MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-211J20
Chromosome	7 (Build37)
Map Location	115,005,047 - 115,130,955
singlet/doublet	doublet
Overlap gene	Olfr471, LOC626661, Olfr472, Olfr473, LOC669301, Olfr474, Olfr476
Upstream gene	Olfr704, Olfr705, Olfr706, Olfr707, Olfr708, Olfr709-ps1, Olfr710, LOC384651, Olfr6, Olfr711, GA_x5J8B7W6B6J-1784824-1783474, Olfr2, Olfr713, Olfr714, Olfr17, Olfr715, Olfr716, Nlrp14, LOC100042278, 1700012H05Rik, Syt9, Olfml1, Ppfibp2, 5330417H12Rik, Cyb5r2, Ovch2, LOC100042310, Olfr467, Olfr468-ps1, Olfr469, GA_x5J8B7W6B6J-2580381-2580079, Olfr470
Downstream gene	Olfr477, LOC626732, Olfr478, Olfr479, Olfr480, Olfr481, LOC100043059, Olfr482, Olfr483, Olfr484, Olfr485, Olfr486, Olfr487, Olfr1538-ps1, Olfr488, LOC546990, Olfr489-ps1, Olfr490, LOC626881, Olfr491, Olfr492, Olfr493, Olfr494, Olfr495, Olfr496-ps1, Olfr497, Olfr498, Olfr499-ps1, Olfr500-ps1, Olfr501-ps1, Olfr502, LOC269980, Olfr503, Olfr504, Olfr505-ps1, Olfr506, Olfr507, Olfr508, Olfr509, Olfr510, Olfr511-ps1, Olfr512, Olfr513, Olfr514, Olfr515-ps1, Olfr516, Olfr517, Olfr518, Olfr519, Nlrp10, Eif3s5, BC049265
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr704 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259034 MGI:3030539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258350 MGI:3030540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258173 MGI:3030542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr709-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258146 MGI:3030543
definition	gene_synonym : MOR260-7 note : olfactory receptor 709, pseudogene 1 pseudo : _no_value

name	Olfr710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233670 MGI:104713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259037 MGI:3030545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-1784824-1783474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257721
definition	note : olfactory receptor GA_x5J8B7W6B6J-1784824-1783474 pseudo : _no_value

name	Olfr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr713 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259036 MGI:3030547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr714 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259035 MGI:3030548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18314 MGI:109148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258776 MGI:3030549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr716 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258597 MGI:3030550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76858 MGI:1924108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700012H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60510 MGI:1926373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244198 MGI:2679264
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppfibp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19024 MGI:894649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5330417H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76679 MGI:1923929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320635 MGI:2444415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ovch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244199 MGI:3045251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257919 MGI:3030301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr468-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404393 MGI:3030302
definition	note : olfactory receptor 468, pseudogene 1 pseudo : _no_value

name	Olfr469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258418 MGI:3030303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6B6J-2580381-2580079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257773
definition	note : olfactory receptor GA_x5J8B7W6B6J-2580381-2580079 pseudo : _no_value

name	Olfr470 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258417 MGI:3030304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626674 MGI:3030305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 486 Proteins

name	LOC626661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626661
definition	note : RNA-binding protein 3-like pseudo : _no_value

name	Olfr472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258770 MGI:3030306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258771 MGI:3030307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins pseudo : _no_value

name	Olfr474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258488 MGI:3030308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr476 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258926 MGI:3030310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258928 MGI:3030311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	Olfr478 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258729 MGI:3030312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr479 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257891 MGI:3030313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56861 MGI:3030314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr481 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258927 MGI:3030315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043059 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 200 ESTs, 1 Protein

name	Olfr482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258728 MGI:3030316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258730 MGI:3030317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258492 MGI:3030318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258041 MGI:3030319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr486 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258489 MGI:3030320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258042 MGI:3030321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1538-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258040 MGI:3031372
definition	gene_synonym : MOR204-31P note : olfactory receptor 1538, pseudogene 1 pseudo : _no_value

name	Olfr488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258727 MGI:3030322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr489-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258161 MGI:3030323
definition	gene_synonym : MOR204-26P note : olfactory receptor 489, pseudogene 1 pseudo : _no_value

name	Olfr490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258491 MGI:3030324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258731 MGI:3030325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr492 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258490 MGI:3030326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258307 MGI:3030327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258732 MGI:3030328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr495 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258361 MGI:3030329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr496-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258053 MGI:3030330
definition	gene_synonym : MOR204-28P note : olfactory receptor 496, pseudogene 1 pseudo : _no_value

name	Olfr497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258733 MGI:3030331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258304 MGI:3030332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr499-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404396 MGI:3030333
definition	note : olfactory receptor 499, pseudogene 1 pseudo : _no_value

name	Olfr500-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258162 MGI:3030334
definition	gene_synonym : MOR204-25P note : olfactory receptor 500, pseudogene 1 pseudo : _no_value

name	Olfr501-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258054 MGI:3030335
definition	gene_synonym : MOR204-27P note : olfactory receptor 501, pseudogene 1 pseudo : _no_value

name	Olfr502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258734 MGI:3030336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC269980 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:269980
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Olfr503 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259143 MGI:3030337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258163 MGI:3030338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr505-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258164 MGI:3030339
definition	gene_synonym : MOR204-24P note : olfactory receptor 505, pseudogene 1 pseudo : _no_value

name	Olfr506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258215 MGI:3030340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258738 MGI:3030341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr508 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258769 MGI:3030342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258369 MGI:3030343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258308 MGI:3030344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr511-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404397 MGI:3030345
definition	note : olfactory receptor 511, pseudogene 1 pseudo : _no_value

name	Olfr512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258719 MGI:3030346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258718 MGI:3030347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr514 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258721 MGI:3030348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr515-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404398 MGI:3030349
definition	note : olfactory receptor 515, pseudogene 1 pseudo : _no_value

name	Olfr516 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258720 MGI:3030350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr517 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258136 MGI:3030351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258303 MGI:3030352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr519 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277935 MGI:3030353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244202 MGI:2444084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66085 MGI:1913335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC049265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414075 MGI:3041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Olfr704 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801285 GeneID:257902 MGI:3030538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 704 transcript_id : NM_001011749.1

name	Olfr705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128880 GeneID:259034 MGI:3030539
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 705 transcript_id : NM_147032.1

name	Olfr706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129596 GeneID:258350 MGI:3030540
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 706 transcript_id : NM_146353.1

name	Olfr707 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174767 GeneID:194433 MGI:3030541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 707 transcript_id : NM_001005570.2

name	Olfr708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58531211 GeneID:258173 MGI:3030542
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 708 transcript_id : NM_001011542.1

name	Olfr710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128640 GeneID:258594 MGI:3030544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 710 transcript_id : NM_146601.1

name	Olfr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047479 GeneID:233670 MGI:104713
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 6 transcript_id : NM_206897.1

name	Olfr711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128878 GeneID:259037 MGI:3030545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 711 transcript_id : NM_147035.1

name	Olfr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242164 GeneID:18317 MGI:97432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 2 transcript_id : NM_010983.1

name	Olfr713 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128876 GeneID:259036 MGI:3030547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 713 transcript_id : NM_147034.1

name	Olfr714 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128882 GeneID:259035 MGI:3030548
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 714 transcript_id : NM_147033.1

name	Olfr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181105 GeneID:18314 MGI:109148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 17 transcript_id : NM_020598.1

name	Olfr715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129286 GeneID:258776 MGI:3030549
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 715 transcript_id : NM_146780.1

name	Olfr716 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129444 GeneID:258597 MGI:3030550
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 716 transcript_id : NM_146604.1

name	Nlrp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50872154 GeneID:76858 MGI:1924108
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 14 transcript_id : NM_001002894.1

name	1700012H05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369862 GeneID:76572 MGI:1923822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012H05 gene transcript_id : NM_029660.2

name	Syt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802850 GeneID:60510 MGI:1926373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin IX transcript_id : NM_021889.3

name	Olfml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982547 GeneID:244198 MGI:2679264
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactomedin-like 1 transcript_id : NM_172907.2

name	Ppfibp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679434 GeneID:19024 MGI:894649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2 transcript_id : NM_008905.1

name	5330417H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257707 GeneID:76679 MGI:1923929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5330417H12 gene transcript_id : XM_001478760.1

name	Cyb5r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662404 GeneID:320635 MGI:2444415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 reductase 2 transcript_id : NM_177216.3

name	Ovch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892770 GeneID:244199 MGI:3045251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovochymase 2 transcript_id : NM_172908.3

name	Olfr467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828689 GeneID:257919 MGI:3030301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 467 transcript_id : NM_001005488.1

name	Olfr469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239107 GeneID:258418 MGI:3030303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 469 transcript_id : NM_146426.1

name	Olfr470 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239109 GeneID:258417 MGI:3030304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 470 transcript_id : NM_146425.1

name	Olfr471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257649 GeneID:626674 MGI:3030305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 486 Proteins product : olfactory receptor 471 transcript_id : XM_001487801.1

name	Olfr472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129298 GeneID:258770 MGI:3030306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 472 transcript_id : NM_146774.1

name	Olfr473 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129300 GeneID:258771 MGI:3030307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 473 transcript_id : NM_146775.1

name	Olfr474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239113 GeneID:258488 MGI:3030308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 474 transcript_id : NM_146495.1

name	Olfr476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227562 GeneID:258926 MGI:3030310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 476 transcript_id : NM_146924.1

name	Olfr477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239111 GeneID:258928 MGI:3030311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 477 transcript_id : NM_146926.1

name	Olfr478 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129376 GeneID:258729 MGI:3030312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 478 transcript_id : NM_146734.1

name	Olfr479 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801277 GeneID:257891 MGI:3030313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 479 transcript_id : NM_001011742.1

name	Olfr480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938015 GeneID:56861 MGI:3030314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 480 transcript_id : NM_020291.1

name	Olfr481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544956 GeneID:258927 MGI:3030315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 481 transcript_id : NM_146925.1

name	LOC100043059 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257713 GeneID:100043059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 200 ESTs, 1 Protein product : hypothetical protein LOC100043059 transcript_id : XM_001478802.1

name	Olfr482 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129374 GeneID:258728 MGI:3030316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 482 transcript_id : NM_146733.1

name	Olfr483 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129370 GeneID:258730 MGI:3030317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 483 transcript_id : NM_146735.1

name	Olfr484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239119 GeneID:258492 MGI:3030318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 484 transcript_id : NM_146499.1

name	Olfr485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801385 GeneID:258041 MGI:3030319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 485 transcript_id : NM_001011810.1

name	Olfr486 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239117 GeneID:258489 MGI:3030320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 486 transcript_id : NM_146496.1

name	Olfr487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801387 GeneID:258042 MGI:3030321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 487 transcript_id : NM_001011811.1

name	Olfr488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380654 GeneID:258727 MGI:3030322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 488 transcript_id : NM_146732.1

name	Olfr490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239121 GeneID:258491 MGI:3030324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 490 transcript_id : NM_146498.1

name	Olfr491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129372 GeneID:258731 MGI:3030325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 491 transcript_id : NM_146736.1

name	Olfr492 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239115 GeneID:258490 MGI:3030326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 492 transcript_id : NM_146497.1

name	Olfr493 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129670 GeneID:258307 MGI:3030327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 493 transcript_id : NM_146310.1

name	Olfr494 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129366 GeneID:258732 MGI:3030328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 494 transcript_id : NM_146737.1

name	Olfr495 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129570 GeneID:258361 MGI:3030329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 495 transcript_id : NM_146364.1

name	Olfr497 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129368 GeneID:258733 MGI:3030331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 497 transcript_id : NM_146738.1

name	Olfr498 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129672 GeneID:258304 MGI:3030332
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 498 transcript_id : NM_146307.1

name	Olfr502 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129362 GeneID:258734 MGI:3030336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 502 transcript_id : NM_146739.1

name	Olfr503 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372131 GeneID:259143 MGI:3030337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 503 transcript_id : NM_001011527.1

name	Olfr504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801473 GeneID:258163 MGI:3030338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 504 transcript_id : NM_001011858.1

name	Olfr506 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801495 GeneID:258215 MGI:3030340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 506 transcript_id : NM_001011871.1

name	Olfr507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129354 GeneID:258738 MGI:3030341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 507 transcript_id : NM_146743.1

name	Olfr508 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129304 GeneID:258769 MGI:3030342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 508 transcript_id : NM_146773.1

name	Olfr509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129560 GeneID:258369 MGI:3030343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 509 transcript_id : NM_146372.1

name	Olfr510 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129664 GeneID:258308 MGI:3030344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 510 transcript_id : NM_146311.1

name	Olfr512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129392 GeneID:258719 MGI:3030346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 512 transcript_id : NM_146724.1

name	Olfr513 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129390 GeneID:258718 MGI:3030347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 513 transcript_id : NM_146723.1

name	Olfr514 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129388 GeneID:258721 MGI:3030348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 514 transcript_id : NM_146726.1

name	Olfr516 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129386 GeneID:258720 MGI:3030350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 516 transcript_id : NM_146725.1

name	Olfr517 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801449 GeneID:258136 MGI:3030351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 517 transcript_id : NM_001011846.1

name	Olfr518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129678 GeneID:258303 MGI:3030352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 518 transcript_id : NM_146306.1

name	Olfr519 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53850578 GeneID:277935 MGI:3030353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 519 transcript_id : NM_207160.1

name	Nlrp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872194 GeneID:244202 MGI:2444084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 10 transcript_id : NM_175532.3

name	Eif3s5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313619 GeneID:66085 MGI:1913335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 5 (epsilon) transcript_id : NM_025344.1

name	BC049265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257719 GeneID:414075 MGI:3041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : cDNA sequence BC049265 transcript_id : XM_001478990.1

name	Olfr704 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801286 CCDS:CCDS21675.1 GeneID:257902 MGI:3030538
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9247095-9248042; olfactory receptor MOR283-12P; T3 olfactory receptor product : olfactory receptor 704 protein_id : NP_001011749.1

name	Olfr705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128881 CCDS:CCDS21676.1 GeneID:259034 MGI:3030539
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9256348-9255398; olfactory receptor MOR283-2; T2 olfactory receptor product : olfactory receptor 705 protein_id : NP_667243.1

name	Olfr706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129597 CCDS:CCDS21677.1 GeneID:258350 MGI:3030540
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9271198-9270248; olfactory receptor MOR283-11; T1 olfactory receptor product : olfactory receptor 706 protein_id : NP_666465.1

name	Olfr707 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174768 CCDS:CCDS21678.1 GeneID:194433 MGI:3030541
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9276470-9275547; olfactory receptor MOR260-8P; B6 olfactory receptor; B4 olfactory receptor product : olfactory receptor 707 protein_id : NP_001005570.2

name	Olfr708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58531212 CCDS:CCDS21679.1 GeneID:258173 MGI:3030542
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9297671-9298594; olfactory receptor MOR260-6P; B5 olfactory receptor product : olfactory receptor 708 protein_id : NP_001011542.1

name	Olfr710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128641 CCDS:CCDS21680.1 GeneID:258594 MGI:3030544
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9325348-9324416; olfactory receptor MOR260-3; B3 olfactory receptor product : olfactory receptor 710 protein_id : NP_666812.1

name	Olfr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047480 CCDS:CCDS21681.1 GeneID:233670 MGI:104713
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9337331-9336381; m50 olfactory receptor product : olfactory receptor 6 protein_id : NP_996780.1

name	Olfr711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128879 CCDS:CCDS21682.1 GeneID:259037 MGI:3030545
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9352783-9351839; olfactory receptor MOR103-4; m51 olfactory receptor product : olfactory receptor 711 protein_id : NP_667246.1

name	Olfr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242165 CCDS:CCDS21683.1 GeneID:18317 MGI:97432
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9381439-9380456; I7 olfactory receptor; odorant receptor B2 product : olfactory receptor 41 protein_id : NP_035113.1

name	Olfr713 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128877 CCDS:CCDS21684.1 GeneID:259036 MGI:3030547
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9415724-9416677; olfactory receptor MOR263-1; P3 olfactory receptor product : olfactory receptor 713 protein_id : NP_667245.1

name	Olfr714 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128883 GeneID:259035 MGI:3030548
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9453401-9454354; olfactory receptor MOR263-2; P4 olfactory receptor product : olfactory receptor 714 protein_id : NP_667244.1

name	Olfr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181106 GeneID:18314 MGI:109148
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-9470146-9471093; olfactory receptor MOR263-5; P2 olfactory receptor product : olfactory receptor 17 protein_id : NP_065623.1

name	Olfr715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129287 CCDS:CCDS21686.1 GeneID:258776 MGI:3030549
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9479517-9478573; olfactory receptor MOR260-1; B2 olfactory receptor product : olfactory receptor 715 protein_id : NP_666991.1

name	Olfr716 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129445 CCDS:CCDS21687.1 GeneID:258597 MGI:3030550
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-9497411-9498355; olfactory receptor MOR260-2; B1 olfactory receptor product : olfactory receptor 716 protein_id : NP_666815.1

name	Nlrp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50872155 CCDS:CCDS21688.1 GeneID:76858 MGI:1924108
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : germ-cell specific leucine rich repeat NTPase; RNI-like protein; NACHT, leucine rich repeat and PYD containing 14 product : NACHT, leucine rich repeat and PYD containing 14-like protein_id : NP_001002894.1

name	1700012H05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301143 CCDS:CCDS21689.1 GeneID:76572 MGI:1923822
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : testes-specific heterogenous nuclear ribonucleoprotein G-T protein_id : NP_083936.1

name	Syt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543799 GeneID:60510 MGI:1926373
definition	GO_component : GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : synaptotagmin V; synaptotagmin 9 product : synaptotagmin IX protein_id : NP_068689.2

name	Olfml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370390 GeneID:244198 MGI:2679264
definition	codon_start : 1 product : olfactomedin-like 1 protein_id : NP_766495.1

name	5330417H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257708 GeneID:76679 MGI:1923929
definition	codon_start : 1 product : hypothetical protein LOC76679 protein_id : XP_001478810.1

name	Ppfibp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679435 CCDS:CCDS21691.1 GeneID:19024 MGI:894649
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : liprin beta 2 product : protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2 protein_id : NP_032931.1

name	Cyb5r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893247 GeneID:320635 MGI:2444415
definition	GO_function : GO:0004128 - cytochrome-b5 reductase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] codon_start : 1 product : cytochrome b5 reductase b5R.2 protein_id : NP_796190.1

name	Ovch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34013516 CCDS:CCDS21692.1 GeneID:244199 MGI:3045251
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : oviductin product : oviductin precursor protein_id : NP_766496.2

name	Olfr467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828690 GeneID:257919 MGI:3030301
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10144091-10145011; olfactory receptor MOR204-33P product : olfactory receptor 467 protein_id : NP_001005488.1

name	Olfr469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239108 CCDS:CCDS21693.1 GeneID:258418 MGI:3030303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10152980-10152036; olfactory receptor MOR204-21 product : olfactory receptor 469 protein_id : NP_666637.1

name	Olfr470 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239110 CCDS:CCDS21694.1 GeneID:258417 MGI:3030304
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10175273-10174329; olfactory receptor MOR204-22 product : olfactory receptor 470 protein_id : NP_666636.1

name	Olfr471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257650 GeneID:626674 MGI:3030305
definition	codon_start : 1 product : similar to olfactory receptor Olfr471 protein_id : XP_001487851.1

name	Olfr472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129299 CCDS:CCDS21695.1 GeneID:258770 MGI:3030306
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10231953-10232885; olfactory receptor MOR204-5 product : olfactory receptor 472 protein_id : NP_666985.1

name	Olfr473 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129301 CCDS:CCDS21696.1 GeneID:258771 MGI:3030307
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10262759-10263691; olfactory receptor MOR204-4 product : olfactory receptor 473 protein_id : NP_666986.1

name	Olfr474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239114 CCDS:CCDS21697.1 GeneID:258488 MGI:3030308
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10283869-10284801; olfactory receptor MOR204-20 product : olfactory receptor 474 protein_id : NP_666706.1

name	Olfr476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227563 CCDS:CCDS21698.1 GeneID:258926 MGI:3030310
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10296787-10297719; olfactory receptor MOR204-3 product : olfactory receptor 476 protein_id : NP_667135.1

name	Olfr477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239112 CCDS:CCDS21699.1 GeneID:258928 MGI:3030311
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10319672-10320604; olfactory receptor MOR204-1 product : olfactory receptor 477 protein_id : NP_667137.1

name	Olfr478 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129377 CCDS:CCDS21700.1 GeneID:258729 MGI:3030312
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10361879-10360935; olfactory receptor MOR204-13 product : olfactory receptor 478 protein_id : NP_666945.1

name	Olfr479 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801278 CCDS:CCDS21701.1 GeneID:257891 MGI:3030313
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10384085-10385068; olfactory receptor MOR267-15 product : olfactory receptor 479 protein_id : NP_001011742.1

name	Olfr480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938016 CCDS:CCDS21702.1 GeneID:56861 MGI:3030314
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR204-32; GA_x6K02T2PBJ9-10395807-10394869 product : odorant receptor S25 protein_id : NP_064687.1

name	Olfr481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544957 CCDS:CCDS21703.1 GeneID:258927 MGI:3030315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10409785-10410723; olfactory receptor MOR204-2 product : olfactory receptor 481 protein_id : NP_667136.1

name	LOC100043059 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257714 GeneID:100043059
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478852.1

name	Olfr482 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129375 CCDS:CCDS21704.1 GeneID:258728 MGI:3030316
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10424354-10423383; olfactory receptor MOR204-14 product : olfactory receptor 482 protein_id : NP_666944.1

name	Olfr483 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129371 CCDS:CCDS21705.1 GeneID:258730 MGI:3030317
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10432095-10433042; olfactory receptor MOR204-12 product : olfactory receptor 483 protein_id : NP_666946.1

name	Olfr484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239120 CCDS:CCDS21706.1 GeneID:258492 MGI:3030318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10454128-10453163; olfactory receptor MOR204-16 product : olfactory receptor 484 protein_id : NP_666710.1

name	Olfr485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801386 GeneID:258041 MGI:3030319
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-10489044-10488091; MOR204-40_p; olfactory receptor MOR204-30P product : olfactory receptor 485 protein_id : NP_001011810.1

name	Olfr486 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239118 CCDS:CCDS21707.1 GeneID:258489 MGI:3030320
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10501920-10500976; olfactory receptor MOR204-19 product : olfactory receptor 486 protein_id : NP_666707.1

name	Olfr487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801388 CCDS:CCDS21708.1 GeneID:258042 MGI:3030321
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10541702-10540758; olfactory receptor MOR204-29P product : olfactory receptor 487 protein_id : NP_001011811.1

name	Olfr488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380655 CCDS:CCDS21709.1 GeneID:258727 MGI:3030322
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10586187-10585243; olfactory receptor MOR204-15 product : olfactory receptor 488 protein_id : NP_666943.1

name	Olfr490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239122 CCDS:CCDS21710.1 GeneID:258491 MGI:3030324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10617173-10616229; olfactory receptor MOR204-17 product : olfactory receptor 490 protein_id : NP_666709.1

name	Olfr491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129373 CCDS:CCDS21711.1 GeneID:258731 MGI:3030325
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10646917-10647849; olfactory receptor MOR204-11 product : olfactory receptor 491 protein_id : NP_666947.1

name	Olfr492 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239116 GeneID:258490 MGI:3030326
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10653693-10652749; olfactory receptor MOR204-18 product : olfactory receptor 492 protein_id : NP_666708.1

name	Olfr493 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129671 CCDS:CCDS21712.1 GeneID:258307 MGI:3030327
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10676998-10676054; olfactory receptor MOR204-35 product : olfactory receptor 493 protein_id : NP_666422.1

name	Olfr494 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129367 CCDS:CCDS21713.1 GeneID:258732 MGI:3030328
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10697517-10698461; olfactory receptor MOR204-10 product : olfactory receptor 494 protein_id : NP_666948.1

name	Olfr495 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129571 CCDS:CCDS21714.1 GeneID:258361 MGI:3030329
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10725148-10726140; olfactory receptor MOR204-37 product : olfactory receptor 495 protein_id : NP_666476.1

name	Olfr497 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129369 CCDS:CCDS21715.1 GeneID:258733 MGI:3030331
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10752603-10753547; olfactory receptor MOR204-9 product : olfactory receptor 497 protein_id : NP_666949.1

name	Olfr498 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129673 CCDS:CCDS21716.1 GeneID:258304 MGI:3030332
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-10795522-10796514; olfactory receptor MOR204-36 product : olfactory receptor 498 protein_id : NP_666419.1

name	Olfr502 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129363 CCDS:CCDS21717.1 GeneID:258734 MGI:3030336
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10853935-10852991; olfactory receptor MOR204-8 product : olfactory receptor 502 protein_id : NP_666950.1

name	Olfr503 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372132 CCDS:CCDS21718.1 GeneID:259143 MGI:3030337
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10874315-10875286; olfactory receptor MOR34-8P product : olfactory receptor 503 protein_id : NP_001011527.1

name	Olfr504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801474 CCDS:CCDS21719.1 GeneID:258163 MGI:3030338
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10895499-10894543; olfactory receptor MOR40-7P product : olfactory receptor 504 protein_id : NP_001011858.1

name	Olfr506 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801496 CCDS:CCDS21720.1 GeneID:258215 MGI:3030340
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10942040-10942984; olfactory receptor MOR204-23 product : olfactory receptor 506 protein_id : NP_001011871.1

name	Olfr507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129355 CCDS:CCDS21721.1 GeneID:258738 MGI:3030341
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10951546-10952496; olfactory receptor MOR204-7 product : olfactory receptor 507 protein_id : NP_666954.1

name	Olfr508 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129305 CCDS:CCDS21722.1 GeneID:258769 MGI:3030342
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10959726-10960658; olfactory receptor MOR204-6 product : olfactory receptor 508 protein_id : NP_666984.1

name	Olfr509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129561 CCDS:CCDS21723.1 GeneID:258369 MGI:3030343
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10976304-10975339; olfactory receptor MOR267-14 product : olfactory receptor 509 protein_id : NP_666484.1

name	Olfr510 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129665 CCDS:CCDS21724.1 GeneID:258308 MGI:3030344
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-10997715-10998659; olfactory receptor MOR204-34 product : olfactory receptor 510 protein_id : NP_666423.1

name	Olfr512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129393 CCDS:CCDS21725.1 GeneID:258719 MGI:3030346
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11043421-11044365; olfactory receptor MOR268-3 product : olfactory receptor 512 protein_id : NP_666935.1

name	Olfr513 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129391 CCDS:CCDS21726.1 GeneID:258718 MGI:3030347
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11084889-11085818; olfactory receptor MOR195-1 product : olfactory receptor 513 protein_id : NP_666934.1

name	Olfr514 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129389 CCDS:CCDS21727.1 GeneID:258721 MGI:3030348
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11156311-11155379; olfactory receptor MOR268-1 product : olfactory receptor 514 protein_id : NP_666937.1

name	Olfr516 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129387 CCDS:CCDS21728.1 GeneID:258720 MGI:3030350
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11176324-11175380; olfactory receptor MOR268-2 product : olfactory receptor 516 protein_id : NP_666936.1

name	Olfr517 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801450 GeneID:258136 MGI:3030351
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11199311-11198367; olfactory receptor MOR268-4 product : olfactory receptor 517 protein_id : NP_001011846.1

name	Olfr518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129679 CCDS:CCDS21729.1 GeneID:258303 MGI:3030352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11211854-11210853; olfactory receptor MOR268-5 product : olfactory receptor 518 protein_id : NP_666418.1

name	Olfr519 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53850579 GeneID:277935 MGI:3030353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-11224559-11223615; olfactory receptor MOR268-6 product : olfactory receptor 519 protein_id : NP_997043.1

name	Nlrp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425308 CCDS:CCDS21730.1 GeneID:244202 MGI:2444084
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : neuronal apoptosis inhibitor protein 10; NACHT/LRR/pyrin domain-containing protein 10; NACHT, leucine rich repeat and PYD containing 10 product : NACHT, LRR and PYD containing protein 10 protein_id : NP_780741.1

name	Eif3s5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313620 CCDS:CCDS21731.1 GeneID:66085 MGI:1913335
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : eukaryotic translation initiation factor 3, subunit 5 (epsilon) protein_id : NP_079620.1

name	BC049265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257720 GeneID:414075 MGI:3041253
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479040.1

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 1 pseudo : _no_value

name	LOC384651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384651
definition	number : 2 pseudo : _no_value

name	LOC100042278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042278
definition	number : 1 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 3 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 2 pseudo : _no_value

name	LOC100042310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042310
definition	number : 1 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 1 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 2 pseudo : _no_value

name	LOC546990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546990
definition	number : 3 pseudo : _no_value

name	LOC626881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626881
definition	number : 2 pseudo : _no_value

name	LOC626881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626881
definition	number : 1 pseudo : _no_value

name	LOC269980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269980
definition	number : 2 pseudo : _no_value

name	LOC269980 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269980
definition	number : 1 pseudo : _no_value

name	LOC669301 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257651 GeneID:669301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins product : similar to suppressor of cytokine signaling 6 pseudo : _no_value transcript_id : XR_033485.1

name	LOC626732 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257712 GeneID:626732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : similar to peptidylprolyl isomerase A pseudo : _no_value transcript_id : XR_033898.1

clone name	MSMg01-315F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-121K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-306B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342K12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-100O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-535K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-103F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-478F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359G06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-201O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-089E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-343A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-437J14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-211J20.b	B6Ng01-211J20.g
ACC	GA029634	GA029635
length	1,094	1,148
definition	B6Ng01-211J20.b	B6Ng01-211J20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(115,129,858 - 115,130,955)	(115,005,047 - 115,006,188)
sequence	gaattcttcttttcaaatgcaaaatatgtgggctaatatttgctttgttt ttcttttccactgaacaatcaatatctagaactctgttctggctttcagc tgagatcagggatgctgaccactcaaatatactttctctcaagggatcag tcactgtggtgggaaaatagaggaggtaggacagtgaatcttacctagtt gaaatcaggctgtttcttcttatttcctctccttgtctcactcagctcct taagaccagcaacaatactggtttcatagatcatacatgtggtatccacg tgccttatgtttattggcctacatgtgccagcaaaccactgcacagcaat tcttgctgagggcatgatttccacacagatcaagagctcaaactgttcaa agtacttttctaattttcaaattcctcttgagttatttaaaaatacatcc taataaattcatcagtctttcatttaccatttagaattgatacttacact gaaatccataaaggacttcatgaagtatttattttttatttacatagaga aagttgggatgtgcacaatctgcaataaaaaccattagtgcacacacttg tcaaggagcctaaccaacacctgtagaaaatattaggttgggtgtctttg tgtgcatattaaatgaggaggagaatggcttaataaaccaggcaaccctt cggagattattgttactagcctcttaagagaaaggtccatggatttctta tacagaaatgcttatagaaccaagtgattcattatctcctggcttgttct ccccaggtaataccgacagtatgacaaagcatacaatgggattattttgt cctgatttactgaaagtgaaacagacaacaagaatatttgacattgaaag taataattatttttgtgtaatgtgatggtatttttcaattataataacta ttgaatcaaatttcaaaaggaggcttgagaatagtaagcaagaatagcag tgaatgaaattggtacttaactcatgtctattttgactagagaaatagaa aaaaatgatgctaagtcctgcagatgtaggactgacttacaaaa	gaattcacacatccacccatgtaggaaataaccaataagatgaggcagac cttgggagacatgagagtggagtagagcaggggtgagcagatggccacat agcgatcatagtccatggcagccagcaggaagaactcagcagtcccaaag accacatcagagccaagctggactatgcaaccagccacagggatggcagt tctctctctcagcaaactcacaatcatgacaggtgtgactgagctggagt acccaatgtccacaaaggccaagtggctgaggaaaaggtacattggggtg tgaagctgagggcttcttctgatcaacatgattatgctgacattgcccaa tatggtggtgatgtagacacccaggaacaacacaaagaagatacaacaaa gggtggggacctcagttagccccaaaataatgaactctgttaccattgtg tggttcccaggctctatcttttttgaagtgcttcctactgaaataaaacc agtggctatcagaatacattaaatggcctcatgattgatatacactactc cacatttagcccattaaaaataaatgtggatttcattttgttctgatgtt tgttttcccccaaatctttcccaaaccaagttacatcatgaataatttca gaatattaatcatcatttaccttaagcccacagatacaaactgagcagtg actcagatcagaacacaggactcactcacagaagtggcttttgatcaagg aaggaggtataattaatgcatagagcgctgatgcgctgagaccccaaata gttgaagtgacagttgtatgctggtctatatgatatatgattcaattcta tttctcagtcctattgaagccggtccttcctagtcttcttgtgatcttgt gccactgtgggtggtgcatgctactctgttgtgaaagtgaatggtatttt tatgaggatcaaactacagtaccagtccgcaacttcttcttctaatttct aaactgacaccttttacacgatacatcttacaaatatagcagaccttctc actagccagggttcaacttgtggatagggcatattattgttacatgcacc tcgagtcagaatagaacctgtggctggttagctcaacttaattcctag
quality values	Open. Hide. 58 36 22 27 62 62 62 62 62 62 62 62 62 37 10 47 62 49 49 56 51 62 62 62 62 62 41 47 59 62 62 59 62 59 49 38 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 30 59 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 59 62 62 59 54 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 54 58 52 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 47 58 58 58 58 54 58 58 58 58 58 58 58 58 51 58 53 58 58 58 58 58 48 58 58 58 58 58 53 58 58 58 51 54 51 58 51 58 58 58 58 58 54 58 47 58 58 58 50 58 58 58 51 51 46 58 48 58 58 52 51 58 58 58 54 58 50 58 49 49 51 52 53 42 54 58 53 49 41 50 54 58 58 52 58 46 50 58 58 49 53 52 58 53 58 53 50 58 51 58 49 51 58 51 52 58 58 49 58 44 27 43 58 42 58 41 50 58 58 42 58 51 52 39 53 52 58 50 50 47 40 53 54 53 53 40 40 34 38 49 49 52 26 49 49 22 38 37 53 45 38 40 54 46 40 37 49 52 40 45 50 34 38 53 51 41 38 53 52 54 31 51 36 31 38 54 25 52 53 37 30 28 54 33 39 54 47 53 40 39 37 35 32 51 27 42 51 54 40 39 52 40 54 47 34 47 32 40 51 32 31 52 29 36 31 31 35 31 32 47 32 33 45 52 42 34 53 45 34 45 31 27 30 40 53 32 52 11 31 31 35 24 51 46 33 30 22 51 31 27 37 42 31 26 29 31 31 31 35 32 31 31 37 32 30 31 38 51 45 25 30 34 33 29 41 32 18 25 33 47 46 27 24 38 31 26 47 47 30 43 23 29 31 22 31 31 23 47 31 30 34 34 42 42 47 30 32 31 32 31 48 33 27 21 19 37 25 22 27 18 32 19 18 33 32 31 29 32 48 41 36 38 20 17 30 38 13 24 47 31 29 17 10 14 25 22 25 18 22 29 26 48 48 44 31 31 19 38 30 22 31 23 38 13 21 31 28 31 28 11 33 29 30 41 36 38 31 34 14 26 14 15 28 25 23 13 9 13 20 22 28 17 8 28 18 26 21 33 21 48 33 12 39 17 20 29 48 48 14 23 8 16 19 10 22 19 17 25 21 11 8 27 14 29 15 27 15 16 27 29 11 15 11 19 10 18 28 27 26 26 21 16 23 19 11 11 13 22 47 25 19 27 13 22 3 9 16 17 12 27 18 19 28 27 7 7 6 7 13 13 20 20 33 40 7 7 20 28 27 24 20 8 7 11 29 4 8 13 3 5 3 29 28 17 29 13 3 8 22 11 18 22 15 12 12 8 5 7 4 19 14 15 8 8 23 6 6 11 7 17 7 15 6 10 8 16 13 22 18 6 12 11 29 17 22	Open. Hide. 62 47 42 47 62 47 42 59 59 62 59 62 62 59 30 62 62 33 35 62 59 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 59 59 62 62 62 59 62 62 59 59 59 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 54 58 58 58 40 49 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 49 39 58 58 54 41 54 58 58 58 54 58 58 58 58 58 58 41 52 54 54 58 58 58 58 51 58 58 46 47 58 41 58 58 58 58 49 52 51 58 58 58 58 51 58 58 44 49 58 58 58 51 58 58 58 58 58 49 51 58 58 54 58 49 58 53 58 58 58 41 58 58 51 50 58 58 58 49 46 58 58 58 53 54 58 54 50 58 48 50 58 49 50 49 51 54 58 58 58 40 58 32 58 53 52 54 58 54 50 52 50 43 37 58 49 49 50 52 58 44 40 52 39 52 43 50 50 47 40 51 52 41 51 58 53 45 53 53 51 40 35 52 42 51 46 44 40 50 49 38 51 40 32 47 51 54 39 50 49 46 46 32 51 49 49 42 53 35 32 49 42 52 39 39 32 37 42 32 54 45 42 45 45 40 39 46 27 17 51 45 37 38 51 45 34 44 40 43 53 45 31 34 42 53 33 54 54 54 45 40 32 32 35 45 34 26 47 33 37 32 53 35 23 52 28 31 32 29 45 42 53 33 53 34 47 31 31 34 32 31 41 45 53 32 32 42 31 33 26 30 33 30 41 31 31 31 13 33 26 41 41 34 31 51 31 30 29 38 45 42 30 41 51 28 42 42 25 31 35 38 29 37 46 27 30 28 31 36 36 42 46 31 38 31 31 27 30 30 31 37 22 30 31 31 32 31 41 18 31 36 26 33 46 30 37 32 30 30 48 38 37 28 30 32 23 25 31 33 24 28 22 22 31 31 39 30 37 31 27 33 18 18 31 31 37 19 27 27 31 29 22 12 15 31 25 12 32 35 26 32 32 32 24 19 24 35 22 32 31 25 23 31 31 31 25 38 48 33 11 11 24 7 26 30 33 25 33 24 32 33 32 38 32 27 31 27 32 42 29 29 19 34 5 17 11 18 21 20 27 22 26 14 16 23 48 48 43 7 10 21 32 33 20 17 25 18 26 29 48 16 15 23 22 22 27 15 6 17 28 26 15 10 10 32 32 28 32 22 29 14 13 5 9 5 10 11 19 23 22 27 20 11 20 40 17 27 10 18 34 11 21 24 23 12 8 6 7 26 18 34 34 27 13 18 8 17 17 28 11 10 14 15 28 9 6 11 9 13 8 28 11 11 6 11 18 20 28 22 11 14 3 3 4 10 7 7 6 15 14 15 17 3 5 3 5 6 25 6 23 13 5 7 13 7 5 6 4 4 10 12 3 3 5 10 27 14 9 6 6 5 7 13 7 10 20 21 7 9 16 6 5 10 11 10 6 7 5 13 9 4 15 6 17 21 7 5 19 8 6 5 15 10 24 6 7 8 9 5 10 7 8 6 4 8 4 13 5 4 4 9 8 7 6 9 4 4 13 4 2 2 5 7 5 6 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_115129858_115130955
seq2: B6Ng01-211J20.b_44_1137 (reverse)

seq1  TTTTGTAAAGTCAGTCCTACATCTGCAAGACTTTAGCATCATTTTTTTTT  50
      |||||| |||||||||||||||||||| ||| |||||||||  |||||||
seq2  TTTTGT-AAGTCAGTCCTACATCTGCAGGAC-TTAGCATCA--TTTTTTT  46

seq1  CTATTTCTCTAGTC-AAATAGACAATGAGTTTAAGTACCAATTTCATTCA  99
      |||||||||||||| |||||||| ||||| ||||||||||||||||||||
seq2  CTATTTCTCTAGTCAAAATAGAC-ATGAG-TTAAGTACCAATTTCATTCA  94

seq1  CTGCTATTCTTGCTTACTA-TCTCAAGCCTCCTTTTG-AATTTGATTCAA  147
      ||||||||||||||||||| ||||||||||||||||| ||||||||||||
seq2  CTGCTATTCTTGCTTACTATTCTCAAGCCTCCTTTTGAAATTTGATTCAA  144

seq1  TAGTTATTATAATTGAAAAATACCATCACATTACACAAAAATAATTATTA  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTATTATAATTGAAAAATACCATCACATTACACAAAAATAATTATTA  194

seq1  CTTTCAATGTCAAATATTCTTTGTTGTCTGTTTCACTTTCAGTAAATCAG  247
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CTTTCAATGTCAAATATTC-TTGTTGTCTGTTTCACTTTCAGTAAATCAG  243

seq1  GACAAAATAATCCCATTGTATGCTTTGTCATACTGTCGGTATTACCTGGG  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAATAATCCCATTGTATGCTTTGTCATACTGTCGGTATTACCTGGG  293

seq1  GAGAACAAGCCAGGAGATAATGAATCACTTGGTTCTATAAGCATTTCTGT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACAAGCCAGGAGATAATGAATCACTTGGTTCTATAAGCATTTCTGT  343

seq1  ATAAGAAATCCATGGACCTTTCTCTTAAGAGGCTAGTAACAATAATCTCC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGAAATCCATGGACCTTTCTCTTAAGAGGCTAGTAACAATAATCTCC  393

seq1  GAAGGGTTGCCTGGTTTATTAAGCCATTCTCCTCCTCATTTAATATGCAC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGTTGCCTGGTTTATTAAGCCATTCTCCTCCTCATTTAATATGCAC  443

seq1  ACAAAGACACCCAACCTAATATTTTCTACAGGTGTTGGTTAGGCTCCTTG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAGACACCCAACCTAATATTTTCTACAGGTGTTGGTTAGGCTCCTTG  493

seq1  ACAAGTGTGTGCACTAATGGTTTTTATTGCAGATTGTGCACATCCCAACT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTGTGTGCACTAATGGTTTTTATTGCAGATTGTGCACATCCCAACT  543

seq1  TTCTCTATGTAAATAAAAAATAAATACTTCATGAAGTCCTTTATGGATTT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTATGTAAATAAAAAATAAATACTTCATGAAGTCCTTTATGGATTT  593

seq1  CAGTGTAAGTATCAATTCTAAATGGTAAATGAAAGACTGATGAATTTATT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTAAGTATCAATTCTAAATGGTAAATGAAAGACTGATGAATTTATT  643

seq1  AGGATGTATTTTTAAATAACTCAAGAGGAATTTGAAAATTAGAAAAGTAC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGTATTTTTAAATAACTCAAGAGGAATTTGAAAATTAGAAAAGTAC  693

seq1  TTTGAACAGTTTGAGCTCTTGATCTGTGTGGAAATCATGCCCTCAGCAAG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAACAGTTTGAGCTCTTGATCTGTGTGGAAATCATGCCCTCAGCAAG  743

seq1  AATTGCTGTGCAGTGGTTTGCTGGCACATGTAGGCCAATAAACATAAGGC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCTGTGCAGTGGTTTGCTGGCACATGTAGGCCAATAAACATAAGGC  793

seq1  ACGTGGATACCACATGTATGATCTATGAAACCAGTATTGTTGCTGGTCTT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTGGATACCACATGTATGATCTATGAAACCAGTATTGTTGCTGGTCTT  843

seq1  AAGGAGCTGAGTGAGACAAGGAGAGGAAATAAGAAGAAACAGCCTGATTT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGCTGAGTGAGACAAGGAGAGGAAATAAGAAGAAACAGCCTGATTT  893

seq1  CAACTAGGTAAGATTCACTGTCCTACCTCCTCTATTTTCCCACCACAGTG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTAGGTAAGATTCACTGTCCTACCTCCTCTATTTTCCCACCACAGTG  943

seq1  ACTGATCCCTTGAGAGAAAGTATATTTGAGTGGTCAGCATCCCTGATCTC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGATCCCTTGAGAGAAAGTATATTTGAGTGGTCAGCATCCCTGATCTC  993

seq1  AGCTGAAAGCCAGAACAGAGTTCTAGATATTGATTGTTCAGTGGAAAAGA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGAAAGCCAGAACAGAGTTCTAGATATTGATTGTTCAGTGGAAAAGA  1043

seq1  AAAACAAAGCAAATATTAGCCCACATATTTTGCATTTGAAAAGAAGAATT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAAAGCAAATATTAGCCCACATATTTTGCATTTGAAAAGAAGAATT  1093

seq1  C  1098
      |
seq2  C  1094

seq1: chr7_115005047_115006188
seq2: B6Ng01-211J20.g_67_1214

seq1  GAATTCACACATCCACCCATGTAGGAAATAACCAATAAGATGAGGCAGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACACATCCACCCATGTAGGAAATAACCAATAAGATGAGGCAGAC  50

seq1  CTTGGGAGACATGAGAGTGGAGTAGAGCAGGGGTGAGCAGATGGCCACAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGGAGACATGAGAGTGGAGTAGAGCAGGGGTGAGCAGATGGCCACAT  100

seq1  AGCGATCATAGTCCATGGCAGCCAGCAGGAAGAACTCAGCAGTCCCAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGATCATAGTCCATGGCAGCCAGCAGGAAGAACTCAGCAGTCCCAAAG  150

seq1  ACCACATCAGAGCCAAGCTGGACTATGCAACCAGCCACAGGGATGGCAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACATCAGAGCCAAGCTGGACTATGCAACCAGCCACAGGGATGGCAGT  200

seq1  TCTCTCTCTCAGCAAACTCACAATCATGACAGGTGTGACTGAGCTGGAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTCTCAGCAAACTCACAATCATGACAGGTGTGACTGAGCTGGAGT  250

seq1  ACCCAATGTCCACAAAGGCCAAGTGGCTGAGGAAAAGGTACATTGGGGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAATGTCCACAAAGGCCAAGTGGCTGAGGAAAAGGTACATTGGGGTG  300

seq1  TGAAGCTGAGGGCTTCTTCTGATCAACATGATTATGCTGACATTGCCCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCTGAGGGCTTCTTCTGATCAACATGATTATGCTGACATTGCCCAA  350

seq1  TATGGTGGTGATGTAGACACCCAGGAACAACACAAAGAAGATACAACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGTGGTGATGTAGACACCCAGGAACAACACAAAGAAGATACAACAAA  400

seq1  GGGTGGGGACCTCAGTTAGCCCCAAAATAATGAACTCTGTTACCATTGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGGGACCTCAGTTAGCCCCAAAATAATGAACTCTGTTACCATTGTG  450

seq1  TGGTTCCCAGGCTCTATCTTTTTTGAAGTGCTTCCTACTGAAATAAAACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTCCCAGGCTCTATCTTTTTTGAAGTGCTTCCTACTGAAATAAAACC  500

seq1  AGTGGCTATCAGAATACATTAAATGGCCTCATGATTGATATACACTACTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGCTATCAGAATACATTAAATGGCCTCATGATTGATATACACTACTC  550

seq1  CACATTTAGCCCATTAAAAATAAATGTGGATTTCATTTTGTTCTGATGTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTTAGCCCATTAAAAATAAATGTGGATTTCATTTTGTTCTGATGTT  600

seq1  TGTTTTCCCCCAAATCTTTCCCAAACCAAGTTACATCATGAATAATTTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTCCCCCAAATCTTTCCCAAACCAAGTTACATCATGAATAATTTCA  650

seq1  GAATATTAATCATCATTTACCTTAAGCCCACAGATACAAACTGAGCAGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATATTAATCATCATTTACCTTAAGCCCACAGATACAAACTGAGCAGTG  700

seq1  ACTCAGATCAGAACACAGGACTCACTCACAGAAGTGGCTTTTGATCAAGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAGATCAGAACACAGGACTCACTCACAGAAGTGGCTTTTGATCAAGG  750

seq1  AAGGAGGTATAATTAATGCATAGAGCGCTGATGCGCTGAGACCCCAAATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGGTATAATTAATGCATAGAGCGCTGATGCGCTGAGACCCCAAATA  800

seq1  GTTGAAGTGACAGTTGTATGCTGGTCTATATGATATATGATTCAATTCTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAAGTGACAGTTGTATGCTGGTCTATATGATATATGATTCAATTCTA  850

seq1  TTTCTCAGTCCTATTGAAGCCGGTCCTTCCTAGTCTTCTTGTGATCTTGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTCAGTCCTATTGAAGCCGGTCCTTCCTAGTCTTCTTGTGATCTTGT  900

seq1  GCCACTGTGGGTGGTGCATGCTACTCTGTTGTGAAGGTGAATGGTA-TTT  949
      ||||||||||||||||||||||||||||||||||| |||||||||| |||
seq2  GCCACTGTGGGTGGTGCATGCTACTCTGTTGTGAAAGTGAATGGTATTTT  950

seq1  TATGAGGATCAAACTACAGTACCAGTCCGCAACT--CTCTTCTAATTTCT  997
      ||||||||||||||||||||||||||||||||||   |||||||||||||
seq2  TATGAGGATCAAACTACAGTACCAGTCCGCAACTTCTTCTTCTAATTTCT  1000

seq1  AAACTGACACCTTTTACACGATACATC-TAC-AATATAGCAGAACCTCTC  1045
      ||||||||||||||||||||||||||| ||| ||||||||||| | ||||
seq2  AAACTGACACCTTTTACACGATACATCTTACAAATATAGCAGACCTTCTC  1050

seq1  ACTAGCCCAGGTTTCAACTGTGGGAATAGGGCATA-TATTG-TACATGCA  1093
      ||||| ||||| ||||||| || | |||||||||| ||||| ||||||||
seq2  ACTAG-CCAGGGTTCAACT-TGTGGATAGGGCATATTATTGTTACATGCA  1098

seq1  -CTCGAAGTCAG-ATAGAA-CTGT-GCTGTGTTAGCTCACACTAAATTCC  1139
       |||| |||||| |||||| |||| |||| ||||||||| ||| ||||||
seq2  CCTCG-AGTCAGAATAGAACCTGTGGCTG-GTTAGCTCA-ACTTAATTCC  1145

seq1  TAG  1142
      |||
seq2  TAG  1148

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information