MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-247P22
Chromosome	7 (Build37)
Map Location	32,527,996 - 32,529,011
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Sbsn, Dmkn, Krtdap, Ffar2, Ffar3, Ffar1, Cd22, Mag, Hamp2, Usf2-ps1, Hamp1, Usf2, LOC100043823, Lsr, Tmem162, Fxyd5, Fxyd7, Fxyd1, Lgi4, Fxyd3, Hpn, Scn1b, Gramd1a, LOC672598, LOC100043323, LOC100043827, Apbh, Abpe, LOC100043326, EG384585, LOC100043328, LOC100043331, LOC626181, LOC100043334, LOC100043834, LOC546947, LOC677233, LOC100043337, LOC546949, LOC100043836, EG626305
Downstream gene	EG668342, EG626330, LOC100043340, LOC100043343, EG626358, LOC668351, EG384593, LOC100043351, LOC100043352, LOC100043353, EG384594, LOC100043838, EG668361, LOC668362, EG624584, LOC100043355, LOC546951, EG626740, EG668371, EG668377, LOC100043842, LOC634929, EG668379, EG668381, LOC668386, LOC626373, EG384589, EG668393, EG330689, LOC100043362, LOC100043365, EG384591, LOC668398, EG384596, LOC100043370, LOC434161, EG270499
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sbsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:282619 MGI:2446326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dmkn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73712 MGI:1920962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Krtdap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64661 MGI:1928282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233079 MGI:2441731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233080 MGI:2685324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ffar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233081 MGI:2684079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12483 MGI:88322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17136 MGI:96912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66438 MGI:2153530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usf2-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140554 MGI:2153531
definition	note : upstream transcription factor 2, pseudogene 1 pseudo : _no_value

name	Hamp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84506 MGI:1933533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22282 MGI:99961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043823 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Lsr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54135 MGI:1927471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem162 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76415 MGI:1923665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18301 MGI:1201785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57780 MGI:1889006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56188 MGI:1889273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Lgi4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243914 MGI:2180197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17178 MGI:107497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15451 MGI:1196620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20266 MGI:98247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gramd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52857 MGI:105490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043827 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043827
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Apbh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57426 MGI:1930867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abpe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381970 MGI:3042579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG384585 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384585 MGI:3644233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC100043328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC626181 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100043334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC546947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC677233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC546949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043836 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 38 ESTs, 5 Proteins

name	EG626305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626305 MGI:3643480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	EG668342 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668342 MGI:3647353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG626330 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626330 MGI:3646173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100043340 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043343 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG626358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626358 MGI:3646884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	LOC668351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG384593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384593 MGI:3647423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043353 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG384594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384594 MGI:3647426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043838 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668361 MGI:3648386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins pseudo : _no_value

name	LOC668362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	LOC100043355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC546951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG626740 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626740 MGI:3646832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein

name	EG668371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668371 MGI:3645182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	EG668377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668377 MGI:3645179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC634929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG668379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668379 MGI:3645177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	EG668381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668381 MGI:3645736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	LOC668386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	LOC626373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG384589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384589 MGI:3644231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins

name	EG668393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668393 MGI:3646192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	EG330689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330689 MGI:3649164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043365 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG384591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384591 MGI:3647424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	LOC668398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG384596 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384596 MGI:3644821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434161 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG270499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270499 MGI:3647682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Sbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953884 GeneID:282619 MGI:2446326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suprabasin transcript_id : NM_172205.3

name	Sbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953886 GeneID:282619 MGI:2446326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suprabasin transcript_id : NM_001083903.1

name	Dmkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375786 GeneID:73712 MGI:1920962
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dermokine transcript_id : NM_172899.3

name	Dmkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50284531 GeneID:73712 MGI:1920962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dermokine transcript_id : NM_028618.1

name	Krtdap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382948 GeneID:64661 MGI:1928282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratinocyte differentiation associated protein transcript_id : NM_001033131.2

name	Ffar2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373011 GeneID:233079 MGI:2441731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 2 transcript_id : NM_146187.3

name	Ffar3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345193 GeneID:233080 MGI:2685324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 3 transcript_id : NM_001033316.2

name	Ffar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835700 GeneID:233081 MGI:2684079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : free fatty acid receptor 1 transcript_id : NM_194057.2

name	Cd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807202 GeneID:12483 MGI:88322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD22 antigen transcript_id : NM_001043317.1

name	Cd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807200 GeneID:12483 MGI:88322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD22 antigen transcript_id : NM_009845.2

name	Mag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130141 GeneID:17136 MGI:96912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated glycoprotein transcript_id : NM_010758.2

name	Hamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802189 GeneID:66438 MGI:2153530
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepcidin antimicrobial peptide 2 transcript_id : NM_183257.2

name	Hamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14211541 GeneID:84506 MGI:1933533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepcidin antimicrobial peptide 1 transcript_id : NM_032541.1

name	Usf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755944 GeneID:22282 MGI:99961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream transcription factor 2 transcript_id : NM_011680.1

name	LOC100043823 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256691 GeneID:100043823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100043823 transcript_id : XM_001481105.1

name	Lsr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794489 GeneID:54135 MGI:1927471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipolysis stimulated lipoprotein receptor transcript_id : NM_017405.1

name	Tmem162 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802962 GeneID:76415 MGI:1923665
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 162 transcript_id : NM_175240.3

name	Fxyd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612666 GeneID:18301 MGI:1201785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 5 transcript_id : NM_008761.2

name	Fxyd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612660 GeneID:57780 MGI:1889006
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 7 transcript_id : NM_022007.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577139 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_052992.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577136 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_194321.1

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577135 GeneID:56188 MGI:1889273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_019503.2

name	Fxyd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37577138 GeneID:56188 MGI:1889273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 1 transcript_id : NM_052991.2

name	Lgi4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981705 GeneID:243914 MGI:2180197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeat LGI family, member 4 transcript_id : NM_144556.2

name	Fxyd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678813 GeneID:17178 MGI:107497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 3 transcript_id : NM_008557.1

name	Hpn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377829 GeneID:15451 MGI:1196620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepsin transcript_id : NM_008281.2

name	Scn1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981505 GeneID:20266 MGI:98247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type I, beta transcript_id : NM_011322.2

name	Gramd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360343 GeneID:52857 MGI:105490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRAM domain containing 1A transcript_id : NM_027898.3

name	LOC100043323 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256501 GeneID:100043323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001479970.1

name	Apbh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357193 GeneID:57426 MGI:1930867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen-binding protein eta transcript_id : NM_020563.2

name	Abpe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402272 GeneID:381970 MGI:3042579
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen binding protein epsilon transcript_id : NM_207262.1

name	LOC100043326 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256505 GeneID:100043326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein epsilon transcript_id : XM_001479974.1

name	EG384585 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380126 GeneID:384585 MGI:3644233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG384585 transcript_id : XM_357729.4

name	LOC100043334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256507 GeneID:100043334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to allergen dI chain C2C transcript_id : XM_001479986.1

name	LOC100043836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256693 GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs, 5 Proteins product : similar to lacrimal androgen-binding protein delta, transcript variant 1 transcript_id : XM_001481113.1

name	LOC100043836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256695 GeneID:100043836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to lacrimal androgen-binding protein delta, transcript variant 2 transcript_id : XM_001481115.1

name	EG626305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380127 GeneID:626305 MGI:3643480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG626305 transcript_id : XM_890897.2

name	EG626330 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905081 GeneID:626330 MGI:3646173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG626330 transcript_id : XM_890923.1

name	EG626358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256510 GeneID:626358 MGI:3646884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG626358 transcript_id : XM_890946.2

name	LOC100043352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256517 GeneID:100043352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480006.1

name	LOC100043353 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256519 GeneID:100043353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001480011.1

name	EG384594 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086278 GeneID:384594 MGI:3647426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG384594 transcript_id : XM_357734.1

name	EG624584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380174 GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 1 Protein product : predicted gene, EG624584, transcript variant 1 transcript_id : XM_892661.2

name	EG624584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256697 GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 1 Protein product : predicted gene, EG624584, transcript variant 2 transcript_id : XM_900241.3

name	LOC100043355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256522 GeneID:100043355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001480020.1

name	EG626740 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380140 GeneID:626740 MGI:3646832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : predicted gene, EG626740 transcript_id : XM_891349.2

name	LOC100043842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256698 GeneID:100043842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to lacrimal androgen-binding protein delta transcript_id : XM_001481120.1

name	LOC634929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256524 GeneID:634929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480028.1

name	EG668379 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256700 GeneID:668379 MGI:3645177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG668379 transcript_id : XM_001001176.2

name	EG668381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256701 GeneID:668381 MGI:3645736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : predicted gene, EG668381 transcript_id : XM_001001188.2

name	EG384589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380147 GeneID:384589 MGI:3644231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : predicted gene, EG384589 transcript_id : XM_357730.5

name	EG330689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51744732 GeneID:330689 MGI:3649164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG330689 transcript_id : XM_286083.2

name	EG384591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256526 GeneID:384591 MGI:3647424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG384591 transcript_id : XM_357732.6

name	EG384596 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086282 GeneID:384596 MGI:3644821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG384596 transcript_id : XM_357735.1

name	LOC434161 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256532 GeneID:434161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480058.1

name	EG270499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25032836 GeneID:270499 MGI:3647682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG270499 transcript_id : XM_195264.1

name	Sbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953885 GeneID:282619 MGI:2446326
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; suprabasal-specific protein product : suprabasin isoform 1 protein_id : NP_757342.2

name	Sbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953887 GeneID:282619 MGI:2446326
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; suprabasal-specific protein product : suprabasin isoform 2 protein_id : NP_001077372.1

name	Dmkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230483 GeneID:73712 MGI:1920962
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] codon_start : 1 exception : mismatches in translation note : beta is encoded by transcript variant 2; epidermis-specific secreted protein product : dermokine beta protein_id : NP_766487.2

name	Dmkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284532 GeneID:73712 MGI:1920962
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] codon_start : 1 note : alpha is encoded by transcript variant 1; epidermis-specific secreted protein product : dermokine alpha protein_id : NP_082894.1

name	Krtdap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781694 CCDS:CCDS21110.1 GeneID:64661 MGI:1928282
definition	GO_process : GO:0008544 - epidermis development [Evidence ISS] codon_start : 1 product : keratinocyte differentiation associated protein protein_id : NP_001028303.1

name	Ffar2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122727 CCDS:CCDS21111.1 GeneID:233079 MGI:2441731
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 43 protein_id : NP_666299.1

name	Ffar3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701812 CCDS:CCDS21112.1 GeneID:233080 MGI:2685324
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : putative G protein-coupled receptor GPR41 product : G protein-coupled receptor 41 protein_id : NP_001028488.1

name	Ffar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835701 CCDS:CCDS21113.1 GeneID:233081 MGI:2684079
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR40 product : G protein-coupled receptor 40 protein_id : NP_918946.2

name	Cd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807203 GeneID:12483 MGI:88322
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IPI]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : CD22 antigen protein_id : NP_001036782.1

name	Cd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807201 CCDS:CCDS21114.1 GeneID:12483 MGI:88322
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IPI]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015026 - coreceptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD22 antigen protein_id : NP_033975.2

name	Mag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754614 CCDS:CCDS21115.1 GeneID:17136 MGI:96912
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : myelin-associated glycoprotein protein_id : NP_034888.1

name	Hamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304034 GeneID:66438 MGI:2153530
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0050832 - defense response to fungus [Evidence IEA]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IEA] codon_start : 1 product : hepcidin antimicrobial peptide 2 protein_id : NP_899080.1

name	Hamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14211542 GeneID:84506 MGI:1933533
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0050832 - defense response to fungus [Evidence IDA]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : hepcidin antimicrobial peptide 1 protein_id : NP_115930.1

name	Usf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755945 CCDS:CCDS21118.1 GeneID:22282 MGI:99961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007595 - lactation [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcription factor product : upstream stimulatory factor 2 protein_id : NP_035810.1

name	LOC100043823 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256692 GeneID:100043823
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481155.1

name	Lsr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794490 CCDS:CCDS21119.1 GeneID:54135 MGI:1927471
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0042627 - chylomicron [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] codon_start : 1 note : lipolysis stimulated receptor product : liver-specific bHLH-Zip transcription factor protein_id : NP_059101.1

name	Tmem162 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30172568 CCDS:CCDS21120.1 GeneID:76415 MGI:1923665
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76415 protein_id : NP_780449.1

name	Fxyd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679168 CCDS:CCDS21121.1 GeneID:18301 MGI:1201785
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : oncoprotein induced transcript 2 product : FXYD domain-containing ion transport regulator 5 protein_id : NP_032787.1

name	Fxyd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612661 CCDS:CCDS21122.1 GeneID:57780 MGI:1889006
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : FXYD domain-containing ion transport regulator 7 protein_id : NP_071290.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506705 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : FXYD domain-containing ion transport regulator 1 (MGD\|MGI:1889273)putative; phospholemman product : phospholemman precursor protein_id : NP_062376.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996479 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_443717.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37577140 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_443718.1

name	Fxyd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37577137 CCDS:CCDS21123.1 GeneID:56188 MGI:1889273
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : phospholemman product : phospholemman precursor protein_id : NP_919302.1

name	Lgi4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981706 CCDS:CCDS21124.1 GeneID:243914 MGI:2180197
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042552 - myelination [Evidence IMP]; GO:0042551 - neuron maturation [Evidence IMP] codon_start : 1 function : putative secreted protein note : LGI1-like protein 3; leucine-rich glioma inactivated protein 4; claw paw product : leucine-rich repeat LGI family, member 4 protein_id : NP_653139.2

name	Fxyd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678814 CCDS:CCDS21125.1 GeneID:17178 MGI:107497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mammary tumor 8 kDa product : chloride conductance inducer protein MAT-8 precursor protein_id : NP_032583.1

name	Hpn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680267 GeneID:15451 MGI:1196620
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hepsin protein_id : NP_032307.1

name	Scn1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755408 CCDS:CCDS21126.1 GeneID:20266 MGI:98247
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium channel, voltage-gated, type I, beta polypeptide product : sodium channel, voltage-gated, type I, beta protein_id : NP_035452.1

name	Gramd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360344 GeneID:52857 MGI:105490
definition	codon_start : 1 product : GRAM domain containing 1A protein_id : NP_082174.3

name	LOC100043323 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256502 GeneID:100043323
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480020.1

name	Apbh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181188 GeneID:57426 MGI:1930867
definition	codon_start : 1 note : lacrimal gland protein; major allergen 1-like product : androgen-binding protein eta protein_id : NP_065588.1

name	Abpe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402273 CCDS:CCDS21128.1 GeneID:381970 MGI:3042579
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : lacrimal androgen-binding protein epsilon product : androgen binding protein epsilon protein_id : NP_997145.1

name	LOC100043326 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256506 GeneID:100043326
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein epsilon protein_id : XP_001480024.1

name	EG384585 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51782621 GeneID:384585 MGI:3644233
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_357729.2

name	LOC100043334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256508 GeneID:100043334
definition	codon_start : 1 product : similar to allergen dI chain C2C protein_id : XP_001480036.1

name	LOC100043836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256696 GeneID:100043836
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_001481165.1

name	LOC100043836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256694 GeneID:100043836
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 1 protein_id : XP_001481163.1

name	EG626305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905078 GeneID:626305 MGI:3643480
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_895990.1

name	EG626330 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905082 GeneID:626330 MGI:3646173
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_896016.1

name	EG626358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256511 GeneID:626358 MGI:3646884
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase protein_id : XP_896039.2

name	LOC100043352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256518 GeneID:100043352
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480056.1

name	LOC100043353 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256520 GeneID:100043353
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001480061.1

name	EG384594 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086279 GeneID:384594 MGI:3647426
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_357734.1

name	EG624584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904930 GeneID:624584 MGI:3643785
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 1 protein_id : XP_897754.1

name	EG624584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904932 GeneID:624584 MGI:3643785
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_905334.1

name	LOC100043355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256523 GeneID:100043355
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480070.1

name	EG626740 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905136 GeneID:626740 MGI:3646832
definition	codon_start : 1 product : similar to allergen dI chain C2C protein_id : XP_896442.1

name	LOC100043842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256699 GeneID:100043842
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_001481170.1

name	LOC634929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256525 GeneID:634929
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480078.1

name	EG668379 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380144 GeneID:668379 MGI:3645177
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_001001176.1

name	EG668381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380146 GeneID:668381 MGI:3645736
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001001188.1

name	EG384589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556710 GeneID:384589 MGI:3644231
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_357730.3

name	EG330689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51744733 GeneID:330689 MGI:3649164
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_286083.2

name	EG384591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256527 GeneID:384591 MGI:3647424
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase protein_id : XP_357732.6

name	EG384596 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086283 GeneID:384596 MGI:3644821
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_357735.1

name	LOC434161 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256533 GeneID:434161
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480108.1

name	EG270499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25032837 GeneID:270499 MGI:3647682
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_195264.1

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 1 pseudo : _no_value

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 2 pseudo : _no_value

name	LOC672598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672598
definition	number : 3 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 1 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 2 pseudo : _no_value

name	LOC100043827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043827
definition	number : 3 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 4 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 3 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 2 pseudo : _no_value

name	LOC100043328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043328
definition	number : 1 pseudo : _no_value

name	LOC100043331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043331
definition	number : 1 pseudo : _no_value

name	LOC100043331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043331
definition	number : 2 pseudo : _no_value

name	LOC626181 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626181
definition	number : 2 pseudo : _no_value

name	LOC626181 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626181
definition	number : 1 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 3 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 2 pseudo : _no_value

name	LOC100043834 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043834
definition	number : 1 pseudo : _no_value

name	LOC546947 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546947
definition	number : 1 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 1 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 2 pseudo : _no_value

name	LOC677233 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677233
definition	number : 3 pseudo : _no_value

name	LOC100043337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043337
definition	number : 1 pseudo : _no_value

name	LOC100043337 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043337
definition	number : 2 pseudo : _no_value

name	LOC546949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546949
definition	number : 1 pseudo : _no_value

name	EG668342 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668342
definition	number : 1 pseudo : _no_value

name	LOC100043340 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043340
definition	number : 3 pseudo : _no_value

name	LOC100043340 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043340
definition	number : 2 pseudo : _no_value

name	LOC100043340 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043340
definition	number : 1 pseudo : _no_value

name	LOC100043343 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043343
definition	number : 1 pseudo : _no_value

name	LOC100043343 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043343
definition	number : 2 pseudo : _no_value

name	LOC100043343 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043343
definition	number : 3 pseudo : _no_value

name	LOC668351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668351
definition	number : 1 pseudo : _no_value

name	LOC668351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668351
definition	number : 2 pseudo : _no_value

name	EG384593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384593
definition	number : 1 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 3 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 2 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 1 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 3 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 2 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 1 pseudo : _no_value

name	LOC668362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668362
definition	number : 1 pseudo : _no_value

name	LOC546951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546951
definition	number : 1 pseudo : _no_value

name	EG668371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668371
definition	number : 1 pseudo : _no_value

name	EG668371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668371
definition	number : 2 pseudo : _no_value

name	EG668377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668377
definition	number : 1 pseudo : _no_value

name	LOC668386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668386
definition	number : 1 pseudo : _no_value

name	LOC626373 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626373
definition	number : 1 pseudo : _no_value

name	EG668393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668393
definition	number : 1 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 3 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 2 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 1 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 1 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 2 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 3 pseudo : _no_value

name	LOC668398 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668398
definition	number : 1 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 3 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 2 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 1 pseudo : _no_value

name	EG668361 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256521 GeneID:668361 MGI:3648386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins product : predicted gene, EG668361 pseudo : _no_value transcript_id : XR_002168.2

clone name	MSMg01-360J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432P02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-465I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359C06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294P02
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-040M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038B11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-247P22.b	B6Ng01-247P22.g
ACC	GA056183	GA056184
length	1,056	1,048
definition	B6Ng01-247P22.b	B6Ng01-247P22.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttagggccacttacatatactatcatatcatttgcaaatagtga tattttgacttcttcctttccaatttgtatcccctttatctccttttgtt gtcgaattgttgtggctaggacttcaagtactatattgaatagataaaga gaaagtgggcagccttgtctattccgtgatttttgtggggttcttttgag tatctctctttattaatgtttcttacccatttgctgtatattgcttttat tatgtgtagggatgggccttgaattcttgatctcttcaaggctttttatc ttgaacgggtgtggattttgtcaaatgttgttcagcatctaatgagatga tcattagtttttgtctttaagtttttttatatagtggattacgttgatgg atttccatatattaaaccatccatgcatcccttggatgaagcctctttag ttatgatagatgatcattttgttggattcttggatttggtttgcgatgat tttattgagtatttttgcattgatattcataagggaaattggtctgaagt tctctttcttccttggttctttgtgtgctttaggtatcaaagtaattgtg gcttcatagaatgaactgggtagagtaccttctctttctattttgtgaaa tagtttgaggagtgttggaattaggtctgctttgaaggtctgacagaatt ctgcaataaaccattctgctcctgggctttttttggctgggagactattg atgagtgctcttatatcctaaggtgaaatggaactgttttgatccttaat ctgatcctgatttcactttggtacctggtatctatctaggaagtggtcga tttcatccaagttttctagttttattgagtatagcctttttagtagtatc tgatgatgttttagatttcctgaaattctgttgttatgtttcagttttat ttttgattttgttaattatgaatactatccctggtgcttctaatgggtaa gggtttatctatggtggttgattttctcaaagaaccaaacctcctggttt cggtag	gaattctctttttctttttcctcctctcccatggctgatggaagtgcatc cttgtttcccgcttatacccagccttttgtatatcagtttttattaacaa atcagagaataaattgttcaataacaaacctggtctcaaataattagttg aagactgttcagatagctcagtgattaaaggtgcactgattgaaggtgaa cacctgagttgaaatttcagaacccacctggtagaagaaaagaagtaagt tctctaaattgtaatttaaccttccacacacacacacacacacacacaca cacagcttgatacctctgtctatacacagtcacacacaaacaagcacaca aacacatgaacacacacctacaaatgtctgtgaaaactggcatcagtaag cattaataagctcctaatggaaaaatatgaagcaatttgacaaacaaact aaataacacatgagattgtactataatggtgaaataacctataaacccat gcacatgtgaattgctgcatggcaggtaaatgaacattactgaacctgac gggacctgcgggacccagaggtctctccactctgcagaaaccctacaaac caggacctcagaatcatgggtaagtggaacagaacatcagcaccaaagaa tcccagagggtcttgtgccagcaggaagagggacaaaggaaccctgaact accagaggctgggattcattctggttggcgccagcccggccatcttcttt ttgaacccagtggagggagccaaggacccagaggactctccacaccacag gatccatatcacacccaaaatccaggcatcacgggactcaggaagtagat tggagctccagacttctggacacctgccctgcataaaggagagcttgaat gcagagagtgctctgaccactgtgactcagtgagagttgggactcccagg acagctgacagaggctaacagaatcaaagagaacaagcttcagccagaga cagctatatcttctaacaccagagatacatattgctaaggcaagcata
quality values	Open. Hide. 58 26 32 34 58 58 58 58 58 58 58 54 54 39 23 47 62 54 62 47 33 62 62 62 62 62 62 54 56 32 24 38 27 27 20 21 43 38 49 49 59 59 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 49 59 62 62 62 54 54 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 41 46 62 62 62 62 47 62 62 54 62 62 58 58 58 58 52 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 49 58 54 58 58 58 58 58 58 54 58 54 58 58 58 58 48 54 42 58 54 52 54 54 52 58 58 58 58 54 54 54 58 58 54 58 58 52 58 54 52 42 54 58 52 58 42 42 58 58 54 48 58 58 58 58 54 52 51 58 50 51 49 44 58 49 58 51 54 50 53 58 58 50 50 52 47 58 58 58 58 50 51 53 58 50 52 45 41 54 58 58 58 53 39 58 58 37 51 51 46 54 51 58 54 50 47 39 33 50 58 46 50 58 49 50 58 58 58 49 53 53 32 51 24 37 51 51 51 26 44 31 58 39 39 53 45 53 50 50 39 41 50 40 54 39 49 50 37 58 41 45 53 50 50 51 40 50 50 51 58 52 35 39 58 51 58 58 58 49 51 51 29 41 40 54 32 28 24 28 21 45 53 35 51 42 30 26 50 54 28 49 44 36 51 42 34 54 49 38 32 37 35 44 26 28 40 21 46 29 38 44 54 31 40 51 33 33 24 33 37 47 38 54 54 46 33 34 34 22 47 47 29 33 45 32 40 52 40 24 17 19 33 35 39 45 25 54 32 33 9 27 41 52 25 36 33 36 29 40 35 32 53 32 45 39 39 40 37 32 53 32 24 23 20 35 47 21 21 18 21 42 32 36 25 19 11 47 26 31 21 36 25 30 33 31 25 51 51 51 34 36 32 37 34 46 51 51 35 29 14 22 31 37 24 36 31 26 31 26 20 28 28 46 46 46 41 32 10 16 25 24 23 24 30 31 31 32 31 18 38 43 16 43 32 40 27 28 20 5 16 28 46 38 26 44 30 25 22 46 25 16 24 31 27 38 16 36 37 13 15 23 26 25 11 46 24 25 18 15 29 46 46 20 20 7 32 41 39 25 13 27 18 38 32 11 31 10 20 19 10 7 8 16 13 32 32 7 8 9 31 13 31 19 13 29 22 5 14 27 13 21 29 7 8 27 11 9 15 7 28 44 31 29 25 12 11 34 13 11 34 11 25 26 20 12 19 14 8 6 30 8 11 24 11 9 18 18 32 26 31 19 11 8 15 31 20 8 25 33 8 7 5 24 18 6 8 15 33 12 7 17 18 10 28 22 4 15 13 5 8 5	Open. Hide. 62 44 37 44 62 62 62 62 34 32 28 25 25 25 25 32 49 43 38 43 54 56 62 62 62 62 59 62 62 59 59 62 54 54 54 54 54 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 46 54 31 43 35 34 43 56 59 62 62 59 62 62 62 62 62 62 59 62 54 62 62 62 54 54 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 54 52 52 52 54 58 58 58 58 49 54 58 58 58 58 58 58 58 58 58 58 58 58 45 58 58 58 58 54 54 58 58 54 54 54 58 54 58 54 58 58 58 44 48 54 54 58 49 52 54 58 52 41 38 54 54 58 54 54 58 58 45 34 41 47 51 49 51 53 58 58 53 58 53 53 47 49 48 45 54 51 51 58 58 54 53 58 51 50 49 49 52 53 51 51 48 49 51 49 49 51 52 52 51 27 41 48 52 51 50 58 37 40 50 50 51 58 58 58 50 52 50 49 51 58 51 58 53 42 51 39 58 41 50 52 51 53 42 52 54 29 33 41 33 51 51 39 58 33 39 40 50 43 49 38 41 13 49 54 52 53 53 52 54 53 51 44 50 41 41 51 39 34 54 49 49 34 54 22 54 51 38 27 37 39 42 30 54 39 35 39 34 27 42 49 51 34 34 40 39 50 40 38 40 44 19 54 44 38 53 54 54 35 40 45 34 34 54 49 42 45 51 37 33 31 46 54 36 43 46 44 19 52 52 51 44 35 49 27 44 32 52 32 53 41 36 31 49 49 49 52 32 32 46 29 40 40 32 45 32 52 32 30 13 49 40 24 29 29 40 32 31 30 46 34 18 40 45 34 32 38 12 51 29 19 32 31 30 24 36 24 30 30 30 45 30 30 31 21 51 28 26 21 51 26 31 30 31 31 31 37 30 41 40 38 22 42 46 38 34 25 42 24 10 18 33 32 36 32 31 28 39 42 33 23 19 43 33 31 6 41 29 46 33 33 30 31 29 23 26 16 15 30 17 29 32 27 37 16 11 30 18 31 41 30 21 30 28 31 24 26 32 23 16 32 21 31 19 27 38 29 29 31 21 41 16 25 27 27 16 37 22 31 31 26 18 17 20 29 33 24 24 29 38 21 26 25 21 34 27 35 23 14 20 33 19 21 26 30 30 14 8 15 33 32 32 22 4 4 7 17 33 10 22 19 32 24 9 43 7 33 17 33 27 36 19 25 21 19 16 12 20 21 28 23 23 30 10 14 10 25 7 18 23 32 18 23 27 27 6 15 7 19 17 18 40 7 5 14 5 3 12 14 8 27 19 16 13 14 16 21 9 8 12 24 10 23 9 12 18 20 14 18 28 15 11 9 14 13 18 15 27 28 25 8 12 11 8 21 7 19 27 9 17 20 8 7 9 2 9 8 18 19 12 16 18 8 6 10 12 14 12 11 11 10 8 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_32527996_32529011
seq2: B6Ng01-247P22.g_103_1114 (reverse)

seq1  TATGCTTGCCTTTAGCAATATTGTAATCTCTGGTGTTAGAAGATATAGCT  50
      |||||||||| ||||||||| ||| |||||||||||||||||||||||||
seq2  TATGCTTGCC-TTAGCAATA-TGT-ATCTCTGGTGTTAGAAGATATAGCT  47

seq1  GTCTCTGGCTGAAGCTTGTTCCTCCTTTGATTCTGTTAGCCTCTGTCAGC  100
      |||||||||||||||||||||   ||||||||||||||||||||||||||
seq2  GTCTCTGGCTGAAGCTTGTTC--TCTTTGATTCTGTTAGCCTCTGTCAGC  95

seq1  TGTCCTGGGAGT-CCAACTCTCACCTGAGTCACAGTGGTCAGAGCACTCT  149
      |||||||||||| |||||||||| ||||||||||||||||||||||||||
seq2  TGTCCTGGGAGTCCCAACTCTCA-CTGAGTCACAGTGGTCAGAGCACTCT  144

seq1  CTGCATTCAAGCTCTCC-TTATGCAGGGCAGGTGTCCAGAAGTCTGGAGC  198
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  CTGCATTCAAGCTCTCCTTTATGCAGGGCAGGTGTCCAGAAGTCTGGAGC  194

seq1  TCCAATCTACTTCCTGAGTCCCGTGATGCCTGGATTTTGGGTGTGATATG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAATCTACTTCCTGAGTCCCGTGATGCCTGGATTTTGGGTGTGATATG  244

seq1  GATCCTGTGGTGTGGAGAGTCCTCTGGGTCCTTGGCTCCCTCCACTGGGT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCTGTGGTGTGGAGAGTCCTCTGGGTCCTTGGCTCCCTCCACTGGGT  294

seq1  TCAAAAAGAAGATGGCCGGGCTGGCGCCAACCAGAATGAATCCCAGCCTC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAAAGAAGATGGCCGGGCTGGCGCCAACCAGAATGAATCCCAGCCTC  344

seq1  TGGTAGTTCAGGGTTCCTTTGTCCCTCTTCCTGCTGGCACAAGACCCTCT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAGTTCAGGGTTCCTTTGTCCCTCTTCCTGCTGGCACAAGACCCTCT  394

seq1  GGGATTCTTTGGTGCTGATGTTCTGTTCCACTTACCCATGATTCTGAGGT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATTCTTTGGTGCTGATGTTCTGTTCCACTTACCCATGATTCTGAGGT  444

seq1  CCTGGTTTGTAGGGTTTCTGCAGAGTGGAGAGACCTCTGGGTCCCGCAGG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTTTGTAGGGTTTCTGCAGAGTGGAGAGACCTCTGGGTCCCGCAGG  494

seq1  TCCCGTCAGGTTCAGTAATGTTCATTTACCTGCCATGCAGCAATTCACAT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGTCAGGTTCAGTAATGTTCATTTACCTGCCATGCAGCAATTCACAT  544

seq1  GTGCATGGGTTTATAGGTTATTTCACCATTATAGTACAATCTCATGTGTT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCATGGGTTTATAGGTTATTTCACCATTATAGTACAATCTCATGTGTT  594

seq1  ATTTAGTTTGTTTGTCAAATTGCTTCATATTTTTCCATTAGGAGCTTATT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGTTTGTTTGTCAAATTGCTTCATATTTTTCCATTAGGAGCTTATT  644

seq1  AATGCTTACTGATGCCAGTTTTCACAGACATTTGTAGGTGTGTGTTCATG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCTTACTGATGCCAGTTTTCACAGACATTTGTAGGTGTGTGTTCATG  694

seq1  TGTTTGTGTGCTTGTTTGTGTGTGACTGTGTATAGACAGAGGTATCAAGC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGTGTGCTTGTTTGTGTGTGACTGTGTATAGACAGAGGTATCAAGC  744

seq1  TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGAAGGTTAAATTACAATTTA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGAAGGTTAAATTACAATTTA  794

seq1  GAGAACTTACTTCTTTTCTTCTACCAGGTGGGTTCTGAAATTTCAACTCA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACTTACTTCTTTTCTTCTACCAGGTGGGTTCTGAAATTTCAACTCA  844

seq1  GGTGTTCACCTTCAATCAGTGCACCTTTAATCACTGAGCTATCTGAACAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTTCACCTTCAATCAGTGCACCTTTAATCACTGAGCTATCTGAACAG  894

seq1  TCTTCAACTAATTATTTGAGACCAGGTTTGTTATTGAACAATTTATTCTC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAACTAATTATTTGAGACCAGGTTTGTTATTGAACAATTTATTCTC  944

seq1  TGATTTGTTAATAAAAACTGATATACAAAAGGCTGGGTATAAGCGGGAAA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTGTTAATAAAAACTGATATACAAAAGGCTGGGTATAAGCGGGAAA  994

seq1  CAAGGATGCACTTCCATC  1016
      ||||||||||||||||||
seq2  CAAGGATGCACTTCCATC  1012

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information