MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242M22
Chromosome	7 (Build37)
Map Location	151,343,506 - 151,446,388
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Kcnq1, Cdkn1c, Slc22a18, Phlda2, Nap1l4, Cars, Tnfrsf26, Tnfrsf22, Tnfrsf23, Osbpl5, Mrgprg, Mrgpre, Nadsyn1, Dhcr7, Gm498
Downstream gene	Shank2, Cttn, Ppfia1, Fadd, Tmem16a, LOC669079, LOC677315, Fgf3, Fgf4, Fgf15, Oraov1, Ccnd1, 1810010D01Rik, LOC100040049, Tpcn2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Kcnq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16535 MGI:108083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdkn1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12577 MGI:104564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18400 MGI:1336884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Phlda2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22113 MGI:1202307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nap1l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17955 MGI:1316687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27267 MGI:1351477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244237 MGI:2651928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79202 MGI:1930270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79201 MGI:1930269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbpl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79196 MGI:1930265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381974 MGI:3033145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgpre (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244238 MGI:2441884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nadsyn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78914 MGI:1926164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhcr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13360 MGI:1298378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244239 MGI:2685344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Shank2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210274 MGI:2671987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cttn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13043 MGI:99695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppfia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233977 MGI:1924750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 115 ESTs, 4 Proteins

name	Fadd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14082 MGI:109324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101772 MGI:2142149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC677315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Fgf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14174 MGI:95517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14175 MGI:95518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14170 MGI:1096383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oraov1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72284 MGI:1919534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12443 MGI:88313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810010D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381935 MGI:1916283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 1 Protein

name	LOC100040049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Tpcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233979 MGI:2385297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887794 GeneID:16535 MGI:108083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 1 transcript_id : NM_008434.2

name	Cdkn1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803290 GeneID:12577 MGI:104564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 1C (P57) transcript_id : NM_009876.3

name	Slc22a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363087 GeneID:18400 MGI:1336884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 18 transcript_id : NM_008767.2

name	Slc22a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363085 GeneID:18400 MGI:1336884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 18 transcript_id : NM_001042760.1

name	Phlda2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57863299 GeneID:22113 MGI:1202307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family A, member 2 transcript_id : NM_009434.2

name	Nap1l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130698 GeneID:17955 MGI:1316687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 4 transcript_id : NM_008672.2

name	Cars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352266 GeneID:27267 MGI:1351477
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteinyl-tRNA synthetase transcript_id : NM_013742.3

name	Tnfrsf26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802947 GeneID:244237 MGI:2651928
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 26 transcript_id : NM_175649.4

name	Tnfrsf22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328313 GeneID:79202 MGI:1930270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 22 transcript_id : NM_023680.2

name	Tnfrsf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875522 GeneID:79201 MGI:1930269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 23 transcript_id : NM_024290.3

name	Osbpl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130695 GeneID:79196 MGI:1930265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 5 transcript_id : NM_024289.2

name	Mrgprg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896630 GeneID:381974 MGI:3033145
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member G transcript_id : NM_203492.2

name	Mrgpre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342123 GeneID:244238 MGI:2441884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member E transcript_id : NM_175534.2

name	Nadsyn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313533 GeneID:78914 MGI:1926164
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD synthetase 1 transcript_id : NM_030221.1

name	Dhcr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42544247 GeneID:13360 MGI:1298378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 7-dehydrocholesterol reductase transcript_id : NM_007856.2

name	Gm498 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82915634 GeneID:244239 MGI:2685344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : gene model 498, (NCBI) transcript_id : XM_146165.5

name	Shank2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486976 GeneID:210274 MGI:2671987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3/ankyrin domain gene 2 transcript_id : NM_001081370.1

name	Cttn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803480 GeneID:13043 MGI:99695
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cortactin transcript_id : NM_007803.3

name	Ppfia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381473 GeneID:233977 MGI:1924750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 115 ESTs, 4 Proteins product : protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1, transcript variant 1 transcript_id : XM_133979.7

name	Fadd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803123 GeneID:14082 MGI:109324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas (TNFRSF6)-associated via death domain transcript_id : NM_010175.3

name	Tmem16a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835695 GeneID:101772 MGI:2142149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16A transcript_id : NM_178642.4

name	LOC669079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258294 GeneID:669079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : hypothetical LOC669079 transcript_id : XM_001473953.1

name	Fgf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679782 GeneID:14174 MGI:95517
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 3 transcript_id : NM_008007.1

name	Fgf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374561 GeneID:14175 MGI:95518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 4 transcript_id : NM_010202.3

name	Fgf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131051 GeneID:14170 MGI:1096383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 15 transcript_id : NM_008003.2

name	Oraov1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130438 GeneID:72284 MGI:1919534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oral cancer overexpressed 1 transcript_id : NM_028184.3

name	Ccnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672895 GeneID:12443 MGI:88313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D1 transcript_id : NM_007631.2

name	LOC100040049 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258296 GeneID:100040049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100040049 transcript_id : XM_001473999.1

name	Tpcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347877 GeneID:233979 MGI:2385297
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : two pore segment channel 2 transcript_id : NM_146206.3

name	Kcnq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887795 CCDS:CCDS22039.1 GeneID:16535 MGI:108083
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0016458 - gene silencing [Evidence IMP]; GO:0006349 - imprinting [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage-gated channel subfamily Q member 1 product : potassium voltage-gated channel, subfamily Q, member 1 protein_id : NP_032460.2

name	Cdkn1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981849 CCDS:CCDS22040.1 GeneID:12577 MGI:104564
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0042551 - neuron maturation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : cyclin-dependent kinase inhibitor 1C (P57) protein_id : NP_034006.2

name	Slc22a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363086 GeneID:18400 MGI:1336884
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence TAS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence TAS]; GO:0006811 - ion transport [Evidence IEA]; GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic cationic transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like product : solute carrier family 22 (organic cation transporter), member 18 protein_id : NP_001036225.1

name	Slc22a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363088 CCDS:CCDS22041.1 GeneID:18400 MGI:1336884
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008514 - organic anion transporter activity [Evidence TAS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence TAS]; GO:0006811 - ion transport [Evidence IEA]; GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : organic cationic transporter-like 2; solute carrier family 22 (organic cation transporter), member 1-like product : solute carrier family 22 (organic cation transporter), member 18 protein_id : NP_032793.2

name	Phlda2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678447 CCDS:CCDS22042.1 GeneID:22113 MGI:1202307
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_process : GO:0009887 - organ morphogenesis [Evidence IMP] codon_start : 1 note : tumor-suppressing subchromosomal transferable fragment 3 product : pleckstrin homology-like domain, family A, member 2 protein_id : NP_033460.1

name	Nap1l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679012 GeneID:17955 MGI:1316687
definition	codon_start : 1 note : nucleosome assembly protein 1 like 4 product : nucleosome assembly protein 1-like 4 protein_id : NP_032698.1

name	Cars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980754 GeneID:27267 MGI:1351477
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cysteinyl-tRNA synthetase protein_id : NP_038770.2

name	Tnfrsf26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316748 GeneID:244237 MGI:2651928
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TNF receptor homolog 3; tumor necrosis factor receptor superfamily, member 24 product : tumor necrosis factor receptor superfamily, member 26 protein_id : NP_783580.1

name	Tnfrsf22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50838796 CCDS:CCDS22043.1 GeneID:79202 MGI:1930270
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] [Evidence IEA]; GO:0045569 - TRAIL binding [Evidence IDA] GO_process : GO:0042981 - regulation of apoptosis [Evidence IDA] codon_start : 1 note : tumor necrosis factor receptor superfamily, member 1a-like 2 product : tumor necrosis factor receptor superfamily, member 22 protein_id : NP_076169.2

name	Tnfrsf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28269699 CCDS:CCDS22044.1 GeneID:79201 MGI:1930269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : decoy TRAIL receptor 1; tumor necrosis factor receptor superfamily, member 1a-like 1 product : tumor necrosis factor receptor superfamily, member 23 protein_id : NP_077252.2

name	Osbpl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011889 GeneID:79196 MGI:1930265
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0008142 - oxysterol binding [Evidence ISS] GO_process : GO:0008203 - cholesterol metabolism [Evidence ISS]; GO:0030301 - cholesterol transport [Evidence ISS]; GO:0006893 - Golgi to plasma membrane transport [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : oxysterol-binding protein-related protein 5; OSBP-related protein 5; oxysterol binding protein 2; oxysterol binding protein homolog 1 product : oxysterol-binding protein-like protein 5 protein_id : NP_077251.1

name	Mrgprg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45237191 CCDS:CCDS22045.1 GeneID:381974 MGI:3033145
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor MrgG product : MAS-related GPR, member G protein_id : NP_987077.1

name	Mrgpre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425312 CCDS:CCDS22046.1 GeneID:244238 MGI:2441884
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor MrgE protein_id : NP_780743.1

name	Nadsyn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313534 CCDS:CCDS22047.1 GeneID:78914 MGI:1926164
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016810 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003952 - NAD+ synthase (glutamine-hydrolyzing) activity [Evidence ISS] [Evidence IEA]; GO:0008795 - NAD+ synthase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0009435 - NAD biosynthesis [Evidence ISS] [Evidence IEA]; GO:0006807 - nitrogen compound metabolism [Evidence IEA] codon_start : 1 note : NH3-dependent NAD+ synthetase-like protein product : NAD synthetase 1 protein_id : NP_084497.1

name	Dhcr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681179 CCDS:CCDS22048.1 GeneID:13360 MGI:1298378
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047598 - 7-dehydrocholesterol reductase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IMP] codon_start : 1 product : 7-dehydrocholesterol reductase protein_id : NP_031882.1

name	Gm498 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915635 GeneID:244239 MGI:2685344
definition	codon_start : 1 product : similar to actin-12 protein_id : XP_146165.5

name	Shank2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486977 GeneID:210274 MGI:2671987
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : SH3/ankyrin domain gene 2 protein_id : NP_001074839.1

name	Cttn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677414 CCDS:CCDS22049.1 GeneID:13043 MGI:99695
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : mammary tumor and squamous cell carcinoma associated (p80/85 src substrate) product : cortactin protein_id : NP_031829.2

name	Ppfia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762709 GeneID:233977 MGI:1924750
definition	codon_start : 1 product : protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein, alpha 1 isoform 1 protein_id : XP_133979.5

name	Fadd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753812 CCDS:CCDS22050.1 GeneID:14082 MGI:109324
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0008632 - apoptotic program [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Fas-associating protein with death domain product : Fas-associated via death domain protein_id : NP_034305.1

name	Tmem16a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835696 GeneID:101772 MGI:2142149
definition	codon_start : 1 product : transmembrane protein 16A protein_id : NP_848757.3

name	LOC669079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258295 GeneID:669079
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474003.1

name	Fgf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679783 CCDS:CCDS22051.1 GeneID:14174 MGI:95517
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0001759 - induction of an organ [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : fibroblast growth factor 3 protein_id : NP_032033.1

name	Fgf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955870 CCDS:CCDS22052.1 GeneID:14175 MGI:95518
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IGI]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0019827 - stem cell maintenance [Evidence IGI] codon_start : 1 product : fibroblast growth factor 4 protein_id : NP_034332.2

name	Fgf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679777 CCDS:CCDS22053.1 GeneID:14170 MGI:1096383
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : fibroblast growth factor 15 protein_id : NP_032029.1

name	Oraov1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980738 CCDS:CCDS22054.1 GeneID:72284 MGI:1919534
definition	codon_start : 1 product : oral cancer overexpressed 1 protein_id : NP_082460.2

name	Ccnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680868 CCDS:CCDS22055.1 GeneID:12443 MGI:88313
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA] [Evidence IDA]; GO:0051301 - cell division [Evidence IEA]; GO:0045444 - fat cell differentiation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0000320 - re-entry into mitotic cell cycle [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0030968 - unfolded protein response [Evidence IDA] codon_start : 1 product : cyclin D1 protein_id : NP_031657.1

name	LOC100040049 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258297 GeneID:100040049
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474049.1

name	Tpcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542196 GeneID:233979 MGI:2385297
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : two pore segment channel 2 protein_id : NP_666318.2

name	LOC677315 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677315
definition	number : 1 pseudo : _no_value

name	1810010D01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94381474 GeneID:381935 MGI:1916283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 1 Protein product : RIKEN cDNA 1810010D01 gene transcript_id : XR_002364.1

clone name	MSMg01-410J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137I17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242M22.b	B6Ng01-242M22.g
ACC	GA052353	GA052354
length	1,183	1,126
definition	B6Ng01-242M22.b	B6Ng01-242M22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(151,343,506 - 151,344,661)	(151,445,249 - 151,446,388)
sequence	gaattctttgttcagttctgagccccattttttaatggggttatttgatt ttctgaagtccaccttcttgagttcttaagaacacaaactttctagcagc agagaaagtgactgtagcttgtagagagactcaggtgggacagtgtgtag agaagactcatcggaaggggcaccagcttaaggctagagaaccttaaagt aaatatgtaggcagaagcagaggtcaagggtaaagtatatataactggca acaggagacgccatgtggagaaggtaggagaacagagaagggaagagcta aggttttcatgtcttctgtgacctagatgaaactgaggcccttggccact tattcagaacaccagcctttctgacctggaagcttatagaagcaaagcaa actcctccattctgggccagttctttccacgaggaaccagattgagtttg ggagggacataccgcagtgtgcgttctttttaattagcccttgtggtaaa gtcgtgaggagctatggagcctgccagagccttcggggcacctgttggtg gccggccagttggctgtcctctcatatcactgggtcaccaggaattctat ggagccagggctcagatctcctcgttcaaatgacaagctatgcctgcttc tgaaggctgtgggttgaatagccttctctatggtagatgcagggtttgtc caggcaaggaggtcacggccagggccctaatgtcctggcagcactgtatg ctccaggtctgacattgcgaaaggcccaggctaggtcctcaagagtacac caactccttcctggggaatactgaatctcttttaagaaccctgtgtgtgt gtgtgtctgtgtgtgtctgtgtgtgtgtgtgtgtgtgctgggcaagagac ttgagtcactgtttgctgtggcttgctggactgttctcccagagttccta ttgccactcattagccaaccaggtgcaaaagggccttgcattttagcttc atgtttcagactctgaggctctggtttcgagtttcgagcttgtgcaacta ccatttcaaggctggttaatcatttcatggatgggggttggcatttgcat tgttatctctgtaacggagcccccccaaggtaggtttcagaacctacttg cctcttctcggcaattctagattctagttagtt	gaattcctggttctacctgccttgcagatccctgccacggtcaaagctgt ctcccttactaatccctacatctgtatgagcagtcttttgtcagtcacag aaacagtgttttctgtcccaatggtgctctgggcagcaagaatttgatat tcaccaagacttctcctcacacacctaaccccaggtgattgtgaacagaa acatgttgacctcaggtggtcccaggcacggcctcacacgcaggtgtaaa tacatggaggctgaggactcataccctaccccccttggcctcttctccag tctccatgtttttctatcacactgacagtgaccttgctttactaggttgc tgaggctgtgtccagggcatggtagtggtgctggtgagatggacagatag acatgtgacccttgtttgctccaactgaaatggcaggtcaagagaggccc acagcttgtccaactcttcatcatgggagagctatggctgactcctaact attcatctaaactcttctacactctgctcagaagttgctggttggcccca gtttggccctaatccccagatatgcttcatcaaaggcacagtctgagagt gaccactgcttgaagccttctaccttaggttctccccacccccaccccac aaggcccactgttccctacctgaacagctcttcaagtagccacagtaaca gcttttcccagacctcccaggaacttatggcgtactggctctgcctggat cttccttgttagatggacatatgggttaaggctactactgactctggcca cctgttaatggtccattctggccaggtttcccagtagccactcgagcaag gcttctgtgggaagattctatcctggatcctgtgacagccataccacagg aaacacacaactttctacaaacttcccacccatgagcctagaaggtctgc tttccctgggggccctgctcatcaggagagcaagattccctgaacagaat gcggactcgggggtgaagtgtaagccagagcagcagtctaatactgcctg gaggaggcaatcactctgcttaggttcctgtcatgccgtctcacatccgt atgattctcaaggaatgccatctttc
quality values	Open. Hide. 58 17 22 26 58 58 58 58 58 58 58 58 25 22 62 62 62 62 54 62 62 54 62 62 62 54 41 62 62 62 50 36 17 21 21 27 49 38 56 44 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 37 43 38 48 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 54 54 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 45 58 58 54 58 58 54 58 58 58 58 52 58 58 58 58 58 54 52 47 58 54 58 58 58 58 58 47 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 48 58 58 54 49 58 52 58 58 58 58 58 54 58 58 58 54 58 58 54 58 58 48 51 54 58 51 47 58 54 58 58 58 58 51 49 42 58 50 50 51 58 38 40 58 50 54 51 58 58 58 51 53 58 49 50 51 58 58 54 58 53 53 41 58 50 51 58 54 43 44 51 51 58 49 50 40 58 41 58 58 58 48 49 58 51 58 58 50 51 51 58 54 51 58 50 54 51 50 53 51 58 38 22 44 32 51 58 49 39 58 54 49 44 50 58 40 52 51 50 44 43 50 51 33 51 50 28 32 40 47 54 37 53 50 41 39 51 52 38 23 54 51 32 54 54 51 42 53 44 40 50 49 50 51 40 32 49 25 14 51 37 39 40 40 44 54 40 39 32 35 15 24 24 39 42 50 41 40 41 54 38 51 51 47 54 31 40 39 34 40 38 41 47 35 34 40 52 40 45 52 35 51 32 23 53 33 42 52 37 46 18 16 46 52 40 41 23 31 49 16 31 27 19 47 40 21 27 36 31 34 32 26 51 28 31 53 53 31 31 41 43 53 18 53 25 32 33 29 38 24 45 34 45 29 27 30 51 34 43 31 31 51 46 31 40 31 23 26 39 30 34 30 43 42 35 31 30 51 51 47 45 31 36 22 28 18 30 51 46 31 51 29 37 30 42 32 46 32 46 31 46 30 38 18 46 31 46 17 30 16 46 25 21 24 48 26 48 23 46 31 46 20 44 24 46 7 46 6 44 23 37 28 48 18 31 38 20 41 48 37 15 14 7 8 37 14 36 30 22 39 26 19 6 24 20 33 31 31 39 18 44 6 26 26 37 28 15 8 24 8 19 32 32 24 29 27 22 28 23 27 32 32 28 11 7 10 36 28 13 9 8 5 16 23 23 21 30 11 7 11 10 31 20 8 21 16 7 14 16 25 31 11 14 19 10 12 7 25 10 16 10 11 23 24 10 40 37 26 7 39 17 22 19 17 9 15 21 20 16 36 34 8 24 14 32 18 16 9 33 26 24 15 43 14 37 22 11 23 14 33 14 9 13 26 12 10 16 28 27 28 16 15 5 28 6 27 15 27 9 14 28 20 22 8 32 20 21 15 27 15 19 19 7 3 8 14 6 4 11 15 9 16 28 17 6 9 19 5 8 24 24 21 7 3 6 30 19 4 5 17 13 28 11 16 16 6 6 5 6 17 5 19 17 4 5 4 6 8 12 15 15 16 23 21 5 11 6 5 12 7 15 16 8 20 8 11 5 11 5 4 17 8 4 6 4 14 5 9 16 5 25 17 15 15 14 12 5 4 3 2 3 13 9 19 9 12 9 5 11 14 6 14 9 6 6 7 6 6 11 4 8 5 16 5 7 6 4 6 13 6 6 7 23 4 5 9 12 3 3 3 8 9 5 7 5 3 4 25 1 5 2	Open. Hide. 62 59 44 44 62 62 62 62 62 59 56 50 59 49 36 28 32 32 43 49 49 62 62 59 59 62 59 59 62 62 62 59 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 43 54 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 58 58 54 58 58 58 54 58 58 54 54 58 58 58 49 52 52 52 54 54 58 58 58 58 58 54 52 58 58 58 58 58 58 58 54 54 48 58 44 42 58 54 58 58 58 58 49 31 58 58 45 54 58 41 58 54 46 58 58 58 58 54 52 52 47 54 52 54 58 58 47 47 41 42 52 58 53 52 54 49 54 51 54 51 52 58 52 51 58 51 40 58 51 50 49 58 50 58 53 58 58 51 33 58 47 58 58 37 23 43 42 58 54 58 54 58 58 49 58 58 50 58 58 51 49 58 51 50 43 54 49 51 53 22 58 58 54 51 53 53 58 58 50 40 51 54 58 58 50 40 39 38 58 50 41 50 49 31 33 58 27 54 40 50 41 51 46 47 40 31 22 30 47 42 52 46 51 39 33 39 47 33 45 47 49 53 53 37 38 46 41 51 51 52 32 26 50 30 38 33 38 39 49 49 49 49 49 49 54 54 54 49 23 50 44 37 20 32 35 35 52 25 44 39 35 37 34 33 28 30 46 39 43 42 39 54 33 44 22 27 31 40 45 45 45 53 40 43 37 31 42 34 37 42 33 31 19 53 11 9 21 21 33 51 29 40 40 22 33 31 31 40 30 27 20 31 33 37 32 49 51 39 47 33 42 25 28 19 37 31 33 38 31 26 27 32 40 32 43 26 30 22 18 15 16 25 30 25 19 26 30 30 36 37 31 29 31 32 41 31 30 27 11 29 26 29 46 17 32 25 14 42 31 48 31 31 35 28 31 29 26 34 22 42 30 27 27 31 29 21 34 21 31 22 26 28 41 23 31 39 24 26 31 26 32 41 32 28 36 20 26 12 36 30 31 32 28 27 11 31 27 7 8 21 18 21 28 36 34 27 17 18 27 20 30 16 12 29 10 9 29 19 30 18 12 13 36 36 27 17 14 21 26 16 6 36 19 35 44 23 21 17 24 14 19 28 18 22 13 10 16 32 9 7 7 24 16 16 17 16 31 7 17 13 31 32 19 25 29 18 33 12 31 32 34 32 21 39 20 27 30 10 6 12 36 31 30 12 7 13 17 18 27 11 16 17 25 24 9 6 4 5 22 5 10 5 19 20 9 13 28 16 28 14 27 17 4 8 24 15 7 19 4 17 16 8 16 8 21 21 8 8 27 24 14 32 34 40 9 18 24 17 27 13 10 21 13 19 25 18 27 13 11 13 24 5 20 15 4 3 4 3 1 13 11 18 9 12 6 6 2 5 6 8 10 16 5 9 6 12 12 5 4 24 13 9 23 19 16 10 20 21 5 6 9 18 19 6 12 13 4 5 7 18 6 5 5 6 15 7 6 4 3 1 4 3 6 7 5 4 5 3 3 3 1 3 8 22 2 2 5 9 5 2 4 6 6 8 8 7 6 6 6 8 9 17 13 4 4 11 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_151343506_151344661
seq2: B6Ng01-242M22.b_47_1229

seq1  GAATTCTTTGTTCAGTTCTGAGCCCCATTTTTTAATGGGGTTATTTGATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGTTCAGTTCTGAGCCCCATTTTTTAATGGGGTTATTTGATT  50

seq1  TTCTGAAGTCCACCTTCTTGAGTTCTTAAGAACACAAACTTTCTAGCAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAAGTCCACCTTCTTGAGTTCTTAAGAACACAAACTTTCTAGCAGC  100

seq1  AGAGAAAGTGACTGTAGCTTGTAGAGAGACTCAGGTGGGACAGTGTGTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAAGTGACTGTAGCTTGTAGAGAGACTCAGGTGGGACAGTGTGTAG  150

seq1  AGAAGACTCATCGGAAGGGGCACCAGCTTAAGGCTAGAGAACCTTAAAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGACTCATCGGAAGGGGCACCAGCTTAAGGCTAGAGAACCTTAAAGT  200

seq1  AAATATGTAGGCAGAAGCAGAGGTCAAGGGTAAAGTATATATAACTGGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATGTAGGCAGAAGCAGAGGTCAAGGGTAAAGTATATATAACTGGCA  250

seq1  ACAGGAGACGCCATGTGGAGAAGGTAGGAGAACAGAGAAGGGAAGAGCTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGAGACGCCATGTGGAGAAGGTAGGAGAACAGAGAAGGGAAGAGCTA  300

seq1  AGGTTTTCATGTCTTCTGTGACCTAGATGAAACTGAGGCCCTTGGCCACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTTTCATGTCTTCTGTGACCTAGATGAAACTGAGGCCCTTGGCCACT  350

seq1  TATTCAGAACACCAGCCTTTCTGACCTGGAAGCTTATAGAAGCAAAGCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAGAACACCAGCCTTTCTGACCTGGAAGCTTATAGAAGCAAAGCAA  400

seq1  ACTCCTCCATTCTGGGCCAGTTCTTTCCACGAGGAACCAGATTGAGTTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCTCCATTCTGGGCCAGTTCTTTCCACGAGGAACCAGATTGAGTTTG  450

seq1  GGAGGGACATACCGCAGTGTGCGTTCTTTTTAATTAGCCCTTGTGGTAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGACATACCGCAGTGTGCGTTCTTTTTAATTAGCCCTTGTGGTAAA  500

seq1  GTCGTGAGGAGCTATGGAGCCTGCCAGAGCCTTCGGGGCACCTGTTGGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCGTGAGGAGCTATGGAGCCTGCCAGAGCCTTCGGGGCACCTGTTGGTG  550

seq1  GCCGGCCAGTTGGCTGTCCTCTCATATCACTGGGTCACCAGGAATTCTAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGGCCAGTTGGCTGTCCTCTCATATCACTGGGTCACCAGGAATTCTAT  600

seq1  GGAGCCAGGGCTCAGATCTCCTCGTTCAAATGACAAGCTATGCCTGCTTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCCAGGGCTCAGATCTCCTCGTTCAAATGACAAGCTATGCCTGCTTC  650

seq1  TGAAGGCTGTGGGTTGAATAGCCTTCTCTATGGTAGATGCAGGGTTTGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGGCTGTGGGTTGAATAGCCTTCTCTATGGTAGATGCAGGGTTTGTC  700

seq1  CAGGCAAGGAGGTCACGGCCAGGGCCCTAATGTCCTGGCAGCACTGTATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCAAGGAGGTCACGGCCAGGGCCCTAATGTCCTGGCAGCACTGTATG  750

seq1  CTCCAGGTCTGACATTGCG-AAGGCCCAGGCTAGGTCCTCAAGAGTACAC  799
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CTCCAGGTCTGACATTGCGAAAGGCCCAGGCTAGGTCCTCAAGAGTACAC  800

seq1  CAACTCCTTCCTGGGGAATACTGAATCTCTTTTAAGAACCCTGTGTGTGT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTCCTTCCTGGGGAATACTGAATCTCTTTTAAGAACCCTGTGTGTGT  850

seq1  GTGTGTCTGTGTGTGTCTGTGTGTGTGTGTGTGTGTGCTGGGC-AGAGAC  898
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GTGTGTCTGTGTGTGTCTGTGTGTGTGTGTGTGTGTGCTGGGCAAGAGAC  900

seq1  TTGAGTCACTG-TTGCTGTGGCTTGCTGGACTGTTCTCCCAGAG-TCCTA  946
      ||||||||||| |||||||||||||||||||||||||||||||| |||||
seq2  TTGAGTCACTGTTTGCTGTGGCTTGCTGGACTGTTCTCCCAGAGTTCCTA  950

seq1  -TGCCACTCAATAGCCAACCAGGTGCAAAAGG--CCTGCA-TTTAGC-TC  991
       ||||||||| |||||||||||||||||||||  | |||| |||||| ||
seq2  TTGCCACTCATTAGCCAACCAGGTGCAAAAGGGCCTTGCATTTTAGCTTC  1000

seq1  ATGTTCCAGACTCTGAGGCTCTGGTTCCGAG-TTCGAGCTTGTGCCAACT  1040
      ||||| |||||||||||||||||||| |||| |||||||||||| |||||
seq2  ATGTTTCAGACTCTGAGGCTCTGGTTTCGAGTTTCGAGCTTGTG-CAACT  1049

seq1  ACCA-TTCAAAGCTGGTAAATCA-TTCAT-GATTGGGGT--GCA-TTGCA  1084
      |||| ||||| |||||| ||||| ||||| ||| |||||  ||| |||||
seq2  ACCATTTCAAGGCTGGTTAATCATTTCATGGATGGGGGTTGGCATTTGCA  1099

seq1  T--GTATCTCTG--ACAGAG-CCCCCCAAGTTAGG-TTCAG-ACCTACTT  1127
      |   ||||||||  || ||| ||||||||| |||| ||||| ||||||||
seq2  TTGTTATCTCTGTAACGGAGCCCCCCCAAGGTAGGTTTCAGAACCTACTT  1149

seq1  GC----TCTCGGC-ATTCTAGGTTCTAGTAAGTT  1156
      ||    ||||||| ||||||| ||||||| ||||
seq2  GCCTCTTCTCGGCAATTCTAGATTCTAGTTAGTT  1183

seq1: chr7_151445249_151446388
seq2: B6Ng01-242M22.g_64_1189 (reverse)

seq1  GAAAGATGGCA-TCCTTGAGAGAAAACAATAGGGATGTGAGAAGGGGCAT  49
      ||||||||||| ||||||||    ||  ||| ||||||||||   |||||
seq2  GAAAGATGGCATTCCTTGAG----AATCATACGGATGTGAGA--CGGCAT  44

seq1  GAACAGGGACCCTAAAGCAGAGTGATTGGCTTCCTCCAGCAGGTATTTAG  99
      | ||||| |||   ||||||||||||| || ||||||||   ||| ||||
seq2  G-ACAGGAACC--TAAGCAGAGTGATT-GCCTCCTCCAGGCAGTA-TTAG  89

seq1  GCCTTCCTGGCTCTGGGCTTACACTTCA-CCCCGAGTCCCGCATTCTTGT  148
       |  | || ||||| ||||||||||||| |||||||| |||||||| |||
seq2  AC--TGCT-GCTCT-GGCTTACACTTCACCCCCGAGT-CCGCATTC-TGT  133

seq1  TCAGGGAATCTTGCTCTCCTTGATGAGCAGGG-CCCCAGGG-AAGCAGAC  196
      ||||||||||||||||||| |||||||||||| |||||||| ||||||||
seq2  TCAGGGAATCTTGCTCTCC-TGATGAGCAGGGCCCCCAGGGAAAGCAGAC  182

seq1  CTTCTAGGCTCATGGGTTGGGAGTTTGTAGAAAGTTGTGTGTTTCCTGTG  246
      ||||||||||||||||| || |||||||||||||||||||||||||||||
seq2  CTTCTAGGCTCATGGGTGGGAAGTTTGTAGAAAGTTGTGTGTTTCCTGTG  232

seq1  GTATGGCTGTCACAGGATCCAGGATAGAATCTTCCCACAGAAGCCTTGCT  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGGCTGTCACAGGATCCAGGATAGAATCTTCCCACAGAAGCCTTGCT  282

seq1  CGAGTGGCTACTGGGAAACCTGGCCAGAATGGACCATTAACAGGTGGCCA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGTGGCTACTGGGAAACCTGGCCAGAATGGACCATTAACAGGTGGCCA  332

seq1  GAGTCAGTAGTAGCCTTAACCCATATGTCCATCTAACAAGGAAGATCCAG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCAGTAGTAGCCTTAACCCATATGTCCATCTAACAAGGAAGATCCAG  382

seq1  GCAGAGCCAGTACGCCATAAGTTCCTGGGAGGTCTGGGAAAAGCTGTTAC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGCCAGTACGCCATAAGTTCCTGGGAGGTCTGGGAAAAGCTGTTAC  432

seq1  TGTGGCTACTTGAAGAGCTGTTCAGGTAGGGAACAGTGGGCCTTGTGGGG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCTACTTGAAGAGCTGTTCAGGTAGGGAACAGTGGGCCTTGTGGGG  482

seq1  TGGGGGTGGGGAGAACCTAAGGTAGAAGGCTTCAAGCAGTGGTCACTCTC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGTGGGGAGAACCTAAGGTAGAAGGCTTCAAGCAGTGGTCACTCTC  532

seq1  AGACTGTGCCTTTGATGAAGCATATCTGGGGATTAGGGCCAAACTGGGGC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTGTGCCTTTGATGAAGCATATCTGGGGATTAGGGCCAAACTGGGGC  582

seq1  CAACCAGCAACTTCTGAGCAGAGTGTAGAAGAGTTTAGATGAATAGTTAG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCAGCAACTTCTGAGCAGAGTGTAGAAGAGTTTAGATGAATAGTTAG  632

seq1  GAGTCAGCCATAGCTCTCCCATGATGAAGAGTTGGACAAGCTGTGGGCCT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCAGCCATAGCTCTCCCATGATGAAGAGTTGGACAAGCTGTGGGCCT  682

seq1  CTCTTGACCTGCCATTTCAGTTGGAGCAAACAAGGGTCACATGTCTATCT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGACCTGCCATTTCAGTTGGAGCAAACAAGGGTCACATGTCTATCT  732

seq1  GTCCATCTCACCAGCACCACTACCATGCCCTGGACACAGCCTCAGCAACC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCATCTCACCAGCACCACTACCATGCCCTGGACACAGCCTCAGCAACC  782

seq1  TAGTAAAGCAAGGTCACTGTCAGTGTGATAGAAAAACATGGAGACTGGAG  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTAAAGCAAGGTCACTGTCAGTGTGATAGAAAAACATGGAGACTGGAG  832

seq1  AAGAGGCCAAGGGGGGTAGGGTATGAGTCCTCAGCCTCCATGTATTTACA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGCCAAGGGGGGTAGGGTATGAGTCCTCAGCCTCCATGTATTTACA  882

seq1  CCTGCGTGTGAGGCCGTGCCTGGGACCACCTGAGGTCAACATGTTTCTGT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCGTGTGAGGCCGTGCCTGGGACCACCTGAGGTCAACATGTTTCTGT  932

seq1  TCACAATCACCTGGGGTTAGGTGTGTGAGGAGAAGTCTTGGTGAATATCA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAATCACCTGGGGTTAGGTGTGTGAGGAGAAGTCTTGGTGAATATCA  982

seq1  AATTCTTGCTGCCCAGAGCACCATTGGGACAGAAAACACTGTTTCTGTGA  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCTTGCTGCCCAGAGCACCATTGGGACAGAAAACACTGTTTCTGTGA  1032

seq1  CTGACAAAAGACTGCTCATACAGATGTAGGGATTAGTAAGGGAGACAGCT  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAAAAGACTGCTCATACAGATGTAGGGATTAGTAAGGGAGACAGCT  1082

seq1  TTGACCGTGGCAGGGATCTGCAAGGCAGGTAGAACCAGGAATTC  1140
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACCGTGGCAGGGATCTGCAAGGCAGGTAGAACCAGGAATTC  1126

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information