34 56 59 62 62 62 59 59 59 59 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 54 48 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 56 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 56 62 59 59 62 62 62 62 62 51 62 62 54 59 59 56 56 59 59 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 49 51 59 34 43 17 33 56 56 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 56 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 47 47 56 62 62 47 62 62 54 62 56 62 62 56 56 54 62 62 62 62 56 62 56 56 52 62 62 62 26 24 12 6 17 17 27 46 54 50 47 54 62 42 62 38 47 54 54 54 47 22 54 52 62 54 62 52 54 52 52 52 42 58 52 42 54 58 52 46 54 58 58 34 45 21 41 42 54 58 54 48 54 58 58 54 54 30 54 54 46 45 45 51 54 54 54 52 39 54 52 52 39 54 54 54 54 54 30 52 58 54 39 41 52 58 51 54 38 45 54 42 58 54 58 32 37 58 47 50 58 46 53 45 33 58 58 46 24 25 27 12 19 27 58 50 58 37 53 50 50 51 51 37 26 37 32 41 42 22 58 50 50 30 28 35 39 32 54 31 37 35 44 9 43 6 42 32 44 19 58 29 37 29 18 36 54 53 52 52 48 32 50 30 53 29 49 26 50 52 42 39 50 31 47 32 52 31 19 12 50 40 58 40 26 36 21 47 50 49 43 19 26 15 20 22 31 54 19 33 15 32 39 12 6 11 24 32 18 13 9 11 34 43 49 36 17 22 13 11 25 28 42 42 32 28 30 26 33 29 49 51 41 47 45 23 12 18 32 25 51 36 31 14 35 19 35 26 47 23 11 19 40 21 37 37 42 39 33 11 13 21 17 26 51 27 32 45 21 37 15 53 41 29 16 25 9 15 13 33 29 21 25 32 17 32 36 32 31 32 31 52 40 19 19 27 25 18 10 9 32 34 24 30 32 30 31 30 29 6 10 9 10 23 15 13 29 27 9 27 20 8 16 26 14 13 21 8 8 15 14 15 23 7 30

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_114261089_114262143
seq2: B6Ng01-211E09.b_44_1090

seq1  GAATTCAATTACTATATGAACAAAATCAGAAGTCAGATGGCTTTCTGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATTACTATATGAACAAAATCAGAAGTCAGATGGCTTTCTGAAA  50

seq1  CCCAAACCACATCATCTTCTGATGCGATTTTGAGCAATATTTATACAAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAACCACATCATCTTCTGATGCGATTTTGAGCAATATTTATACAAGA  100

seq1  TATGAAAGAAAGACAGATAACATGTGGTTTGGCAAATTTAGCCTGTGATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAAGAAAGACAGATAACATGTGGTTTGGCAAATTTAGCCTGTGATT  150

seq1  TTAATTACAACAGCAAGTGTCCCAGGGTGTTGCTGTAAAGGACAGAAAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTACAACAGCAAGTGTCCCAGGGTGTTGCTGTAAAGGACAGAAAGG  200

seq1  TAATATGCTAAGGACTCTCAAAGCACGAGGGAATCCCAGGTTTACACAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATATGCTAAGGACTCTCAAAGCACGAGGGAATCCCAGGTTTACACAAC  250

seq1  CTTTAGGAACTCACCTTTAAATATTTCCTCAAAGGAAAATAATTAGAAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGGAACTCACCTTTAAATATTTCCTCAAAGGAAAATAATTAGAAGC  300

seq1  ATGACCTAAGAGACTTGGAGCTTGTACTCAGTGAAGTAAAGCAGAGGGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACCTAAGAGACTTGGAGCTTGTACTCAGTGAAGTAAAGCAGAGGGGC  350

seq1  ATAATTAGTATAAAGATAAAACTCCTAAGATCAGTATGGGCTTTGAGAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATTAGTATAAAGATAAAACTCCTAAGATCAGTATGGGCTTTGAGAAA  400

seq1  CTTTTCCCAGAAGCCAGTGCTGTCCTTTAAGTCTCTCCCTCATGCTAGGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTCCCAGAAGCCAGTGCTGTCCTTTAAGTCTCTCCCTCATGCTAGGT  450

seq1  CTTAGGCTCCTTCATGGACGACACTTCCAACAGTGTTTCTGCTCCATGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGCTCCTTCATGGACGACACTTCCAACAGTGTTTCTGCTCCATGCC  500

seq1  TACATTGAGGTCAGAGAGGGGAAGCTGCTAATAGGTCTAGTTGGCATAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTGAGGTCAGAGAGGGGAAGCTGCTAATAGGTCTAGTTGGCATAAT  550

seq1  TCTGTAGGGTTGGCTGGAGATTGGGGTAGAAGAAATATGCTGTGTTATTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTAGGGTTGGCTGGAGATTGGGGTAGAAGAAATATGCTGTGTTATTG  600

seq1  GCCCTCCTACTCGCTCATAGTTTTTCTTATTAGGCTCCTAAGCAAAAATT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTCCTACTCGCTCATAGTTTTTCTTATTAGGCTCCTAAGCAAAAATT  650

seq1  CTATTCCCATTCTTCTCCAAAATTCCAGTCTGTAAACTGGAATCCAAACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTCCCATTCTTCTCCAAAATTCCAGTCTGTAAACTGGAATCCAAACT  700

seq1  TTCCCCTTCAGGGATGAAGCTCATGGCCTAGGGACCACAAAGACACAGAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCTTCAGGGATGAAGCTCATGGCCTAGGGACCACAAAGACACAGAG  750

seq1  GCCATGTCATCCAGTATTGCTCTCCCTTTGGTGTGGAAGGCAGCTCTGCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATGTCATCCAGTATTGCTCTCCCTTTGGTGTGGAAGGCAGCTCTGCC  800

seq1  TGGCTCTGTCCTTGTTCAGCTATCAGCCTCCAGCTTTTCATTGCTTCCTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCTGTCCTTGTTCAGCTATCAGCCTCCAGCTTTTCATTGCTTCCTT  850

seq1  AGGTTTCTATACATCCCACTATCTCCCTTTATGGGTGACATACTGAATAC  900
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  A-GTTTCTATACATCCCACTATCTCCCTTTATGGGTGACATACTGAATAC  899

seq1  AGCAAGAGTTGCAAAGACACTAAGAATATTGGTTTGAGGAGCTCATCAAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  AGCAAGAGTTGCAAAGACACTAAGAATATTGGTTTGAGGAGCTCATC-AG  948

seq1  AACATGCTTGGGGGCTCAAGTTCCTTCCGGCCCACTGCAGAACCAGGGTC  1000
      |||||||||||||||||||||||||||| ||||||||||| |||||||||
seq2  AACATGCTTGGGGGCTCAAGTTCCTTCC-GCCCACTGCAG-ACCAGGGTC  996

seq1  CCTGGACAAGGGAGTCTCCTGACACCCGCAAGGACCCACACAGGATCTGC  1050
      ||||||||  |||||||||||||||||||||||||||||||| |||||| 
seq2  CCTGGACA--GGAGTCTCCTGACACCCGCAAGGACCCACACA-GATCTG-  1042

seq1  CACGG  1055
      |||||
seq2  CACGG  1047

seq1: chr7_114441873_114442766
seq2: B6Ng01-211E09.g_69_967 (reverse)

seq1  GTGTCTGTCTTCTTTCTCTTCATTCCCCA-TCACCCAGTTATCTCATTCT  49
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GTGTCTGTCTTCTTTCTCTTCATTCCCCATTCACCCAGTTATCTCATTCT  50

seq1  TAAAACTGTGTAGGTCATGTCAGTG-AGATTAATTTATGTCAAAAAAATT  98
       |||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AAAAACTGTGTAGGTCATGTCAGTGAAGATTAATTTATGTCAAAAAAATT  100

seq1  GCTATTCCTGAAGAGT-AACATTATTATCTTCCAATTTATTAACCCTTGA  147
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  GCTATTCCTGAAGAGTAAACATTATTATCTTCCAATTTATTAACCCTTGA  150

seq1  AATCTATAATTTATTTAAATATTAATAACAT-CCTACTGAATATTTTTAT  196
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  AATCTATAATTTATTTAAATATTAATAACATCCCTACTGAATATTTTTAT  200

seq1  ACAACATATACACAACTAATAAATAAGATTTATTCACCATAGGTTAAA-T  245
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ACAACATATACACAACTAATAAATAAGATTTATTCACCATAGGTTAAATT  250

seq1  TTTCCTAAACATTTAATGTTGATTTCAAACTTAATCAAACACTTCTAAAT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTAAACATTTAATGTTGATTTCAAACTTAATCAAACACTTCTAAAT  300

seq1  ATCTAATCAGAATCTCTTGAATATAGAGGAGCTTCTTAAATGCTCTAAAA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTAATCAGAATCTCTTGAATATAGAGGAGCTTCTTAAATGCTCTAAAA  350

seq1  TCGATCAAGTTCACAAGTAGTATGATATTGTAAAGCTAACCAGATGAATA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGATCAAGTTCACAAGTAGTATGATATTGTAAAGCTAACCAGATGAATA  400

seq1  CCAGAATGCGTAAATTCAGGATATACATGTGAATTATACAGTTTCCTATT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAATGCGTAAATTCAGGATATACATGTGAATTATACAGTTTCCTATT  450

seq1  CATTCATATATATATATAATGAATATATGAATGAATAGATATATATTAGG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCATATATATATATAATGAATATATGAATGAATAGATATATATTAGG  500

seq1  CTTTTTTCTACAGTGAAATGATTTAGGTAGGCTAACACTTCTGTTATCTC  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTTCTACAGTGAAATGATTTAGGTAGGCTAACACTTCTGTTATCTC  550

seq1  ATATTTTTACCTTTTTGTGTGTAAGAACATCTAAAATCTCTTTTAGCTAA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTTTACCTTTTTGTGTGTAAGAACATCTAAAATCTCTTTTAGCTAA  600

seq1  TTGCAGGATGCAGTCTTCTCTCTACAGTTCACCCTACTGCTCCTGCTGTA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAGGATGCAGTCTTCTCTCTACAGTTCACCCTACTGCTCCTGCTGTA  650

seq1  AGCTAACTAGATTTATCCTGCACAATTAAGGAAAGATGGACCATGAGCTC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAACTAGATTTATCCTGCACAATTAAGGAAAGATGGACCATGAGCTC  700

seq1  GTGGCCAGGAGAAACAGCAAGTAAGATTTATACCCTTTGACCTACGTCTT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCAGGAGAAACAGCAAGTAAGATTTATACCCTTTGACCTACGTCTT  750

seq1  CCAAAGCCCCTCCCCCACCTCTGCTAACAACTTTTGTGGGTTTTCTATTT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGCCCCTCCCCCACCTCTGCTAACAACTTTTGTGGGTTTTCTATTT  800

seq1  TGCATTTTTTAGTTTCCCCATATGAGAATGCAATATTTTTTTCTGTCTGT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATTTTTTAGTTTCCCCATATGAGAATGCAATATTTTTTTCTGTCTGT  850

seq1  CTTACTTCATCTAACATAAACTCCATGCTTTTCCACTGTATATGAATTC  894
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACTTCATCTAACATAAACTCCATGCTTTTCCACTGTATATGAATTC  899

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information