MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-242N12
Chromosome	7 (Build37)
Map Location	23,816,296 - 23,817,403
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG620736, EG667444, LOC100043033, LOC100043037, EG667464, EG667469, EG667472, EG667094, LOC100043625, LOC100043626, LOC100043043, LOC100043048, LOC100043632, EG667485, V1rd14, LOC100043051, LOC100043058, EG435947, EG667504, EG667512, LOC100043061, LOC100043638, LOC667527, EG667530, LOC667536, EG667543, LOC100043645, EG667551, LOC100043650, LOC100043067, LOC100043069, LOC670857, LOC620758, EG667570, LOC100043658, LOC100043079, LOC100043083
Downstream gene	EG667586, EG667599, LOC100043086, LOC100043665, LOC667616, LOC100043667, LOC667623, LOC100043088, EG628664, Nlrp4e, LOC434261, Nlrp5, LOC100043095, EG622032, LOC667651, LOC100043101, LOC100043103, EG546944, V1rd7, V1rd9, EG545934, V1rd22, LOC384573, EG622222, LOC546943, V1rd12, V1rd13, V1rd17, LOC100043121, V1rd16, LOC384575, V1rd20, V1rd18
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG620736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620736 MGI:3644439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 100 Proteins

name	EG667444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667444 MGI:3644494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	LOC100043033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667464 MGI:3644264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG667469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667469 MGI:3644289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins

name	EG667472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667472 MGI:3647206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG667094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667094 MGI:3644807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 Proteins

name	LOC100043625 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 71 Proteins

name	LOC100043626 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043043 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043632 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs

name	EG667485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667485 MGI:3645692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	V1rd14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81011 MGI:3033483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043051 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG435947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435947 MGI:3644394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	EG667504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667504 MGI:3643438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	EG667512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667512 MGI:3646576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043061 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	LOC100043638 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins pseudo : _no_value

name	LOC667527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	EG667530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667530 MGI:3646821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	EG667543 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667543 MGI:3642968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC100043645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins

name	EG667551 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 34 Proteins

name	LOC100043650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs

name	LOC100043067 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC620758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	EG667570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667570 MGI:3646358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 33 Proteins pseudo : _no_value

name	LOC100043658 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG667586 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667586 MGI:3644349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins

name	EG667599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667599 MGI:3647550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	LOC100043086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 Proteins pseudo : _no_value

name	LOC100043665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 55 Proteins

name	LOC667616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043667 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	LOC100043088 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	EG628664 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628664 MGI:3647238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 78 Proteins

name	Nlrp4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:446099 MGI:3056600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 mRNAs, 515 ESTs, 34 Proteins pseudo : _no_value

name	Nlrp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	EG622032 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622032 MGI:3644421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC667651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	LOC100043103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	EG546944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546944 MGI:3644326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	V1rd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81012 MGI:3033476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81010 MGI:3033478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545934 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545934 MGI:3645760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins

name	V1rd22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404291 MGI:3033491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG622222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622222 MGI:3648367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	LOC546943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	V1rd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384572 MGI:3033481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232959 MGI:3033482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404286 MGI:3033486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 293 ESTs, 13 Proteins pseudo : _no_value

name	V1rd16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232962 MGI:3033485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1rd20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404289 MGI:3033489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404287 MGI:3033487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG620736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256622 GeneID:620736 MGI:3644439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 100 Proteins product : predicted gene, EG620736, transcript variant 2 transcript_id : XM_896550.3

name	EG667444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379972 GeneID:667444 MGI:3644494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667444, transcript variant 1 transcript_id : XM_990594.1

name	LOC100043033 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256396 GeneID:100043033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479381.1

name	LOC100043037 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256398 GeneID:100043037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479387.1

name	EG667464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256401 GeneID:667464 MGI:3644264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667464 transcript_id : XM_990676.2

name	EG667469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379978 GeneID:667469 MGI:3644289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins product : predicted gene, EG667469 transcript_id : XM_990703.1

name	EG667472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379980 GeneID:667472 MGI:3647206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667472 transcript_id : XM_990722.1

name	EG667094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256404 GeneID:667094 MGI:3644807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 29 Proteins product : predicted gene, EG667094 transcript_id : XM_988272.2

name	LOC100043625 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256623 GeneID:100043625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 71 Proteins product : hypothetical protein LOC100043625 transcript_id : XM_001480641.1

name	LOC100043043 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256410 GeneID:100043043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479398.1

name	LOC100043632 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256625 GeneID:100043632
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs product : hypothetical protein LOC100043632 transcript_id : XM_001480653.1

name	EG667485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379986 GeneID:667485 MGI:3645692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667485 transcript_id : XM_990829.1

name	V1rd14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507695 GeneID:81011 MGI:3033483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D14 transcript_id : NM_030736.1

name	LOC100043051 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256412 GeneID:100043051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479410.1

name	LOC100043058 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256414 GeneID:100043058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to LOC434138 protein transcript_id : XM_001479420.1

name	EG435947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51762802 GeneID:435947 MGI:3644394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : predicted gene, EG435947 transcript_id : XM_487997.1

name	EG667504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379990 GeneID:667504 MGI:3643438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG667504 transcript_id : XM_990941.1

name	EG667512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379992 GeneID:667512 MGI:3646576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667512 transcript_id : XM_990975.1

name	LOC100043061 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256416 GeneID:100043061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479431.1

name	EG667530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256629 GeneID:667530 MGI:3646821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667530 transcript_id : XM_991086.2

name	EG667543 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256418 GeneID:667543 MGI:3642968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : predicted gene, EG667543 transcript_id : XM_991143.2

name	LOC100043645 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256631 GeneID:100043645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 103 Proteins product : hypothetical protein LOC100043645 transcript_id : XM_001480664.1

name	EG667551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380001 GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667551, transcript variant 2 transcript_id : XM_991175.1

name	EG667551 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256633 GeneID:667551 MGI:3646139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG667551, transcript variant 1 transcript_id : XM_001487808.1

name	LOC100043650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256635 GeneID:100043650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 42 ESTs product : similar to gag protein transcript_id : XM_001480672.1

name	LOC100043067 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256420 GeneID:100043067
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479437.1

name	LOC670857 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256637 GeneID:670857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001480674.1

name	LOC620758 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256424 GeneID:620758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_885146.3

name	LOC100043079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256428 GeneID:100043079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to V1rd21 protein transcript_id : XM_001479456.1

name	LOC100043083 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256430 GeneID:100043083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479459.1

name	EG667586 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380012 GeneID:667586 MGI:3644349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 Proteins product : predicted gene, EG667586 transcript_id : XM_991349.1

name	EG667599 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380014 GeneID:667599 MGI:3647550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG667599 transcript_id : XM_991394.1

name	LOC100043665 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256639 GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 55 Proteins product : hypothetical protein LOC100043665, transcript variant 1 transcript_id : XM_001480685.1

name	LOC100043665 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256641 GeneID:100043665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 55 Proteins product : hypothetical protein LOC100043665, transcript variant 2 transcript_id : XM_001480688.1

name	LOC100043667 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256644 GeneID:100043667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to pheromone receptor V3R8 transcript_id : XM_001480693.1

name	LOC100043088 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256432 GeneID:100043088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : similar to pheromone receptor V3R8 transcript_id : XM_001479466.1

name	EG628664 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256646 GeneID:628664 MGI:3647238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 78 Proteins product : predicted gene, EG628664, transcript variant 2 transcript_id : XM_902140.3

name	Nlrp4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921378 GeneID:446099 MGI:3056600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4E transcript_id : NM_001004194.1

name	Nlrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362738 GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 5 transcript_id : NM_011860.2

name	Nlrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362739 GeneID:23968 MGI:1345193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 5 transcript_id : NM_001039143.1

name	LOC100043095 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256436 GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : similar to vomeronasal receptor V1RD12 transcript_id : XM_001479476.1

name	EG622032 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82904588 GeneID:622032 MGI:3644421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622032 transcript_id : XM_886441.1

name	LOC100043101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256438 GeneID:100043101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : similar to vomeronasal receptor V1RD12 transcript_id : XM_001479495.1

name	LOC100043103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256440 GeneID:100043103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : similar to pheromone receptor V3R7 transcript_id : XM_001479499.1

name	EG546944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256442 GeneID:546944 MGI:3644326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : predicted gene, EG546944 transcript_id : XM_621762.3

name	V1rd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723604 GeneID:81012 MGI:3033476
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D7 transcript_id : NM_030737.2

name	V1rd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507693 GeneID:81010 MGI:3033478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D9 transcript_id : NM_030735.1

name	EG545934 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380024 GeneID:545934 MGI:3645760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins product : predicted gene, EG545934 transcript_id : XM_620442.3

name	V1rd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430547 GeneID:404291 MGI:3033491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D22 transcript_id : NM_207548.1

name	EG622222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256444 GeneID:622222 MGI:3648367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : predicted gene, EG622222 transcript_id : XM_886633.2

name	LOC546943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256446 GeneID:546943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : similar to pheromone receptor V3R7 transcript_id : XM_001479520.1

name	V1rd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047413 GeneID:384572 MGI:3033481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D12 transcript_id : NM_206872.1

name	V1rd13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047403 GeneID:232959 MGI:3033482
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D13 transcript_id : NM_206868.1

name	V1rd17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430549 GeneID:404286 MGI:3033486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D17 transcript_id : NM_207545.1

name	V1rd16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047416 GeneID:232962 MGI:3033485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D16 transcript_id : NM_206869.1

name	V1rd20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430543 GeneID:404289 MGI:3033489
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D20 transcript_id : NM_207546.1

name	V1rd18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518531 GeneID:404287 MGI:3033487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : vomeronasal 1 receptor, D18 transcript_id : NM_207618.1

name	EG620736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904067 GeneID:620736 MGI:3644439
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_901643.1

name	EG667444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379973 GeneID:667444 MGI:3644494
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_995688.1

name	LOC100043033 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256397 GeneID:100043033
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479431.1

name	LOC100043037 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256399 GeneID:100043037
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479437.1

name	EG667464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256402 GeneID:667464 MGI:3644264
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995770.2

name	EG667469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379979 GeneID:667469 MGI:3644289
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995797.1

name	EG667472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379981 GeneID:667472 MGI:3647206
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995816.1

name	EG667094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256405 GeneID:667094 MGI:3644807
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_993366.2

name	LOC100043625 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256624 GeneID:100043625
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480691.1

name	LOC100043043 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256411 GeneID:100043043
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479448.1

name	LOC100043632 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256626 GeneID:100043632
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480703.1

name	EG667485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379987 GeneID:667485 MGI:3645692
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_995923.1

name	V1rd14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507696 CCDS:CCDS20925.1 GeneID:81011 MGI:3033483
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R8 product : vomeronasal 1 receptor, D14 protein_id : NP_109661.1

name	LOC100043051 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256413 GeneID:100043051
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479460.1

name	LOC100043058 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256415 GeneID:100043058
definition	codon_start : 1 product : similar to LOC434138 protein protein_id : XP_001479470.1

name	EG435947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762803 GeneID:435947 MGI:3644394
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_487997.1

name	EG667504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379991 GeneID:667504 MGI:3643438
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996035.1

name	EG667512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379993 GeneID:667512 MGI:3646576
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996069.1

name	LOC100043061 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256417 GeneID:100043061
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479481.1

name	EG667530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256630 GeneID:667530 MGI:3646821
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996180.2

name	EG667543 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256419 GeneID:667543 MGI:3642968
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996237.2

name	LOC100043645 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256632 GeneID:100043645
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480714.1

name	EG667551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256634 GeneID:667551 MGI:3646139
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 1 protein_id : XP_001487858.1

name	EG667551 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380002 GeneID:667551 MGI:3646139
definition	codon_start : 1 product : similar to pheromone receptor V3R8 isoform 2 protein_id : XP_996269.1

name	LOC100043650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256636 GeneID:100043650
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001480722.1

name	LOC100043067 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256421 GeneID:100043067
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479487.1

name	LOC670857 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256638 GeneID:670857
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480724.1

name	LOC620758 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256425 GeneID:620758
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_890239.3

name	LOC100043079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256429 GeneID:100043079
definition	codon_start : 1 product : similar to V1rd21 protein protein_id : XP_001479506.1

name	LOC100043083 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256431 GeneID:100043083
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479509.1

name	EG667586 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380013 GeneID:667586 MGI:3644349
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996443.1

name	EG667599 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380015 GeneID:667599 MGI:3647550
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_996488.1

name	LOC100043665 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256640 GeneID:100043665
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480735.1

name	LOC100043665 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256642 GeneID:100043665
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480738.1

name	LOC100043667 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256645 GeneID:100043667
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001480743.1

name	LOC100043088 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256433 GeneID:100043088
definition	codon_start : 1 product : similar to pheromone receptor V3R8 protein_id : XP_001479516.1

name	EG628664 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904693 GeneID:628664 MGI:3647238
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_907233.1

name	Nlrp4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921379 CCDS:CCDS20928.1 GeneID:446099 MGI:3056600
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : NALP, epsilon; NLR family, pyrin domain containing 4 product : NACHT, leucine rich repeat and PYD containing 4E protein_id : NP_001004194.1

name	Nlrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106379 CCDS:CCDS20930.1 GeneID:23968 MGI:1345193
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0002217 - physiological defense response [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; ooplasm; NACHT, leucine rich repeat and PYD containing 5; maternal effect product : NACHT, leucine rich repeat and PYD containing 5 isoform a protein_id : NP_035990.1

name	Nlrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362740 CCDS:CCDS20929.1 GeneID:23968 MGI:1345193
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0002217 - physiological defense response [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; ooplasm; NACHT, leucine rich repeat and PYD containing 5; maternal effect product : NACHT, leucine rich repeat and PYD containing 5 isoform b protein_id : NP_001034232.1

name	LOC100043095 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256437 GeneID:100043095
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD12 protein_id : XP_001479526.1

name	EG622032 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904589 GeneID:622032 MGI:3644421
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_891534.1

name	LOC100043101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256439 GeneID:100043101
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD12 protein_id : XP_001479545.1

name	LOC100043103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256441 GeneID:100043103
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_001479549.1

name	EG546944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256443 GeneID:546944 MGI:3644326
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_621762.3

name	V1rd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507698 GeneID:81012 MGI:3033476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R7 product : vomeronasal 1 receptor, D7 protein_id : NP_109662.1

name	V1rd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507694 CCDS:CCDS20932.1 GeneID:81010 MGI:3033478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R9 product : vomeronasal 1 receptor, D9 protein_id : NP_109660.1

name	EG545934 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63565483 GeneID:545934 MGI:3645760
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD22 protein_id : XP_620442.1

name	V1rd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430548 CCDS:CCDS20933.1 GeneID:404291 MGI:3033491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D22 protein_id : NP_997431.1

name	EG622222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256445 GeneID:622222 MGI:3648367
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_891726.2

name	LOC546943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256447 GeneID:546943
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_001479570.1

name	V1rd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047414 CCDS:CCDS20934.1 GeneID:384572 MGI:3033481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor V1RD12 product : vomeronasal 1 receptor, D12 protein_id : NP_996755.1

name	V1rd13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047404 CCDS:CCDS20935.1 GeneID:232959 MGI:3033482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RD13 product : vomeronasal 1 receptor, D13 protein_id : NP_996751.1

name	V1rd17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430550 CCDS:CCDS20936.1 GeneID:404286 MGI:3033486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D17 protein_id : NP_997428.1

name	V1rd16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047417 CCDS:CCDS20937.1 GeneID:232962 MGI:3033485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor V1RD16 product : vomeronasal 1 receptor, D16 protein_id : NP_996752.1

name	V1rd20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430544 CCDS:CCDS20938.1 GeneID:404289 MGI:3033489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D20 protein_id : NP_997429.1

name	V1rd18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518532 CCDS:CCDS20939.1 GeneID:404287 MGI:3033487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D18 protein_id : NP_997501.1

name	LOC100043626 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043626
definition	number : 1 pseudo : _no_value

name	LOC100043048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043048
definition	number : 2 pseudo : _no_value

name	LOC100043048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043048
definition	number : 1 pseudo : _no_value

name	LOC667536 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667536
definition	number : 1 pseudo : _no_value

name	LOC100043069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043069
definition	number : 2 pseudo : _no_value

name	LOC100043069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043069
definition	number : 1 pseudo : _no_value

name	LOC100043658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043658
definition	number : 1 pseudo : _no_value

name	LOC100043086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043086
definition	number : 2 pseudo : _no_value

name	LOC100043086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043086
definition	number : 1 pseudo : _no_value

name	LOC667623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667623
definition	number : 1 pseudo : _no_value

name	LOC667651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667651
definition	number : 1 pseudo : _no_value

name	LOC667651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667651
definition	number : 2 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 1 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 2 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 3 pseudo : _no_value

name	LOC384575 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384575
definition	number : 1 pseudo : _no_value

name	LOC100043638 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256627 GeneID:100043638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 87 Proteins product : hypothetical protein LOC100043638 pseudo : _no_value transcript_id : XR_034793.1

name	LOC667527 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256628 GeneID:667527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_035708.1

name	EG667570 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256427 GeneID:667570 MGI:3646358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 33 Proteins product : predicted gene, EG667570 pseudo : _no_value transcript_id : XR_002045.2

name	LOC667616 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256643 GeneID:667616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to NALP-epsilon pseudo : _no_value transcript_id : XR_034805.1

name	LOC434261 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256647 GeneID:434261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 mRNAs, 515 ESTs, 34 Proteins product : similar to Keratin 8 pseudo : _no_value transcript_id : XR_034809.1

name	LOC100043121 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256448 GeneID:100043121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 293 ESTs, 13 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) pseudo : _no_value transcript_id : XR_034255.1

clone name	MSMg01-507D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-526A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466C16
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-074G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009K04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-242N12.b	B6Ng01-242N12.g
ACC	GA052381	GA052382
length	1,120	1,173
definition	B6Ng01-242N12.b	B6Ng01-242N12.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctaaaattatatcagtgatcattaagctcttttacagtgggact gccattaggtctttttctgatagtcaaaactgcaaagagaactctgccag tttcccatgtgtcaccagttaattgctcttagatagtaaacagactttct ccatctcaaagcacattccaagaagttgtaaaataattaaacaaaggtca taaaagggaactaacgatttattataggtgctagaacagaagataaaata ttgactgggtttatctatataaaacttcactaatcacttagttatggttt taaaccttcagtgaacctgtggagctgagacaggtgatagatggttagcc agataattactcccaatggatatgcctgtaaacattcattgctataaata aacttctatttcaatttatgatttgattttttttgtgtgaacttgtgatg aactttgtaacaggtgatcatgtattctgaaggatgtgtaagcactgagg acaaagagaagagaatttttccctttccccctccctagaagaatttttcc ttgctagaatattttccttttccccacttaggatctttctgcttttcccc ttagatagctttcataggaaaatttttacaacttagtaataaactctata accacttctctaagtgtccctttttcttcctgtgacttctgaccagcagg ctaagttagagttcccgttgagatagaagaaagaccacattacttaaccc cccactgtcaggctactggtgtcactctcctaagctagcagtcttttacc ctcagaaagagaaaggaagtttttagaaccttttaaaagttatcagcatt tcagtacagtcagcgagcttgaaagccctgagaccctcagactttaaaac cattaccagagtcctactctgtgactccactactactctccctgggccag gaggctcccagcactaatgggtattttctgataataatatgtgtaatagt tccattactgtactacataccttggctgaaaaatacttcaaggacactgg caaaccctcagtgcgtttggtaatgtgctgtctatcacatggatgccatt ttccaacacctggaggagca	gaattctcacctgaggaataccaaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaacactgagat tccacttcactccagtcagaatggctaagatcaaaaactcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttgatg ggattgcaagcttgtacaaccactctggaaatcagtctggcagttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgtcccaaccggtaagaagaacacatgctccactat gttcatagcagccttgtttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacatttacacaatggaatactactcagc tattaaaaaaatgaatttattaaattcctaggcaaatggatggacctgga gggtatcatcctgagtgaagtaacccaatcacaaaggaactcgcacaata tgtactcactgataagtggatattagcccagaaacttaggatacccaaga tataggatacaacttgccaaacgcatgaaattcaaaaagaacgaagacca aagtgtggacactttaccctttcttagaaatgggaacaaaacacccatat aaggagttacagagacaaaatttggagttgtgacaaaggatggaccatct agtgattgccatatgtagggatccatcccataatcagcttccaaatgctg acaccattgcatacactagcaagatttccctgaaaaggacccagatatag ctctctcttgtgagactatgccggggcctaggaaacacagaagtggatga tcacagtcagctattggatgggtcacacggcccctaatggaggagctaga gaaattacccaagagctaaagggaactgcacctataggtggacacaatat gactaaccagtacctggggagcgctttttctttagctgcatattgttatt caaagatggcctagttcggccaatcactgcagagaagtcaatgaactgca actttaattgcccagtcagaacgtcagggactaaaaggggattgggtggc ctagcggcatctgtcgcacgctt
quality values	Open. Hide. 58 31 29 26 58 62 62 62 62 62 62 62 47 62 62 62 62 47 38 38 62 62 62 44 47 47 51 54 59 62 62 18 30 30 28 27 62 56 35 45 28 20 48 43 62 59 62 59 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 49 34 34 34 43 54 62 59 56 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 54 62 62 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 52 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 46 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 48 58 58 52 58 42 41 58 58 58 58 54 58 58 58 58 58 58 52 54 58 54 54 54 48 58 58 58 58 58 58 58 58 54 52 58 58 54 52 58 58 58 54 53 58 54 54 58 58 58 58 51 58 58 49 58 58 58 54 49 47 41 58 58 58 53 50 58 52 50 58 58 58 58 58 51 51 58 58 53 58 58 58 58 37 39 58 58 58 58 51 51 46 58 58 58 58 50 49 46 58 52 53 53 58 58 49 58 58 58 52 53 50 54 49 49 52 58 58 58 53 49 53 52 54 54 50 51 58 49 47 58 58 58 58 58 58 44 51 42 53 52 54 51 58 41 54 36 36 51 54 53 53 52 46 30 49 45 39 53 45 34 54 34 47 49 51 39 54 49 41 40 54 44 51 50 42 33 44 49 47 51 49 54 29 38 35 45 43 53 54 33 53 54 51 52 41 21 44 40 46 30 52 45 42 40 53 51 32 40 44 42 35 54 42 39 34 37 35 38 27 39 28 15 49 24 33 25 32 32 47 41 32 46 33 32 32 34 53 45 31 25 32 34 34 33 26 34 34 32 30 32 37 31 32 45 42 53 52 31 32 27 46 40 51 39 36 34 51 46 51 31 51 27 41 47 30 30 42 37 41 29 31 51 51 51 40 31 31 35 37 27 33 31 51 46 38 32 46 46 38 30 25 46 30 31 31 32 31 31 33 42 47 31 29 32 21 30 31 30 31 32 32 43 31 34 42 38 31 31 34 36 43 37 33 42 35 27 22 33 23 28 31 33 16 20 18 37 30 32 30 31 21 39 18 30 47 38 37 48 41 37 24 23 21 30 38 32 21 18 20 29 41 28 34 22 29 31 26 25 31 31 33 32 29 34 38 31 31 19 25 26 31 33 31 31 31 32 31 31 27 32 14 28 22 20 25 48 33 8 14 31 19 21 32 8 24 22 32 15 19 18 18 24 34 25 30 32 30 28 14 32 48 29 10 17 16 34 48 32 28 31 27 28 9 7 26 9 7 13 8 11 17 12 9 31 17 33 34 22 29 9 14 19 19 17 11 19 12 19 32 22 33 13 19 19 26 27 25 20 28 27 9 22 8 9 11 4 3 3 20 24 47 47 47 18 10 18 16 15 13 8 9 20 13 17 10 5 3 8 10 9 13 3 5 47 13 12 31 8 28 27 20 9 8 28 20 20 24 40 15 12 21 6 15 11 7 8 4 16 18 10 4 2 4 12 21 21 10 5 10 16 16 18 3 3 3 16 6 15 8 13 14 17 10 6 5 10 7 12 6 7 8 6 7 6 16 16 12 7 3 5 2	Open. Hide. 62 47 39 44 62 62 62 47 42 44 18 18 19 12 9 25 21 25 23 30 28 24 24 28 32 56 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 43 49 43 32 34 48 48 40 62 62 49 42 42 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 47 62 56 37 32 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 49 39 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 39 54 58 58 58 58 47 54 54 58 54 58 58 58 54 52 58 58 58 52 54 58 58 54 52 58 58 54 54 58 58 58 52 54 54 54 58 54 58 58 58 52 53 58 50 48 58 49 51 51 48 58 46 41 49 39 58 51 41 51 53 45 46 52 51 50 49 58 51 40 50 50 32 58 58 58 58 58 42 28 39 54 58 50 49 58 51 58 54 58 51 51 52 58 53 46 51 58 58 58 50 58 51 47 49 58 54 50 47 39 52 53 58 54 50 54 58 51 58 42 41 41 37 46 58 58 50 32 39 41 51 52 51 50 53 52 50 42 39 58 58 40 42 58 38 43 38 39 40 54 31 26 51 53 39 49 49 50 40 44 42 52 32 39 23 54 53 42 50 51 33 50 24 44 35 22 40 38 30 51 54 32 33 54 52 52 47 35 25 49 44 42 45 52 37 37 40 51 32 13 54 31 29 44 54 39 37 52 31 52 45 52 39 39 42 53 29 26 28 47 34 41 23 52 32 33 52 33 45 42 53 51 22 29 32 40 24 45 25 47 33 33 53 39 42 32 43 43 32 43 53 28 23 11 8 46 30 31 51 31 31 32 29 30 27 19 27 31 41 27 29 29 31 43 38 31 26 32 37 43 24 42 31 25 28 33 17 48 12 14 46 46 27 31 27 46 46 12 25 21 30 10 33 25 31 23 31 30 31 33 31 29 26 43 32 42 31 32 28 18 21 40 23 25 39 18 26 21 31 24 31 20 18 28 30 47 46 21 18 26 36 22 25 16 44 46 29 30 23 29 30 20 21 32 23 31 31 28 27 21 31 38 31 32 16 26 24 37 32 34 33 32 23 15 11 21 42 22 31 6 15 32 48 33 14 18 22 31 21 19 14 15 24 28 28 30 22 16 30 18 21 26 18 19 25 31 15 32 34 13 10 25 19 31 43 26 23 21 14 14 36 28 6 7 7 4 10 26 34 11 30 15 10 31 26 21 14 32 27 34 17 29 14 23 11 11 11 10 21 16 16 16 19 11 5 15 11 6 5 23 26 18 7 21 8 17 11 18 12 13 14 8 8 10 14 13 10 16 16 40 8 27 12 9 4 11 22 32 34 30 7 7 8 38 18 7 6 24 20 23 19 6 11 11 16 7 10 5 12 8 12 7 8 20 28 17 8 21 10 16 8 7 7 18 20 7 5 7 7 11 16 11 25 9 9 21 16 5 5 3 4 2 3 2 2 4 7 6 2 1 3 3 4 16 5 7 7 6 14 7 19 18 23 13 16 17 15 10 7 5 14 6 14 20 15 7 4 5 1 2 5 3 2 4 4 4 16 10 4 28 4 1 3 7 24 26 17 17 17 16 29 6 4 1 4 10 26 21 7 8 2 1 1 2 2 2 4 6 4 4 6 3 1 3 1 1 6 4 3 5 3 2 2 1 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_23816296_23817403
seq2: B6Ng01-242N12.b_59_1165

seq1  TATATCAGTGATCATTAAGCTCTTTTACAGTGGGACTGCCATTAGGTCTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATCAGTGATCATTAAGCTCTTTTACAGTGGGACTGCCATTAGGTCTT  50

seq1  TTTCTGATAGTCAAAACTGCAAAGAGAACTCTGCCAGTTTCCCATGTGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGATAGTCAAAACTGCAAAGAGAACTCTGCCAGTTTCCCATGTGTC  100

seq1  ACCAGTTAATTGCTCTTAGATAGTAAACAGACTTTCTCCATCTCAAAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGTTAATTGCTCTTAGATAGTAAACAGACTTTCTCCATCTCAAAGCA  150

seq1  CATTCCAAGAAGTTGTAAAATAATTAAACAAAGGTCATAAAAGGGAACTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCCAAGAAGTTGTAAAATAATTAAACAAAGGTCATAAAAGGGAACTA  200

seq1  ACGATTTATTATAGGTGCTAGAACAGAAGATAAAATATTGACTGGGTTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGATTTATTATAGGTGCTAGAACAGAAGATAAAATATTGACTGGGTTTA  250

seq1  TCTATATAAAACTTCACTAATCACTTAGTTATGGTTTTAAACCTTCAGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATATAAAACTTCACTAATCACTTAGTTATGGTTTTAAACCTTCAGTG  300

seq1  AACCTGTGGAGCTGAGACAGGTGATAGATGGTTAGCCAGATAATTACTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTGTGGAGCTGAGACAGGTGATAGATGGTTAGCCAGATAATTACTCC  350

seq1  CAATGGATATGCCTGTAAACATTCATTGCTATAAATAAACTTCTATTTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGGATATGCCTGTAAACATTCATTGCTATAAATAAACTTCTATTTCA  400

seq1  ATTTATGATTTGATTTTTTTTGTGTGAACTTGTGATGAACTTTGTAACAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATGATTTGATTTTTTTTGTGTGAACTTGTGATGAACTTTGTAACAG  450

seq1  GTGATCATGTATTCTGAAGGATGTGTAAGCACTGAGGACAAAGAGAAGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATCATGTATTCTGAAGGATGTGTAAGCACTGAGGACAAAGAGAAGAG  500

seq1  AATTTTTCCCTTTCCCCCTCCCTAGAAGAATTTTTCCTTGCTAGAATATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTTCCCTTTCCCCCTCCCTAGAAGAATTTTTCCTTGCTAGAATATT  550

seq1  TTCCTTTTCCCCACTTAGGATCTTTCTGCTTTTCCCCTTAGATAGCTTTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTTCCCCACTTAGGATCTTTCTGCTTTTCCCCTTAGATAGCTTTC  600

seq1  ATAGGAAAATTTTTACAACTTAGTAATAAACTCTATAACCACTTCTCTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGAAAATTTTTACAACTTAGTAATAAACTCTATAACCACTTCTCTAA  650

seq1  GTGTCCCTTTTTCTTCCTGTGACTTCTGACCAGCAGGCTAAGTTAGAGTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCCCTTTTTCTTCCTGTGACTTCTGACCAGCAGGCTAAGTTAGAGTT  700

seq1  CCCGTTGAGATAGAAGAAAGACCACATTACTTAACCCCCCACTGTCAGGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGTTGAGATAGAAGAAAGACCACATTACTTAACCCCCCACTGTCAGGC  750

seq1  TACTGGTGTCACTCTCCTAAGCTAGCAGTCTTTTACCCTCAGAAAGAGAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGGTGTCACTCTCCTAAGCTAGCAGTCTTTTACCCTCAGAAAGAGAA  800

seq1  AGGAAGTTTTTAGAACCTTTTAAAAGTTATCAGCATTTCAGTACAGTCAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGTTTTTAGAACCTTTTAAAAGTTATCAGCATTTCAGTACAGTCAG  850

seq1  CGAGCTTGAAAGCCCTGAGACCCTCAGACTTTAAAACCATTACCAGAGTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGCTTGAAAGCCCTGAGACCCTCAGACTTTAAAACCATTACCAGAGTC  900

seq1  CTACTCTGTGACTCCACTACTACTCTCCCTGGGCCAGGAGGCTCCCAGCA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTCTGTGACTCCACTACTACTCTCCCTGGGCCAGGAGGCTCCCAGCA  950

seq1  CTAATGGGTATTTTTCTGATAATATATTGTGTAATAGTTCCATTACTGTA  1000
      |||||||||| |||||||||||||   |||||||||||||||||||||||
seq2  CTAATGGGTA-TTTTCTGATAATAATATGTGTAATAGTTCCATTACTGTA  999

seq1  CTACATACCTTGGTTGAAAAAATACTTCAAGGACACTGGCAAACCCTCAG  1050
      ||||||||||||| || |||||||||||||||||||||||||||||||||
seq2  CTACATACCTTGGCTG-AAAAATACTTCAAGGACACTGGCAAACCCTCAG  1048

seq1  TGCGTTTGGTAATGTGCTGTTCTATCACATGGTTGCCATTTTTCAACAC-  1099
      ||||||||||||||||||| |||||||||||| ||||||||| |||||| 
seq2  TGCGTTTGGTAATGTGCTG-TCTATCACATGGATGCCATTTTCCAACACC  1097

seq1  -TGAGGAGCA  1108
        ||||||||
seq2  TGGAGGAGCA  1107

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information