MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-248N09
Chromosome	7 (Build37)
Map Location	132,743,743 - 132,966,097
singlet/doublet	doublet
Overlap gene	Il21r, Gtf3c1, D430042O09Rik
Upstream gene	EG545999, LOC670828, 4933440M02Rik, LOC100043014, Jmjd5, Nsmce1, EG244214, Il4ra
Downstream gene	Gsg1l, Xpo6, Sbk1, LOC100043495, Lat, 2210013K02Rik, Nfatc2ip, Cd19, Rabep2, Atp2a1, Sh2b1, Tufm, Atxn2l, Eif3s8, Cln3, Apob48r, Il27, Nupr1, Ccdc101, Sult1a1, LOC629029, Giyd2, Bola2, Coro1a, Snrp1c-ps1, LOC100043044, Mapk3, Gdpd3, Ypel3, Tbx6, Ppp4c, Aldoa, 1500016O10Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG545999 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545999 MGI:3646831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 80 ESTs

name	LOC670828 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	4933440M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71208 MGI:1918458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Jmjd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77035 MGI:1924285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsmce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67711 MGI:1914961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244214 MGI:3643455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 15 Proteins pseudo : _no_value

name	Il4ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16190 MGI:105367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il21r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60504 MGI:1890475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233863 MGI:107887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430042O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233865 MGI:2442760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsg1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269994 MGI:2685483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 5 Proteins

name	Xpo6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74204 MGI:2429950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins

name	Lat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16797 MGI:1342293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210013K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73658 MGI:1920908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfatc2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18020 MGI:1329015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12478 MGI:88319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70314 MGI:1917564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11937 MGI:105058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tufm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233870 MGI:1923686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atxn2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233871 MGI:2446242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56347 MGI:1926966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12752 MGI:107537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apob48r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171504 MGI:2176230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246779 MGI:2384409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nupr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56312 MGI:1891834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75565 MGI:1922815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20887 MGI:102896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Giyd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75764 MGI:1915220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bola2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66162 MGI:1913412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12721 MGI:1345961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrp1c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20631 MGI:109488
definition	gene_synonym : mC-[y]15 note : U1 small nuclear ribonucleoprotein 1C, pseudogene 1 pseudo : _no_value

name	LOC100043044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26417 MGI:1346859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68616 MGI:1915866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ypel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66090 MGI:1913340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tbx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21389 MGI:102539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56420 MGI:1891763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11674 MGI:87994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500016O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68952 MGI:1916202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 7 Proteins

name	EG545999 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381018 GeneID:545999 MGI:3646831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 80 ESTs product : predicted gene, EG545999 transcript_id : XM_620562.3

name	LOC100043014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257709 GeneID:100043014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001479314.1

name	Jmjd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374090 GeneID:77035 MGI:1924285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 5 transcript_id : NM_029842.2

name	Nsmce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328290 GeneID:67711 MGI:1914961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC element 1 homolog (S. cerevisiae) transcript_id : NM_026330.2

name	Il4ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186475 GeneID:16190 MGI:105367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 4 receptor, alpha transcript_id : NM_001008700.3

name	Il21r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11230785 GeneID:60504 MGI:1890475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 21 receptor transcript_id : NM_021887.1

name	Gtf3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402234 GeneID:233863 MGI:107887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor III C 1 transcript_id : NM_207239.1

name	D430042O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486627 GeneID:233865 MGI:2442760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430042O09 gene transcript_id : NM_001081022.1

name	Gsg1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381025 GeneID:269994 MGI:2685483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 5 Proteins product : GSG1-like transcript_id : XM_194378.6

name	Xpo6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537528 GeneID:74204 MGI:2429950
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 6 transcript_id : NM_028816.2

name	Sbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130171 GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-binding kinase 1 transcript_id : NM_145587.2

name	LOC100043495 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257781 GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480108.1

name	Lat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475924 GeneID:16797 MGI:1342293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : linker for activation of T cells transcript_id : NM_010689.2

name	2210013K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963794 GeneID:73658 MGI:1920908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210013K02 gene transcript_id : NM_023712.1

name	Nfatc2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802978 GeneID:18020 MGI:1329015
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein transcript_id : NM_010900.2

name	Cd19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753337 GeneID:12478 MGI:88319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD19 antigen transcript_id : NM_009844.1

name	Rabep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970572 GeneID:70314 MGI:1917564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabaptin, RAB GTPase binding effector protein 2 transcript_id : NM_030566.2

name	Atp2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:36031131 GeneID:11937 MGI:105058
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 transcript_id : NM_007504.2

name	Sh2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347323 GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 1 transcript_id : NM_011363.2

name	Sh2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347241 GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 1 transcript_id : NM_001081459.1

name	Tufm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350937 GeneID:233870 MGI:1923686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tu translation elongation factor, mitochondrial transcript_id : NM_172745.2

name	Atxn2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942088 GeneID:233871 MGI:2446242
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 2-like transcript_id : NM_183020.1

name	Eif3s8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203754 GeneID:56347 MGI:1926966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 8 transcript_id : NM_146200.1

name	Cln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560608 GeneID:12752 MGI:107537
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) transcript_id : NM_009907.2

name	Apob48r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19923862 GeneID:171504 MGI:2176230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B48 receptor transcript_id : NM_138310.1

name	Il27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704109 GeneID:246779 MGI:2384409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 27 transcript_id : NM_145636.1

name	Nupr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790144 GeneID:56312 MGI:1891834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear protein 1 transcript_id : NM_019738.1

name	Ccdc101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981319 GeneID:75565 MGI:1922815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 101 transcript_id : NM_029339.2

name	Sult1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526821 GeneID:20887 MGI:102896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1A, phenol-preferring, member 1 transcript_id : NM_133670.1

name	Giyd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386645 GeneID:75764 MGI:1915220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GIY-YIG domain containing 2 transcript_id : NM_029420.3

name	Bola2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802303 GeneID:66162 MGI:1913412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bolA-like 2 (E. coli) transcript_id : NM_175103.3

name	Coro1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982807 GeneID:12721 MGI:1345961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1A transcript_id : NM_009898.2

name	Mapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102422 GeneID:26417 MGI:1346859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 3 transcript_id : NM_011952.2

name	Gdpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431345 GeneID:68616 MGI:1915866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 3 transcript_id : NM_024228.2

name	Ypel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053874 GeneID:66090 MGI:1913340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 3 (Drosophila) transcript_id : NM_026875.2

name	Ypel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053931 GeneID:66090 MGI:1913340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 3 (Drosophila) transcript_id : NM_025347.2

name	Tbx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48928034 GeneID:21389 MGI:102539
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 6 transcript_id : NM_011538.2

name	Ppp4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130591 GeneID:56420 MGI:1891763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 4, catalytic subunit transcript_id : NM_019674.3

name	Aldoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709447 GeneID:11674 MGI:87994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldolase 1, A isoform transcript_id : NM_007438.3

name	1500016O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257783 GeneID:68952 MGI:1916202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 4 Proteins product : RIKEN cDNA 1500016O10 gene transcript_id : XM_001480258.1

name	EG545999 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63562014 GeneID:545999 MGI:3646831
definition	codon_start : 1 product : similar to glutamate dehydrogenase (NAD(P)+) protein_id : XP_620562.1

name	LOC100043014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257710 GeneID:100043014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479364.1

name	Jmjd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313318 CCDS:CCDS21821.1 GeneID:77035 MGI:1924285
definition	codon_start : 1 product : jumonji domain containing 5 protein_id : NP_084118.1

name	Nsmce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328291 CCDS:CCDS21822.1 GeneID:67711 MGI:1914961
definition	codon_start : 1 product : non-SMC element 1 homolog protein_id : NP_080606.2

name	Il4ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56785428 GeneID:16190 MGI:105367
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : IL-4 receptor alpha chain product : interleukin 4 receptor, alpha protein_id : NP_001008700.1

name	Il21r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230786 CCDS:CCDS21823.1 GeneID:60504 MGI:1890475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA] [Evidence ISS]; GO:0004907 - interleukin receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 product : interleukin 21 receptor protein_id : NP_068687.1

name	Gtf3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402235 GeneID:233863 MGI:107887
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : general transcription factor III C 1 protein_id : NP_997122.1

name	D430042O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486628 GeneID:233865 MGI:2442760
definition	codon_start : 1 product : hypothetical protein LOC233865 protein_id : NP_001074491.1

name	Gsg1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51761966 GeneID:269994 MGI:2685483
definition	codon_start : 1 product : GSG1-like protein_id : XP_194378.4

name	Xpo6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537529 GeneID:74204 MGI:2429950
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006611 - protein export from nucleus [Evidence ISS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RAN binding protein 20 product : exportin 6 protein_id : NP_083092.2

name	Sbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704180 CCDS:CCDS21824.1 GeneID:104175 MGI:2135937
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : CG4945-like product : SH3-binding kinase 1 protein_id : NP_663562.1

name	LOC100043495 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257782 GeneID:100043495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480158.1

name	Lat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754510 CCDS:CCDS21825.1 GeneID:16797 MGI:1342293
definition	GO_component : GO:0001772 - immunological synapse [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005057 - receptor signaling protein activity [Evidence TAS]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0019722 - calcium-mediated signaling [Evidence ISS]; GO:0006968 - cellular defense response [Evidence TAS]; GO:0006955 - immune response [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0043303 - mast cell degranulation [Evidence IEA]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0050863 - regulation of T cell activation [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 note : linker protein product : linker for activation of T cells protein_id : NP_034819.1

name	2210013K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963795 CCDS:CCDS21826.1 GeneID:73658 MGI:1920908
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : spinster-like protein product : spinster protein_id : NP_076201.1

name	Nfatc2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468909 CCDS:CCDS21827.1 GeneID:18020 MGI:1329015
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation note : nuclear factor of activated T-cells, cytoplasmic 2 interacting protein product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein protein_id : NP_035030.1

name	Cd19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753338 CCDS:CCDS21828.1 GeneID:12478 MGI:88319
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD19 antigen protein_id : NP_033974.1

name	Rabep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970573 CCDS:CCDS21829.1 GeneID:70314 MGI:1917564
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fos-related antigen product : rabaptin, RAB GTPase binding effector protein 2 protein_id : NP_085043.2

name	Atp2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36031132 GeneID:11937 MGI:105058
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005793 - ER-Golgi intermediate compartment [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS]; GO:0016529 - sarcoplasmic reticulum [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005388 - calcium-transporting ATPase activity [Evidence ISS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006200 - ATP catabolism [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence ISS]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0045988 - negative regulation of striated muscle contraction [Evidence ISS]; GO:0015992 - proton transport [Evidence IEA]; GO:0006937 - regulation of muscle contraction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATPase, Ca++ transporting, fast twitch 1 protein_id : NP_031530.2

name	Sh2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347242 GeneID:20399 MGI:1201407
definition	GO_component : GO:0001726 - ruffle [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006928 - cell motility [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; SH2-B PH domain containing signaling mediator 1 product : SH2-B PH domain containing signaling mediator 1 isoform 1 protein_id : NP_001074928.1

name	Sh2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347324 GeneID:20399 MGI:1201407
definition	GO_component : GO:0001726 - ruffle [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006928 - cell motility [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; SH2-B PH domain containing signaling mediator 1 product : SH2-B PH domain containing signaling mediator 1 isoform 2 protein_id : NP_035493.2

name	Tufm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370092 CCDS:CCDS21830.1 GeneID:233870 MGI:1923686
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Tu translation elongation factor, mitochondrial protein_id : NP_766333.1

name	Atxn2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942089 CCDS:CCDS21831.1 GeneID:233871 MGI:2446242
definition	GO_component : GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ataxin 2 related protein product : ataxin 2-like protein_id : NP_898841.1

name	Eif3s8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203755 CCDS:CCDS21832.1 GeneID:56347 MGI:1926966
definition	GO_component : GO:0005852 - eukaryotic translation initiation factor 3 complex [Evidence ISS] [Evidence IEA] GO_function : GO:0043022 - ribosome binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence ISS] [Evidence IEA] codon_start : 1 note : NIPI-like protein; eukaryotic translation initiation factor 3, subunit 8 (110 kDa) product : eukaryotic translation initiation factor 3, subunit 8 protein_id : NP_666312.1

name	Cln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560609 CCDS:CCDS21833.1 GeneID:12752 MGI:107537
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IMP]; GO:0006865 - amino acid transport [Evidence IMP]; GO:0008306 - associative learning [Evidence IMP]; GO:0035235 - ionotropic glutamate receptor signaling pathway [Evidence IMP]; GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0016044 - membrane organization and biogenesis [Evidence IMP]; GO:0045861 - negative regulation of proteolysis [Evidence IMP]; GO:0042133 - neurotransmitter metabolism [Evidence IMP]; GO:0016485 - protein processing [Evidence IMP]; GO:0001508 - regulation of action potential [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP] codon_start : 1 exception : mismatches in translation note : battenin product : ceroid-lipofuscinosis, neuronal 3 protein_id : NP_034037.2

name	Apob48r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923863 CCDS:CCDS21834.1 GeneID:171504 MGI:2176230
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0030226 - apolipoprotein receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : apolipoprotein B48 receptor protein_id : NP_612183.1

name	Il27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704110 CCDS:CCDS21835.1 GeneID:246779 MGI:2384409
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0045523 - interleukin-27 receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0042129 - regulation of T cell proliferation [Evidence IDA] codon_start : 1 note : interleukin 30; IL-27 p28 subunit product : interleukin 27 protein_id : NP_663611.1

name	Nupr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790145 GeneID:56312 MGI:1891834
definition	codon_start : 1 product : p8 protein protein_id : NP_062712.1

name	Ccdc101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981320 CCDS:CCDS21837.1 GeneID:75565 MGI:1922815
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 101 protein_id : NP_083615.2

name	Sult1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526822 GeneID:20887 MGI:102896
definition	GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IDA]; GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0017067 - tyrosine-ester sulfotransferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : sulfotransferase, phenol preferring 1; arylsulfotransferase ST1A4 product : sulfotransferase family 1A, phenol-preferring, member 1 protein_id : NP_598431.1

name	Giyd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62543493 CCDS:CCDS21838.1 GeneID:75764 MGI:1915220
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 product : GIY-YIG domain containing 2 protein_id : NP_083696.2

name	Bola2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171318 GeneID:66162 MGI:1913412
definition	GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] codon_start : 1 product : BolA-2 protein protein_id : NP_780312.1

name	Coro1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753492 CCDS:CCDS21840.1 GeneID:12721 MGI:1345961
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : coronin-like actin binding protein; coronin 1a product : coronin, actin binding protein 1A protein_id : NP_034028.1

name	Mapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489933 CCDS:CCDS21841.1 GeneID:26417 MGI:1346859
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IPI] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : protein kinase, mitogen activated kinase 3; p44 MAP kinase product : mitogen activated protein kinase 3 protein_id : NP_036082.1

name	Gdpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431346 GeneID:68616 MGI:1915866
definition	codon_start : 1 product : glycerophosphodiester phosphodiesterase domain containing 3 protein_id : NP_077190.2

name	Ypel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313616 CCDS:CCDS21842.1 GeneID:66090 MGI:1913340
definition	codon_start : 1 note : small ubiquitinated apoptotic protein product : yippee-like 3 protein_id : NP_079623.1

name	Ypel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053875 CCDS:CCDS21842.1 GeneID:66090 MGI:1913340
definition	codon_start : 1 note : small ubiquitinated apoptotic protein product : yippee-like 3 protein_id : NP_081151.2

name	Tbx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48928035 CCDS:CCDS21843.1 GeneID:21389 MGI:102539
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001708 - cell fate specification [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : rib-vertebrae product : T-box 6 protein_id : NP_035668.2

name	Ppp4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790175 CCDS:CCDS21844.1 GeneID:56420 MGI:1891763
definition	GO_component : GO:0005813 - centrosome [Evidence NAS]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence NAS] [Evidence IEA]; GO:0004704 - NF-kappaB-inducing kinase activity [Evidence NAS]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence TAS] [Evidence NAS] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence NAS] codon_start : 1 note : protein phosphatase X product : protein phosphatase 4, catalytic subunit protein_id : NP_062648.1

name	Aldoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671539 CCDS:CCDS21845.1 GeneID:11674 MGI:87994
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004332 - fructose-bisphosphate aldolase activity [Evidence IDA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : aldolase 1, A isoform protein_id : NP_031464.1

name	1500016O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257784 GeneID:68952 MGI:1916202
definition	codon_start : 1 product : hypothetical protein LOC68952 protein_id : XP_001480308.1

name	LOC670828 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670828
definition	number : 1 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 6 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 5 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 4 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 3 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 2 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 1 pseudo : _no_value

name	LOC100043044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043044
definition	number : 1 pseudo : _no_value

name	4933440M02Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257780 GeneID:71208 MGI:1918458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 4933440M02 gene transcript_id : XR_035453.1

name	EG244214 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257711 GeneID:244214 MGI:3643455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 15 Proteins product : predicted gene, EG244214 pseudo : _no_value transcript_id : XR_002216.2

clone name	MSMg01-417C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-248N09.b	B6Ng01-248N09.g
ACC	GA056811	GA056812
length	1,092	317
definition	B6Ng01-248N09.b	B6Ng01-248N09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(132,965,010 - 132,966,097)	(132,743,743 - 132,744,059)
sequence	gaattctttaggcactctgtatccaactgggactactgtggcaaacagtt gcatggaccaagcagctactggggtcttagcctctctagtacagatggcc actgctagaccaggctggcctctaactttgaaagattagcctgcctctgc ctcctgagtgctgggattaaaagcatgtgccatcacatgcctggctgccc tcccttcctccagtctttcctcttgcccttcctttctggtagagctgtag atagaacataggacccaggtcattctagataagaaatatactactactag gtggtacccaagccttggggtgtttgtttgttgttttttcctttattttt gagtgagagacaaggtactgcaagaatagcctcaaatacctgatcctcct gcctcagcctcgtcttgaatacaaatgcctgctactatgctgcctgacta taacaaatgtcctttaaaaatatatgctcaagtgggactgcagagatatt tgagcggttaagagcactgttgctcttgcagaaacctggggttggttcct agtgtccacatggtggttcaggacacctcttactctagttccactgaatc tggtgcaggcactgcacacacttggtacacatacagggaaaaggcaaata ctcatacacataaaataaaaataaatcttaaaaatatgctaaagtgagcc aaactcagtttctactgctgaaaatctaaagtttttaacggattaattta cctcccatctcctattttaaggagagcagaaagcagactctcatagatag caggtaagtcttctaagatcatacagaaagagcaacagctgaggatttta gaatagctgcttcttctttaactgagggcctgatgtgatccacccccgtc catgtttaacatggcccttccagcactgactaggtattgcagtatcatgc tcccttgaatagaacaagaaattcagtcaaagctaaggagttcatcttgt gggcagaggctgtggagctggccttgaacctcagctgtctgcatcttcag gtctgtagtatgacatagatcttagaagaagcacatcagagc	tcatgtttcatccaaatcaaatccgcgcccagaggtgagcatgctgtatg atcccccacgctctctgttctttcccatcttcacacgtgtgcatcctgcc tcacgtgatgacgtcatgctgtcagtctgtctgtcttctctaccagagat gggctccacgagggctgtcctttgtacacctttctaaggcacttcattag gatgtacccaagggcccacttcacgggaaaggatggagggaaggaagaag gggctggctgagtctgcagaggagtgaatgagtggacaggggatgggcag ggtgtggagagggagtg
quality values	Open. Hide. 58 29 9 26 58 54 58 58 36 48 45 49 42 46 54 58 58 58 58 49 54 54 62 38 27 62 62 62 54 62 62 41 47 56 56 47 56 62 43 37 54 56 62 62 62 62 47 62 62 62 62 62 56 62 62 62 41 54 54 62 62 62 62 62 62 62 59 62 35 62 59 62 62 49 62 62 62 62 62 56 62 62 62 62 62 62 59 62 59 59 62 62 59 62 59 62 62 62 62 59 62 59 59 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 49 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 54 52 58 58 58 58 58 58 54 41 58 58 58 58 54 58 47 41 41 54 54 58 58 58 58 58 58 58 54 54 54 58 58 52 58 46 58 54 42 58 58 58 58 58 58 58 54 58 58 58 54 52 49 58 58 48 58 58 58 58 58 58 51 46 53 58 58 53 49 50 58 47 58 52 58 58 39 42 45 47 42 49 51 58 58 41 58 58 50 58 52 52 24 58 39 50 53 47 58 58 58 58 42 52 47 53 54 50 51 52 54 53 50 49 34 49 54 58 58 54 53 53 52 58 58 52 53 50 50 22 58 40 39 39 53 53 52 49 52 52 44 36 51 58 42 58 54 41 40 50 39 53 40 54 50 58 37 50 49 49 42 58 58 49 27 51 26 42 54 37 39 42 53 53 53 34 52 42 53 28 52 37 51 31 54 54 41 42 37 54 54 54 30 45 26 54 41 41 49 42 54 52 54 54 54 37 40 40 52 40 45 45 34 54 51 37 53 52 51 30 17 42 33 54 38 31 41 34 32 28 51 54 53 53 34 32 40 32 40 35 32 32 52 52 51 31 36 45 40 31 51 28 27 52 53 53 49 35 29 30 32 17 53 33 31 20 14 35 35 53 34 29 32 31 42 31 51 46 31 31 31 31 31 38 32 37 41 51 51 32 33 19 18 28 30 25 43 24 24 30 12 41 51 31 25 31 31 22 33 18 33 32 33 34 21 30 31 24 31 32 29 24 31 17 19 27 26 29 31 21 30 28 16 42 38 32 28 33 12 28 28 28 25 33 25 31 17 21 30 46 8 22 19 12 32 28 31 27 24 22 32 32 27 31 10 15 22 13 46 46 16 30 8 18 27 21 26 26 37 36 34 31 24 38 34 33 18 38 34 44 23 19 33 31 21 20 26 14 41 19 9 22 19 31 32 24 35 13 10 24 21 11 18 11 31 38 48 44 27 19 33 17 19 14 25 33 15 36 32 11 8 8 9 21 20 11 4 22 19 10 20 8 19 22 22 29 18 18 33 18 15 24 32 15 12 15 13 18 9 16 11 27 25 15 8 20 27 18 16 15 21 15 14 11 14 12 5 8 25 20 10 16 9 8 17 6 6 14 25 11 28 38 29 12 19 16 29 24 28 14 18 24 14 4 5 7 11 9 3 6 28 9 16 6 6 9 10 8 5 4 5 4 16 22 15 7 5 7 28 13 28 16 22 6 5 7 12 27 9 21 11 27 28 11 10 27 20 16 6 7 8 7 6 6 5 4 5 5 5 4 4 5 10 12 9 6 10 8 4 23 4 4 4 3 5 7 20 6 7 4 13 3 3 5 2 1 5 18 3 4 11 16 16 16 14 8 4 14 24 9 26 25 5 20 6 6 4 11 4 1 2 2 3 4	Open. Hide. 62 42 42 62 62 56 50 36 44 20 46 38 20 22 50 59 62 59 59 62 62 62 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 56 62 62 62 54 56 62 62 62 62 54 62 62 62 62 62 62 49 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_132965010_132966097
seq2: B6Ng01-248N09.b_50_1141 (reverse)

seq1  GCTCTGA-GTGCTTCTTCTAAGATCTTAATGTCCCTAACTACAGA-CTGG  48
      ||||||| ||||||||||||||||||  ||||  |  |||||||| ||| 
seq2  GCTCTGATGTGCTTCTTCTAAGATCT--ATGT--CATACTACAGACCTGA  46

seq1  AGATGCAGACAGACTGAGGTCCAAAGCCAGCT-CACAGCCTCTGCCCAC-  96
      |||||||||||| ||||||| ||| ||||||| |||||||||||||||| 
seq2  AGATGCAGACAG-CTGAGGTTCAAGGCCAGCTCCACAGCCTCTGCCCACA  95

seq1  AGATGACTCCCTTAGCTTTGACTTGATTTCTTG-TCTA-TCAGGGGAGCA  144
      ||||||   ||||||||||||||  |||||||| |||| ||| |||||||
seq2  AGATGAACTCCTTAGCTTTGACTGAATTTCTTGTTCTATTCAAGGGAGCA  145

seq1  TGATACTGC-ATACCTAGTCAGTGCTGGAAGGGCCATG-TAAACATGGAC  192
      ||||||||| |||||||||||||||||||||||||||| |||||||||||
seq2  TGATACTGCAATACCTAGTCAGTGCTGGAAGGGCCATGTTAAACATGGAC  195

seq1  GGGG--TGATCACATCAGGCCCTCAGTTAAAGAAGAAGCAGCTATTCTTA  240
      ||||   |||||||||||||||||||||||||||||||||||||||| ||
seq2  GGGGGTGGATCACATCAGGCCCTCAGTTAAAGAAGAAGCAGCTATTC-TA  244

seq1  AAATCCTCAGCTGTTGCTCCTTCTGTATGATCTTAGAAGACTTACCTGCT  290
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  AAATCCTCAGCTGTTGCTCTTTCTGTATGATCTTAGAAGACTTACCTGCT  294

seq1  ATCTATGAGAGTCTGCTTTCTGCTCTCCTTAAAATAGGAGATGGGAGGTA  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTATGAGAGTCTGCTTTCTGCTCTCCTTAAAATAGGAGATGGGAGGTA  344

seq1  AATTAATCCGTTAAAAACTTTAGATTTTCAGCAGTAGAAACTGAGTTTGG  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAATCCGTTAAAAACTTTAGATTTTCAGCAGTAGAAACTGAGTTTGG  394

seq1  CTCACTTTAGCATATTTTTAAGATTTATTTTTATTTTATGTGTATGAGTA  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTTTAGCATATTTTTAAGATTTATTTTTATTTTATGTGTATGAGTA  444

seq1  TTTGCCTTTTCCCTGTATGTGTACCAAGTGTGTGCAGTGCCTGCACCAGA  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCCTTTTCCCTGTATGTGTACCAAGTGTGTGCAGTGCCTGCACCAGA  494

seq1  TTCAGTGGAACTAGAGTAAGAGGTGTCCTGAACCACCATGTGGACACTAG  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGTGGAACTAGAGTAAGAGGTGTCCTGAACCACCATGTGGACACTAG  544

seq1  GAACCAACCCCAGGTTTCTGCAAGAGCAACAGTGCTCTTAACCGCTCAAA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCAACCCCAGGTTTCTGCAAGAGCAACAGTGCTCTTAACCGCTCAAA  594

seq1  TATCTCTGCAGTCCCACTTGAGCATATATTTTTAAAGGACATTTGTTATA  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTCTGCAGTCCCACTTGAGCATATATTTTTAAAGGACATTTGTTATA  644

seq1  GTCAGGCAGCATAGTAGCAGGCATTTGTATTCAAGACGAGGCTGAGGCAG  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGGCAGCATAGTAGCAGGCATTTGTATTCAAGACGAGGCTGAGGCAG  694

seq1  GAGGATCAGGTATTTGAGGCTATTCTTGCAGTACCTTGTCTCTCACTCAA  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATCAGGTATTTGAGGCTATTCTTGCAGTACCTTGTCTCTCACTCAA  744

seq1  AAATAAAGGAAAAAACAACAAACAAACACCCCAAGGCTTGGGTACCACCT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAAGGAAAAAACAACAAACAAACACCCCAAGGCTTGGGTACCACCT  794

seq1  AGTAGTAGTATATTTCTTATCTAGAATGACCTGGGTCCTATGTTCTATCT  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGTAGTATATTTCTTATCTAGAATGACCTGGGTCCTATGTTCTATCT  844

seq1  ACAGCTCTACCAGAAAGGAAGGGCAAGAGGAAAGACTGGAGGAAGGGAGG  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCTCTACCAGAAAGGAAGGGCAAGAGGAAAGACTGGAGGAAGGGAGG  894

seq1  GCAGCCAGGCATGTGATGGCACATGCTTTTAATCCCAGCACTCAGGAGGC  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCCAGGCATGTGATGGCACATGCTTTTAATCCCAGCACTCAGGAGGC  944

seq1  AGAGGCAGGCTAATCTTTCAAAGTTAGAGGCCAGCCTGGTCTAGCAGTGG  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCAGGCTAATCTTTCAAAGTTAGAGGCCAGCCTGGTCTAGCAGTGG  994

seq1  CCATCTGTACTAGAGAGGCTAAGACCCCAGTAGCTGCTTGGTCCATGCAA  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTGTACTAGAGAGGCTAAGACCCCAGTAGCTGCTTGGTCCATGCAA  1044

seq1  CTGTTTGCCACAGTAGTCCCAGTTGGATACAGAGTGCCTAAAGAATTC  1088
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTGCCACAGTAGTCCCAGTTGGATACAGAGTGCCTAAAGAATTC  1092

seq1: chr7_132743743_132744059
seq2: B6Ng01-248N09.g_75_391

seq1  TCATGTTTCATCCAAATCAAATCCGCGCCCAGAGGTGAGCATGCTGTATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGTTTCATCCAAATCAAATCCGCGCCCAGAGGTGAGCATGCTGTATG  50

seq1  ATCCCCCACGCTCTCTGTTCTTTCCCATCTTCACACGTGTGCATCCTGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCCCACGCTCTCTGTTCTTTCCCATCTTCACACGTGTGCATCCTGCC  100

seq1  TCACGTGATGACGTCATGCTGTCAGTCTGTCTGTCTTCTCTACCAGAGAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGTGATGACGTCATGCTGTCAGTCTGTCTGTCTTCTCTACCAGAGAT  150

seq1  GGGCTCCACGAGGGCTGTCCTTTGTACACCTTTCTAAGGCACTTCATTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTCCACGAGGGCTGTCCTTTGTACACCTTTCTAAGGCACTTCATTAG  200

seq1  GATGTACCCAAGGGCCCACTTCACGGGAAAGGATGGAGGGAAGGAAGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTACCCAAGGGCCCACTTCACGGGAAAGGATGGAGGGAAGGAAGAAG  250

seq1  GGGCTGGCTGAGTCTGCAGAGGAGTGAATGAGTGGACAGGGGATGGGCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGGCTGAGTCTGCAGAGGAGTGAATGAGTGGACAGGGGATGGGCAG  300

seq1  GGTGTGGAGAGGGAGTG  317
      |||||||||||||||||
seq2  GGTGTGGAGAGGGAGTG  317

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information